ID: 953843748

View in Genome Browser
Species Human (GRCh38)
Location 3:46410425-46410447
Sequence AAGGAAAGTGCCTCCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953843748_953843753 5 Left 953843748 3:46410425-46410447 CCTTCACAGGAGGCACTTTCCTT 0: 1
1: 0
2: 0
3: 15
4: 209
Right 953843753 3:46410453-46410475 GCAAAAACGATGATACCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
953843748_953843752 4 Left 953843748 3:46410425-46410447 CCTTCACAGGAGGCACTTTCCTT 0: 1
1: 0
2: 0
3: 15
4: 209
Right 953843752 3:46410452-46410474 GGCAAAAACGATGATACCCATGG 0: 1
1: 0
2: 0
3: 5
4: 79
953843748_953843756 23 Left 953843748 3:46410425-46410447 CCTTCACAGGAGGCACTTTCCTT 0: 1
1: 0
2: 0
3: 15
4: 209
Right 953843756 3:46410471-46410493 ATGGGCACAGCATCTCACATAGG 0: 1
1: 0
2: 0
3: 12
4: 172
953843748_953843757 24 Left 953843748 3:46410425-46410447 CCTTCACAGGAGGCACTTTCCTT 0: 1
1: 0
2: 0
3: 15
4: 209
Right 953843757 3:46410472-46410494 TGGGCACAGCATCTCACATAGGG 0: 1
1: 0
2: 1
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953843748 Original CRISPR AAGGAAAGTGCCTCCTGTGA AGG (reversed) Intronic
900931955 1:5743330-5743352 AAGGACACTGCTTCCTGGGAAGG + Intergenic
901807808 1:11749104-11749126 AGGGAAAGTGCCCCCTGTTCAGG - Intronic
902779791 1:18697637-18697659 AAGGGAGGTGCCTACTGGGAAGG + Intronic
904207369 1:28863767-28863789 TAGGGAGGAGCCTCCTGTGAGGG + Intergenic
904262692 1:29299075-29299097 AGGGAAAGTGCCACCACTGAGGG + Intronic
907938361 1:59063179-59063201 AAGGTAAGTAGCTTCTGTGATGG - Intergenic
908030026 1:59989202-59989224 AAGGTTCGTGCTTCCTGTGAAGG - Intronic
908491501 1:64648753-64648775 CAGGAAATTGAATCCTGTGAAGG - Intronic
910534609 1:88282941-88282963 ATGGAAAGTGCTTTGTGTGAAGG - Intergenic
912557655 1:110527907-110527929 AAATAAACTGCCTCCTGGGAGGG - Intergenic
913686260 1:121234881-121234903 AAGGAACCTGCCTCTGGTGAGGG - Intronic
914038111 1:144022503-144022525 AAGGAACCTGCCTCTGGTGAGGG - Intergenic
914151343 1:145045437-145045459 AAGGAACCTGCCTCTGGTGAGGG + Intronic
916570978 1:166027410-166027432 AATGAAAGTCCCTTTTGTGAAGG + Intergenic
917002534 1:170375306-170375328 GAAGCAAGGGCCTCCTGTGAAGG + Intergenic
917457142 1:175194605-175194627 GAGGAACTTGCCTTCTGTGAAGG + Intergenic
918498724 1:185169943-185169965 AAAGAAACTGCCTTCTCTGAAGG + Intronic
919435206 1:197550414-197550436 AATGAAAGTACCTCCTTTGCTGG + Intronic
920156466 1:203956031-203956053 AAGCAAAGGGCCTTCTATGAAGG + Intergenic
920473582 1:206253440-206253462 AAGGAACCTGCCTCTGGTGAGGG - Intronic
920497353 1:206464733-206464755 AAGGAAGGTGGATTCTGTGAAGG - Intergenic
1063156035 10:3379908-3379930 GAGGAAGGTGCCTCCTGAGACGG + Intergenic
1063220211 10:3960209-3960231 AGGCAAAGTGCCATCTGTGAAGG - Intergenic
1064414693 10:15138849-15138871 AAAGAAATTCCCTACTGTGATGG + Intronic
