ID: 953842059

View in Genome Browser
Species Human (GRCh38)
Location 3:46397036-46397058
Sequence CCTGAAAAGCAGACATTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953842051_953842059 11 Left 953842051 3:46397002-46397024 CCCCATCTCTGACAAGTAGGTGG No data
Right 953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG No data
953842053_953842059 10 Left 953842053 3:46397003-46397025 CCCATCTCTGACAAGTAGGTGGT No data
Right 953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG No data
953842054_953842059 9 Left 953842054 3:46397004-46397026 CCATCTCTGACAAGTAGGTGGTC No data
Right 953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953842059 Original CRISPR CCTGAAAAGCAGACATTAGG AGG Intergenic
No off target data available for this crispr