ID: 953831352

View in Genome Browser
Species Human (GRCh38)
Location 3:46300223-46300245
Sequence CAAAGCTCAGACTTTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953831352_953831353 6 Left 953831352 3:46300223-46300245 CCTACTTTAAAGTCTGAGCTTTG No data
Right 953831353 3:46300252-46300274 TGCAAAAAGAGAGATACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953831352 Original CRISPR CAAAGCTCAGACTTTAAAGT AGG (reversed) Intergenic
No off target data available for this crispr