1065012640 10:21433309-21433331 AAGGTAAATGGCTCCTGTTAGGG - Intergenic
1070342659 10:75511765-75511787 AGGGAAAGTGCCTCATATGAAGG - Intronic
1070958111 10:80478069-80478091 AAAGAAAGTGCCTAATATGAAGG + Intronic
1070976097 10:80606962-80606984 AATAAAAGTGACTCCTTTGAAGG + Intronic
1073755419 10:106575909-106575931 AGGGCAATTTCCTCCTGTGACGG - Exonic
1074020474 10:109577336-109577358 CAAGAAATTGGCTCCTGTGATGG - Intergenic
1076208936 10:128625415-128625437 AAAGGAAGTGCTTCCTGTGTGGG + Intergenic
1076477135 10:130760944-130760966 AATGGAAGTGCCTCCTCTGCAGG + Intergenic
1078366642 11:10712138-10712160 AAGGAGAGTGCCATCTGTCATGG - Intergenic
1078536510 11:12179277-12179299 ACGGAAAGTGCCTACAGTGCTGG - Intronic
1083189725 11:61041263-61041285 GAGGAAAGTGCCTCCTGTTGTGG + Intergenic
1083235265 11:61346920-61346942 AAAGACACTGCCTCCTCTGAGGG + Exonic
1083795133 11:65012419-65012441 AACCTAAGTGCCTCCAGTGAGGG - Intergenic
1083988443 11:66232138-66232160 AAAGAAAGTGTCTCTTGTTAGGG - Intronic
1084249728 11:67888159-67888181 AAGGGGAGGGGCTCCTGTGATGG + Intergenic
1086604795 11:88683984-88684006 AAGGAAATTGCATTCTGAGATGG + Intronic
1095658789 12:44703725-44703747 GAGGATAATGCCTACTGTGAAGG - Exonic
1096776672 12:53968560-53968582 AAGGAAAGTGCCTTCTGCTCAGG - Intergenic
1097652680 12:62320969-62320991 AAAGAAAGTGCCTTGTTTGAAGG - Intronic
1099241253 12:80142102-80142124 GAGGAGAGAGACTCCTGTGAAGG + Intergenic
1104622484 12:130328417-130328439 AAGGAAAGTGCCTGCAGTTTTGG - Intergenic
1105655613 13:22434273-22434295 AGGAAAAGTGGCTCCTCTGAAGG + Intergenic
1108531332 13:51330033-51330055 AAGGCACGTGCCACCTGTCAGGG - Intergenic
1109477579 13:62902892-62902914 AAGGAAAGTGCCTTTCATGAAGG + Intergenic
1111062692 13:83044112-83044134 AAGAAAAGTCACTACTGTGAAGG - Intergenic
1112690989 13:101893652-101893674 AAGGAAAGTGCCACGTGATAAGG + Intronic
1113949901 13:114066132-114066154 GAGGAAAGAGCCTCATGTGCAGG - Intronic
1122136086 14:99633707-99633729 AAGGACAGTGGCCCCTGTAAGGG - Intergenic
1123120860 14:105916252-105916274 AAGGAAAGTGCCTGATGCAAGGG - Intergenic
1123867703 15:24537950-24537972 TAGCAAAGTGCCTCCCTTGATGG - Intergenic
1124405007 15:29384555-29384577 AAGGGAGGTGCCTCCAGTGCTGG - Intronic
1124494597 15:30178651-30178673 GTGGAAAGAGGCTCCTGTGAGGG - Intergenic
1124748973 15:32359994-32360016 GTGGAAAGAGGCTCCTGTGAGGG + Intergenic
1125115838 15:36090682-36090704 AAGGATAGGGCCTAATGTGAGGG + Intergenic
1129527951 15:76234459-76234481 AAGGAAAGTGCCTCAGGGAAGGG - Intronic
1129797855 15:78391708-78391730 AAAAATAGTGCCTCCTGTAATGG + Intergenic
1129888022 15:79052245-79052267 AAAGAAAGTGTCTCCAGAGAGGG - Intronic
1130083420 15:80755913-80755935 AAGGACAGTGCCTCTTTTGTTGG + Intergenic
1133314124 16:4871556-4871578 AAGGAAAGTGCATATTGAGATGG - Intronic
1133868252 16:9664051-9664073 AAGAAAAGTACATCCTGGGAAGG + Intergenic
