ID: 953844550

View in Genome Browser
Species Human (GRCh38)
Location 3:46417021-46417043
Sequence GTGAGCAGGCCTACAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953844550_953844558 13 Left 953844550 3:46417021-46417043 CCAGCACCTGTAGGCCTGCTCAC 0: 1
1: 0
2: 0
3: 14
4: 142
Right 953844558 3:46417057-46417079 TGATTTTTGCTTTTTACCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953844550 Original CRISPR GTGAGCAGGCCTACAGGTGC TGG (reversed) Intergenic
900215566 1:1479786-1479808 GTGAGCGGGCCCACGTGTGCGGG - Intronic
900318872 1:2072742-2072764 GTCAGCAGGGCCATAGGTGCTGG + Intronic
900362048 1:2293833-2293855 GTGAGCAGGCCTGTGGCTGCAGG + Intronic
902792429 1:18778392-18778414 GTGAGAATGCCCACATGTGCTGG - Intergenic
904235871 1:29116699-29116721 GTGAGCAGGTTTACAGGGCCTGG - Intronic
906932883 1:50186916-50186938 GTGAACAGGCCTACAGCCACAGG + Intronic
915511979 1:156391473-156391495 GAGAGCAGGGCTGCTGGTGCAGG - Intergenic
919610658 1:199741773-199741795 GTGCGCATGCGTACACGTGCAGG - Intergenic
919987605 1:202686626-202686648 CTGTCCAGGCCTAGAGGTGCAGG - Intronic
922285942 1:224170717-224170739 TTGAGCATGCCTAAAGGTGAGGG - Intergenic
924438558 1:244067581-244067603 GTGAGCAGGGCTCCCGCTGCAGG + Intergenic
1063379032 10:5572743-5572765 GTGGGCAGGCCTACAGCTGTTGG - Intergenic
1063399230 10:5725649-5725671 GTAGCCAGGACTACAGGTGCAGG - Intronic
1063726074 10:8638824-8638846 TTGAGCAGGGCTCCAGTTGCAGG + Intergenic
1066446481 10:35488482-35488504 GTGTGCAGGTGTGCAGGTGCTGG + Intronic
1070152405 10:73812930-73812952 GAGAGCAGACTCACAGGTGCTGG - Exonic
1073442163 10:103558698-103558720 GAGAGCAGGCTGACAGGGGCGGG + Intronic
1075331732 10:121578939-121578961 GTCAGTAGGCCTGCAGGTGCGGG + Intronic
1076802281 10:132836119-132836141 GTGAGCAGGGCTGCAGGGGAGGG - Intronic
1077016101 11:399736-399758 GTGAGCAGGCCTGGCAGTGCAGG - Intronic
1077046828 11:550374-550396 GTGAGCAGGCCATAGGGTGCGGG - Intronic
1077055862 11:592774-592796 GTGAGCACAGCTCCAGGTGCTGG - Intronic
1078852855 11:15179881-15179903 CTGAGCAGGGGTACAGGTGCTGG + Intronic
1080774256 11:35371090-35371112 GCCACCTGGCCTACAGGTGCTGG - Intronic
1084116492 11:67045719-67045741 GTGGGCAGGCGGACAGGTGAGGG - Intronic
1084489747 11:69471811-69471833 GGGAGCCGGCCTTCAGGAGCTGG + Intergenic
1088735309 11:112723689-112723711 GGGAGCAGGGCTTCAGATGCAGG - Intergenic
1090429765 11:126635946-126635968 GCCAGCAGGCCTACAGGTAGCGG + Intronic
1090954206 11:131500081-131500103 GTGAGAAGGCCCACAGGGCCAGG - Intronic
1091224372 11:133948863-133948885 GTGAGCTGGCTTCCAGGTGGAGG + Intronic
1091704166 12:2682399-2682421 GTGAACAGGCATACAGTTGCTGG - Intronic
1092656024 12:10686379-10686401 CTGAGCAGGCCTAAAGGCACAGG - Intergenic
1094505134 12:31055174-31055196 GTGAGGAGGCCTACCTGTGAGGG + Intergenic
1104064295 12:125294051-125294073 GTGAGAAAGCCTCCAGGTGAAGG + Intronic