1135281706 16:21158647-21158669 AAGGAAAGAGCGTCCCGAGAGGG - Exonic
1135550986 16:23398217-23398239 AAAGACAGTGCCTCCAGGGAAGG - Intronic
1137349313 16:47697492-47697514 AAGGAAAGTGTCTTCTGCAAAGG - Intronic
1139927206 16:70496126-70496148 AAGGAAAATTCCTCCTTTAAGGG - Intronic
1140083046 16:71768547-71768569 TAGGACATTGACTCCTGTGATGG - Intronic
1140690568 16:77479360-77479382 AAGGAAAGCGCTTCCTCTAAAGG + Intergenic
1140779192 16:78278382-78278404 AAGGAAGGAGCTTCCTGTCAGGG + Intronic
1140964869 16:79955856-79955878 AAGGAAAATGCCTACTGTTGCGG - Intergenic
1141994895 16:87630155-87630177 AAGGCCAGTGCCTCCAGTGTGGG - Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143284877 17:5781523-5781545 AATCAAAGTGGCACCTGTGAAGG - Intronic
1148457011 17:47816543-47816565 AGGGTAAGTGCCTGCTGGGAGGG - Exonic
1148498567 17:48071162-48071184 AAGCAAAGGGCCTTCTATGAAGG - Exonic
1151389043 17:73773238-73773260 AAGGAAAGAGCCACCTGGGATGG - Intergenic
1151887197 17:76930071-76930093 ATGGACAGAGCCTCCTGAGATGG + Intronic
1152401628 17:80070067-80070089 AAGGACAGTGTCCCCTTTGAGGG - Intronic
1153043041 18:832140-832162 GAGGGAAGTGGCTCCTGTAAGGG + Intergenic
1155305611 18:24475124-24475146 AAGGATTGTGGGTCCTGTGATGG + Intronic
1155842932 18:30668418-30668440 GAGGAAAGAGGCTGCTGTGAAGG + Intergenic
1158303535 18:56079503-56079525 AAGGACAGTACATCCTGGGATGG + Intergenic
1158387960 18:57016024-57016046 AGGGAAAATGCCTCAGGTGAAGG + Intronic
1160597271 18:79984986-79985008 CATGAAATTGTCTCCTGTGACGG + Intronic
1160597278 18:79985043-79985065 CATGAAATTGTCTCCTGTGACGG + Intronic
1160597283 18:79985100-79985122 CATGAAATTGTCTCCTGTGATGG + Intronic
1160677112 19:397377-397399 AATGAAAACGCCACCTGTGACGG + Intergenic
1161224818 19:3138591-3138613 AAAGAAAGGGCCCCCAGTGAAGG - Intronic
1161857832 19:6775843-6775865 AAGGAAAGGTGCTCCTGTGGAGG + Intronic
1163813344 19:19448245-19448267 AACAAAGGTGCCGCCTGTGAAGG - Intronic
1165431203 19:35774485-35774507 AAGGAGAGACCCTCCTGTGAAGG + Intergenic
1166206732 19:41274985-41275007 AAGGAGAGCGCCTCATGGGAGGG + Intronic
1166370069 19:42295459-42295481 ATGCAAAATGGCTCCTGTGAGGG + Exonic
1168030069 19:53672542-53672564 AAAAAAAGTGCTTCCTGTGAAGG + Intergenic
1168466273 19:56604487-56604509 AAACACAGTGCCTCGTGTGATGG - Intronic
925972565 2:9116684-9116706 AAGGACAGTGCTCACTGTGAAGG + Intergenic
926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG + Intergenic
927467452 2:23348035-23348057 AAGAAAAGTTCCTGCTGGGAAGG - Intergenic
929532639 2:42762356-42762378 AAGGACAGTGCCCCCTGGGATGG + Intergenic
930703462 2:54482726-54482748 AATGAAACTGTCTGCTGTGATGG - Intronic
933878537 2:86644995-86645017 AAGCAAAGTGCCTGCTTTCAAGG + Intronic
934085412 2:88505184-88505206 AAGGAAAGTGAAACTTGTGAGGG + Intergenic
935361534 2:102250435-102250457 CAGGAAAGGGCTTCCTGTCACGG + Intergenic
936742091 2:115524436-115524458 AGAGAAAGAGCCTCCTGTGCTGG - Intronic
939547003 2:143566760-143566782 CAGGAAAGGGCTTCCTGAGAAGG - Intronic
943139792 2:183967948-183967970 AATGGAAGTGCATCCTGTGCAGG - Intergenic
943242349 2:185401054-185401076 AATCAAAGATCCTCCTGTGAAGG + Intergenic
944078720 2:195760339-195760361 AGGGAAACTGACTGCTGTGAAGG + Intronic
946413980 2:219530166-219530188 AGGGAAGGTGCTGCCTGTGATGG + Intronic
948401660 2:237689916-237689938 AATGACAGTGCCCGCTGTGAGGG - Intronic
948436837 2:237959554-237959576 AAGAAAAGTGCCACCTTTTATGG - Intergenic
1171178722 20:23075441-23075463 AAGGAAATGCCCTCCTGTGCTGG + Intergenic
1171498312 20:25573538-25573560 AAAGAATGAGCCTGCTGTGAAGG + Intronic
1173092874 20:39992107-39992129 AAGGCAATTGTCTCCTGGGAAGG + Intergenic
1173464500 20:43270223-43270245 ATGGAAAGTGCTTTGTGTGATGG - Intergenic
1174954537 20:55082949-55082971 TAGGAAAGGGCCTTCTGTTAAGG + Intergenic
1175010046 20:55725808-55725830 AAGGAAGGGGCCACCTGTCAAGG - Intergenic
1175705408 20:61172900-61172922 CAGGAAAGTGACTGCAGTGAGGG + Intergenic
1176672264 21:9745476-9745498 AAAGGAAGTGCTTCCTTTGAGGG - Intergenic
1177620949 21:23592456-23592478 AAGCATAGTGACTTCTGTGACGG + Intergenic
1178083503 21:29090173-29090195 AAGGAAAGTGCACCCTCTGCAGG - Intronic
1178525416 21:33324659-33324681 AAGGTCAAGGCCTCCTGTGAGGG + Intronic
1181769192 22:25113175-25113197 AGCGAAAGTGCCTACTGTGGGGG + Intronic
1183406066 22:37631245-37631267 AAGGAAACTGACTCCTGGGAAGG - Intronic
1185036136 22:48477996-48478018 AAGGAACGTCCCTTTTGTGATGG - Intergenic
949665885 3:6338742-6338764 AAAGTAAGGGCCTACTGTGAGGG - Intergenic
949960183 3:9305344-9305366 AAAGAGAGGACCTCCTGTGAGGG - Intronic
950190707 3:10974380-10974402 AAGGAAAGGGGCTCCTGGTAGGG - Intergenic
953843748 3:46410425-46410447 AAGGAAAGTGCCTCCTGTGAAGG - Intronic
954004977 3:47583500-47583522 AAGGAAAATGCCTCCTGCTCTGG - Intergenic
955132005 3:56179413-56179435 TAAGAAAGTGCCTCATGTCATGG - Intronic
955593631 3:60564464-60564486 ATGGACAGTGACTCCTCTGATGG + Intronic
957361674 3:79167543-79167565 AAGGAAAGTGCCCTCTTAGAAGG - Intronic
960256750 3:115518756-115518778 AAGGAAAGCTCCTGCTGTTAAGG - Intergenic
961785583 3:129344744-129344766 AAGGACAGGGGCTCCTGGGAAGG + Intergenic
961897710 3:130182753-130182775 AAGGGGAGTGGTTCCTGTGATGG + Intergenic
963293095 3:143513631-143513653 ATGGAAAGTGATTCCTCTGATGG - Intronic
964531670 3:157674588-157674610 AAGAAAAGTGCCTCCTCTTAAGG - Intronic
967131629 3:186476303-186476325 AAGCACAGGGCCTCTTGTGAGGG + Intergenic
969007875 4:4036319-4036341 AAGGAGAGGGTTTCCTGTGATGG + Intergenic
970268516 4:14317268-14317290 AAGGAAAGAGCCACCTTTTAGGG - Intergenic
971534842 4:27735899-27735921 AAGGAAACTGCATCCAGAGATGG + Intergenic
972332927 4:38080435-38080457 AGGAAAAGGGCCTCCTGTGCTGG - Intronic