1104181500 12:126386149-126386171 GTGGCCAGGCCTGCAAGTGCTGG - Intergenic
1104587760 12:130061316-130061338 GTGAGCAGTCCTGCAGATGATGG + Intergenic
1109261129 13:60146248-60146270 GTTACCAGGCCACCAGGTGCAGG + Intronic
1114216427 14:20660822-20660844 GTGGCCAGGACCACAGGTGCAGG - Intergenic
1116246505 14:42421170-42421192 GTTAGCAGGACTTCAGGTGAGGG - Intergenic
1122157465 14:99758767-99758789 GTGAGCAAGCCTTCTGTTGCAGG - Intronic
1123939243 15:25208834-25208856 GTGATCAGGCCCACAGGGTCAGG + Intergenic
1126662727 15:51048411-51048433 CAGGGCAGGACTACAGGTGCTGG - Intergenic
1132794960 16:1715507-1715529 TTAAGCAGGCAGACAGGTGCCGG - Intronic
1134684063 16:16146543-16146565 GTTAGCAGGCTGGCAGGTGCCGG + Intergenic
1136607942 16:31349108-31349130 TTGAGCAGGTCTGCAGGTGAGGG + Intergenic
1141186374 16:81790445-81790467 GAGAGCAGGCCTTCAGGCCCTGG + Intronic
1142262739 16:89050402-89050424 GTGTTCAGGCCTGCAGGTGAGGG + Intergenic
1142468004 17:147037-147059 GTGAGCAGACAGACAGGTGGAGG - Exonic
1142821820 17:2475022-2475044 GAGAGCAGGCCTAGAGTGGCTGG - Intronic
1143634488 17:8156509-8156531 GTCAGCAGGCCAACGGGGGCGGG + Intronic
1143684627 17:8504017-8504039 GTACGCAGGCCTGGAGGTGCTGG - Intronic
1143884137 17:10053486-10053508 GTGACCAGGCATTCAGGCGCTGG - Intronic
1147453165 17:40518887-40518909 GGGCGCAGGCCTGCAGGTGGAGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148637700 17:49161414-49161436 GTGAGCTGGATTACAGGTGCAGG - Intronic
1149212286 17:54317245-54317267 TTGAGCAGACCTACAGCTGAGGG + Intergenic
1150162109 17:62907207-62907229 AGGAGCAGGTCTACAGGTGAAGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151688559 17:75665133-75665155 GTGTGCATGCCCACAGGGGCAGG - Exonic
1152379057 17:79933062-79933084 GAGAGGAGGCCCACAGGTGGCGG + Exonic
1152538724 17:80964220-80964242 GTGAGCAGGGGTTCAGGTGCGGG - Intronic
1152861202 17:82697959-82697981 GCGAGCAGGCGCCCAGGTGCTGG - Intronic
1156247651 18:35317677-35317699 GTGAGCATCACTACATGTGCAGG - Intergenic
1157271003 18:46276182-46276204 GTGAGCAGGCGTACATGAACAGG - Intergenic
1157812492 18:50707438-50707460 GTGACTGGGACTACAGGTGCGGG - Intronic
1158312816 18:56177130-56177152 CTGAGCAGGACGGCAGGTGCGGG + Intergenic
1160835882 19:1124252-1124274 GTGAGAAGGCAGCCAGGTGCTGG - Intronic
1162799351 19:13102501-13102523 GGGAGCGGGCCTAAAGGTGGAGG - Intronic
1164586267 19:29478077-29478099 GTGGGCAGGCCCACAAATGCGGG + Intergenic
1167591278 19:50405846-50405868 GTGAGCAGGCGGCCAGGTGGGGG - Intronic
927188614 2:20500325-20500347 GTGAGCAGACCCCCAGGGGCAGG + Intergenic
928361083 2:30662872-30662894 GGGACCAGGGCTTCAGGTGCAGG + Intergenic
929571310 2:43024729-43024751 GTGAGCAGGGCGGAAGGTGCAGG - Intergenic
929771927 2:44899490-44899512 ATGAGAAGGGCTACAGGAGCTGG - Intergenic
929949395 2:46394775-46394797 AGAATCAGGCCTACAGGTGCAGG + Intergenic