976735888 4:88308756-88308778 AAGGAAAATGCCTGGTGTGGTGG - Intergenic
980889427 4:138798331-138798353 TAGCACAGTCCCTCCTGTGAAGG + Intergenic
984941222 4:184933757-184933779 AAGGAAACTGCCAGGTGTGATGG - Intergenic
985281628 4:188292350-188292372 AAGGAAAGTTACACCTTTGAAGG + Intergenic
985402470 4:189606372-189606394 AAAGGAAGTGCTTCCTTTGAGGG + Intergenic
986778634 5:11044144-11044166 AGGGAAAGGACCTCCTGTCACGG - Intronic
987147292 5:15004800-15004822 AAGCCAAGTGCCTCCTGCAAGGG - Intergenic
990401913 5:55446634-55446656 AAGGAGAGTTCCTCCAGAGAAGG + Intronic
991443900 5:66679782-66679804 AGGGTGAGTGCCTGCTGTGAAGG - Intronic
992022907 5:72642453-72642475 AAAGAAAGTGCATTCTGAGAAGG + Intergenic
992150796 5:73900837-73900859 TAGGAAAATGCCTCCTGGGAAGG - Intronic
992286334 5:75239315-75239337 AATGAAATGGCCTCCTGTGCTGG - Intergenic
995552561 5:113295209-113295231 ATGGAAAGCGGCTCCTATGAGGG - Intronic
996495257 5:124148324-124148346 AAGTGAAGTGGATCCTGTGAGGG + Intergenic
999623190 5:153492353-153492375 AAGGGAAGTGTCTCCCCTGAAGG - Intronic
1000046358 5:157525002-157525024 AAGCAAAGTCCCTGCTGTCAAGG + Intronic
1000795624 5:165660968-165660990 AAGGACACTGTCTCCTGAGATGG + Intergenic
1002062880 5:176636759-176636781 AATGAAAATGCCTGCTTTGAAGG - Intronic
1004996758 6:21200760-21200782 AAGGAAAGGCACTCCTGGGAGGG - Intronic
1011644998 6:89449081-89449103 AAAGAAAGTGATTCCTCTGATGG + Intronic
1011851044 6:91629164-91629186 AAGGAAACTTCCCTCTGTGAAGG - Intergenic
1013140388 6:107328081-107328103 AAGCTAAGTGCCTACTCTGAAGG + Intronic
1013308361 6:108871035-108871057 TAGGAAGGTGCCTCATGAGAAGG + Intronic
1014624662 6:123710892-123710914 AAGGAGATTGACTCCTGTGCTGG + Intergenic
1015256688 6:131185471-131185493 AAGGAAAATGGCACCTGTGGTGG - Intronic
1018105885 6:160485874-160485896 TTGGCAAGTGCTTCCTGTGACGG + Intergenic
1021963415 7:25894721-25894743 AAAGAAAATGGCTTCTGTGAAGG + Intergenic
1024921149 7:54556207-54556229 AAGGAAACTGGCTGCAGTGAAGG + Intronic
1025706342 7:63868138-63868160 CAGGAAATTGCCCTCTGTGATGG - Intergenic
1027438669 7:78194955-78194977 CAGGAAAGGAGCTCCTGTGAAGG + Exonic
1028984205 7:96997223-96997245 AGGAAAAGTGCCTGCTATGATGG + Intergenic
1029854102 7:103495885-103495907 ATGGGAAGTGCCTTCTGTTAAGG + Exonic
1031449328 7:121895025-121895047 AAGGAAAATGTGTCCTCTGAAGG + Intronic
1031712164 7:125062211-125062233 AAAGAAAGTGACTCATATGATGG + Intergenic
1032561076 7:132893424-132893446 AAGGAAAGTCCCTTCTATGTAGG - Intronic
1035275341 7:157744992-157745014 AAGGAAGGTGCCGCCTGGAAGGG - Intronic
1035670414 8:1412748-1412770 AAGGCAATTGCCAGCTGTGATGG + Intergenic
1036985413 8:13523208-13523230 ATGGATAGTGGCTCATGTGAAGG + Intergenic
1038500871 8:28042521-28042543 AGGGAAGGTGCCTCATGGGAAGG - Intronic
1040549214 8:48425492-48425514 ATGGAAAATGTGTCCTGTGAAGG + Intergenic