933588602 2:84207097-84207119 GTGGGCAGGCCTGCATCTGCAGG - Intergenic
933694262 2:85205314-85205336 CTGAGCAGGCCTAGAGTTGAAGG + Intronic
935431366 2:102979612-102979634 GGAAACAGGCCTGCAGGTGCAGG - Intergenic
936034201 2:109097787-109097809 GCAAGCAGGCCTACAGGGACAGG - Intergenic
938714986 2:134010974-134010996 GAGAGGAGGCCTGCAAGTGCAGG - Intergenic
941769471 2:169329688-169329710 GTGAGCAGGCTGGTAGGTGCAGG + Intronic
946329144 2:219000084-219000106 CCGGGCAGGCCTGCAGGTGCGGG - Intergenic
946875548 2:224126171-224126193 GCGAGCAGCCCTCCAGATGCAGG + Intergenic
947772693 2:232683325-232683347 GTGAGGATGCCTTCAGCTGCAGG + Intergenic
948056540 2:235012903-235012925 GTGCACAGGCCTCCAGGAGCAGG + Intronic
1170658842 20:18316488-18316510 GGGAGAAGCCCTACATGTGCAGG + Exonic
1171989491 20:31684761-31684783 GTGAACACGGCTACAGGTGCAGG + Intronic
1174478715 20:50815808-50815830 GTGAGGGAGCCTTCAGGTGCAGG + Intronic
1174582137 20:51579517-51579539 GTGAGCAGGCCTTCAGGAGAGGG - Intergenic
1175225315 20:57441019-57441041 CTGAGCAGGCCTGCAGGCCCCGG - Intergenic
1175900606 20:62358523-62358545 CTGGGCAGGCCTACTGGTCCAGG - Intronic
1175915515 20:62424050-62424072 GGGAGCAAGCCTACCGGGGCGGG + Intronic
1178807332 21:35850693-35850715 GTGAGCTGGCCTCCAGGAGAAGG + Intronic
1179887738 21:44321640-44321662 GTCAGCAGGCCGGCAGGTTCTGG - Intronic
1179899384 21:44381134-44381156 GTGAGGAGCCCTCCAGGTGAGGG + Intronic
1183591177 22:38780130-38780152 GTGAGGAGGTCTAGAGGGGCAGG + Intronic
1183898651 22:40989136-40989158 GTGAAAAGGCCTGCAGGGGCTGG - Intergenic
1184889418 22:47370651-47370673 GTTAGAAGACCTCCAGGTGCCGG + Intergenic
1185238266 22:49727044-49727066 GGGAGCTGGCCTTCTGGTGCTGG - Intergenic
949943496 3:9172570-9172592 GTGAGGAGGCAGACAGGAGCTGG - Intronic
950995712 3:17494226-17494248 GTGGTGATGCCTACAGGTGCCGG - Intronic
952252296 3:31666279-31666301 GTGAGCAGACTTACAGGTATGGG + Intronic
952534370 3:34294648-34294670 CTGAGCAGTGCTGCAGGTGCTGG + Intergenic
953059132 3:39412845-39412867 GTCAGCTTGCCTACAGGTTCTGG + Intergenic
953844550 3:46417021-46417043 GTGAGCAGGCCTACAGGTGCTGG - Intergenic
960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG + Intronic
962272912 3:133991311-133991333 GTGAGCAGGCCAACGGCTGATGG - Intronic
965371130 3:167863730-167863752 GTGAGCAGCCCTTGAGGTGGAGG + Intergenic
968963432 4:3757437-3757459 GTGGGCAGGCCCACAGGTGGCGG - Intergenic
969106068 4:4807987-4808009 CTAACCAGGCCTACAGGTGAGGG + Intergenic
973964154 4:56144117-56144139 GTGAGAAGACCTACAGGTGAGGG + Intergenic
975691427 4:76967987-76968009 GTGAGCAGGCCCACAGCTGAGGG + Intronic
977308134 4:95351132-95351154 GTGGGGAGGCCTTCAGGTGAAGG - Intronic
977668069 4:99663780-99663802 GTGAGCAGCCCTGGAGGTTCAGG - Intergenic
980994097 4:139764181-139764203 GTCAGCAGGACTACAGATCCAGG - Intronic