1040590573 8:48788927-48788949 AAGGAAATTGCCTGGTGTGCCGG - Intergenic
1043342373 8:79255716-79255738 AAAGAATGTGCATCCTGGGATGG - Intergenic
1044730523 8:95225413-95225435 AATGAATGTGCCTCATTTGATGG + Intergenic
1045193712 8:99908679-99908701 CAGGAAACTGCACCCTGTGAAGG + Intergenic
1045320118 8:101075986-101076008 AAGGAAAGTACTTCCTGTAAGGG + Intergenic
1045734627 8:105280424-105280446 AGGGAAAGGGCCTCCTCTCAAGG + Intronic
1048095657 8:131290041-131290063 AAGGAAGGCGCCTTCTCTGATGG + Intergenic
1048384311 8:133897570-133897592 AAGGAAGCTGCCTGCTGTTAGGG + Intergenic
1048787104 8:138062335-138062357 CAGGAAAGTGCTTCCAGTCAAGG + Intergenic
1049520002 8:143083060-143083082 AAGGACGGTGCCTCCGGTGTGGG + Intergenic
1049520034 8:143083179-143083201 AAGGATGGTGCCTCCGGTGTTGG + Intergenic
1051618718 9:19031024-19031046 ATGGAAAGTGACTCCTTTGCAGG + Intronic
1051966681 9:22836418-22836440 AAGGAAACTGCCTGTTTTGAAGG - Intergenic
1053010101 9:34628073-34628095 GAGGAAAGGGCCGCCTGTGGGGG + Exonic
1053179960 9:35960347-35960369 AAGGAAAGTGATTTCTGTTAGGG + Intergenic
1054727519 9:68667129-68667151 AATGAAATTGCCTCCTCTGTGGG + Intergenic
1055855566 9:80682999-80683021 AAGGCCAGAGACTCCTGTGAGGG + Intergenic
1057669911 9:97077984-97078006 CAGGGAAGTGCCCACTGTGAAGG + Intergenic
1058341623 9:103904476-103904498 AATGAAAGTTCCTCCTCTCAGGG - Intergenic
1059421221 9:114193674-114193696 AGGGATAGTGCCAACTGTGAAGG + Intronic
1059920225 9:119151999-119152021 AGGTAAAGTGCCTTCTTTGATGG - Intergenic
1060409591 9:123391156-123391178 AAGGAAAGTGGCTCCTGAACTGG - Intronic
1060528048 9:124331654-124331676 AAGGACAGAGCCTCCTCTCATGG + Intronic
1061155937 9:128861683-128861705 AAGGAATGTCCCTCCTGGGATGG - Intronic
1061168566 9:128938882-128938904 AAGGAAAGGGCTTCCTGGGAGGG - Intronic
1186624652 X:11280023-11280045 GAGGAAAGTGCCAGTTGTGATGG + Intronic
1187322694 X:18255031-18255053 AAGGGAAGGGCCACCTGTGTGGG - Intronic
1190029481 X:46958089-46958111 AATGAAAGTGCATCCAGAGAGGG - Intronic
1190738088 X:53268871-53268893 AAGGAAAGTGTGTCCTGGAATGG - Intronic
1190872423 X:54435456-54435478 GAGGAAAGAGCCTTCTGTGCAGG - Intergenic
1191628762 X:63298848-63298870 AAGCAAAGGGCCTTCTATGAAGG - Intergenic
1192273393 X:69605683-69605705 AAGGAGAGTGCCTGCTGAGAGGG - Intergenic
1194002931 X:88454342-88454364 AAGGAGAGTGCCTGTTGGGAAGG + Intergenic
1196848187 X:119913418-119913440 ATTGAACCTGCCTCCTGTGAGGG + Intronic
1197030535 X:121808639-121808661 AAGGAAATTCACTCCTCTGAAGG - Intergenic
1197050215 X:122047979-122048001 AAGGAGAGTGTTTCCTGTGTTGG - Intergenic
1198282762 X:135158050-135158072 AAGAAAAGTGGCTCCTTTGTTGG + Intronic
1198285037 X:135180998-135181020 AAGAAAAGTGGCTCCTTTGTTGG + Intergenic
1198288197 X:135214472-135214494 AAGAAAAGTGGCTCCTTTGTTGG - Intergenic
1200522264 Y:4224763-4224785 AAGGAAGTTGCTTCATGTGAGGG - Intergenic