982900093 4:160988180-160988202 GTAACTAGGCCTACAGGTGCTGG - Intergenic
983065392 4:163204739-163204761 GTGAGCAAGCCTTCAGATGATGG + Intergenic
983939393 4:173524664-173524686 GTGACCAGGCCTAGTGTTGCTGG + Intergenic
985697445 5:1348796-1348818 ATGAGCAGCCCTCCAGGTGCTGG + Intergenic
987110130 5:14678208-14678230 GGGAGCAGCTCTGCAGGTGCGGG + Intronic
992084855 5:73269380-73269402 GTCTGCAGACCTTCAGGTGCAGG - Intergenic
996005941 5:118420439-118420461 CTGAGCAGCCCTACAGATGAGGG + Intergenic
996508064 5:124289613-124289635 GTGATCTGGCCTCCAGGTGGAGG + Intergenic
997715452 5:136039416-136039438 GTGAGCAGGCCTGTAGGACCTGG + Intronic
998886153 5:146696231-146696253 GTAGCCAGGACTACAGGTGCCGG + Intronic
1000414227 5:160966517-160966539 TTGAGCAGGCAAACAGGTGATGG + Intergenic
1000565449 5:162841215-162841237 GTGAGCAGGCATCCAGGAGTGGG + Intergenic
1003224206 6:4189915-4189937 GGGTGCAGCCCGACAGGTGCAGG - Intergenic
1004745186 6:18502255-18502277 GTCTGCAGGCCTGGAGGTGCAGG + Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1013111904 6:107070873-107070895 GTGAGCAGGCCGGCAGGGGCAGG - Exonic
1016570443 6:145506724-145506746 GTGAGCAGGCCTAGAGGGCGTGG + Intronic
1017002196 6:150004580-150004602 GGGCGGAGCCCTACAGGTGCTGG + Intergenic
1019331318 7:462160-462182 GGGAGCCGGCCTCCGGGTGCGGG - Intergenic
1023895686 7:44431182-44431204 GTGCCCAGGCCTGCAGCTGCAGG - Intronic
1024787140 7:52921413-52921435 GTGAGCAGAGCTGCATGTGCGGG - Intergenic
1024955503 7:54915102-54915124 TTGAGAAGGGCTTCAGGTGCTGG - Intergenic
1026285220 7:68956985-68957007 GTAGCCAGGACTACAGGTGCGGG + Intergenic
1026624548 7:71980759-71980781 GTCAGCAGGCCTTCAGTTTCAGG - Intronic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1029307291 7:99629665-99629687 GGGAGAAGCCCTACAAGTGCGGG + Exonic
1030939135 7:115623455-115623477 CTGAGCAGGGCCACAGGGGCAGG + Intergenic
1031870912 7:127089471-127089493 GTATGCAAGCCTACAGCTGCTGG + Intronic
1032536318 7:132667660-132667682 GTGGTCAGGCCCACATGTGCTGG - Intronic
1034912896 7:155012018-155012040 GGGAGCAGGGGTGCAGGTGCAGG - Intergenic
1035108614 7:156462288-156462310 GAGAGCAGGACTACAGTTTCAGG + Intergenic
1035220053 7:157401060-157401082 GCGAGGAGGCCGACAGCTGCCGG - Intronic
1037745705 8:21642534-21642556 GTGAGGCGGCCTTCAGGTGTCGG + Intergenic
1042580009 8:70266290-70266312 GTAGGCGGGACTACAGGTGCAGG + Intronic
1044604273 8:94035356-94035378 GTGAGCATGCTTCCAGCTGCTGG + Intergenic
1052534640 9:29731652-29731674 GTGAGCAAGCCTACTGGGACTGG + Intergenic
1058648881 9:107156424-107156446 GTGAGCAGGCCGAGATGGGCAGG - Intergenic
1058885976 9:109321128-109321150 GTGAGCACACCTACAGCAGCAGG - Intergenic
1061959099 9:133979026-133979048 GAGAGCAGGTCTGCAGGTCCCGG + Intronic
1062431842 9:136529834-136529856 GTGAACAGGCCTGGTGGTGCTGG - Intronic
1193082718 X:77421816-77421838 GAGAGCAGGCTGACAGGTCCAGG - Intergenic