ID: 953847967

View in Genome Browser
Species Human (GRCh38)
Location 3:46443876-46443898
Sequence TCTGCTGCACACAGCCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953847967_953847968 0 Left 953847967 3:46443876-46443898 CCGTGATGGCTGTGTGCAGCAGA 0: 1
1: 0
2: 2
3: 46
4: 313
Right 953847968 3:46443899-46443921 GCCTGTGAGTTGCCTAGTCCAGG 0: 1
1: 0
2: 3
3: 8
4: 100
953847967_953847972 27 Left 953847967 3:46443876-46443898 CCGTGATGGCTGTGTGCAGCAGA 0: 1
1: 0
2: 2
3: 46
4: 313
Right 953847972 3:46443926-46443948 GATTTTGTTTTTATCAGTAATGG 0: 1
1: 0
2: 5
3: 63
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953847967 Original CRISPR TCTGCTGCACACAGCCATCA CGG (reversed) Intronic
900095577 1:938799-938821 TCTTCTGCACACACGCACCAGGG + Intronic
900125114 1:1065384-1065406 ACTCCTGCACACAGCCCTCCAGG - Intergenic
900393219 1:2442910-2442932 TCTGCTGCAGGCAGCCATGAAGG - Intronic
900537068 1:3184016-3184038 TCTGCTGCACACGGTCAGCGGGG + Intronic
900817123 1:4856892-4856914 CCTGCTTCACACAGCCATGCAGG - Intergenic
901625815 1:10624447-10624469 TCTGCTGCACAGGGCCCTCCAGG + Intronic
902742634 1:18449624-18449646 CCTTCTGAACACAGCCTTCAAGG + Intergenic
903691371 1:25176063-25176085 TCACCTGCCCACAGCCATCTGGG - Intergenic
904349485 1:29895688-29895710 CCTGCTCCACACCCCCATCAGGG - Intergenic
904631905 1:31848774-31848796 TCTGCTGGAGGCAGCCAGCAAGG + Intergenic
905752474 1:40477626-40477648 TCTGCTCCACATTCCCATCAAGG - Exonic
905925757 1:41748465-41748487 TCACCTGCACAAAGCAATCAGGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
908931495 1:69321522-69321544 TCTGCTGCACACAGGAAGCTGGG - Intergenic
909035687 1:70591925-70591947 GCCGCTGCACACAGACATGAGGG - Intergenic
911719543 1:101175995-101176017 TTTGCTGCACACAGGCAGAATGG + Intergenic
912296690 1:108476569-108476591 GCTGCTGCACACAGACATGAGGG - Intergenic
912885627 1:113470234-113470256 TCTGTTTCACACTGCCATCCAGG + Intronic
913288556 1:117250733-117250755 TCTGCTGCAACCTGCCATCTTGG - Intergenic
915021961 1:152787580-152787602 ACTGCTGCAGCCAGCCCTCAGGG + Exonic
915264816 1:154709236-154709258 TCTGATGTACACAGCCAAGATGG - Intronic
915855642 1:159383750-159383772 TCTGCTGCAGGGAGCCCTCATGG + Intergenic
917453838 1:175169007-175169029 TCTGCTCCACACAGTCATTCAGG - Intronic
918714182 1:187767589-187767611 GCTGCTGCACGCAGACATGAGGG + Intergenic
919930994 1:202221523-202221545 TCAACTGGACACAGCCATGATGG - Intronic
920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG + Intergenic
920829620 1:209452550-209452572 CCTGCTGCACGCAGACATGAGGG - Intergenic
921118739 1:212118620-212118642 TCAGCTGCACTCAGCAATCTGGG + Intergenic
921205361 1:212844180-212844202 GCCGCTGCACACAGACATGAGGG - Intronic
921520355 1:216149176-216149198 GCCGCTGCACACAGACATGAGGG - Intronic
922048627 1:221969570-221969592 GCTGCTGCACACAGACATGAGGG - Intergenic
922718686 1:227889487-227889509 CCTGCTGCACAGAGCCACCCAGG + Intergenic
923075449 1:230605015-230605037 GCTGCTGCACACAGACATGAGGG - Intergenic
923757817 1:236809251-236809273 TGTGCTTCACAGAGCCTTCAAGG - Intronic
1068285009 10:54922775-54922797 TCTGCAGGGCACAGCCCTCATGG + Intronic
1070338821 10:75478115-75478137 TCAGCTGCACACAGGCTTAAAGG - Intronic
1074850974 10:117439375-117439397 TCTGTTCCACACAGCCTCCACGG - Intergenic
1077337421 11:2011667-2011689 TCGGCTGCACCCCGCCATCTTGG + Intergenic
1077467679 11:2741333-2741355 CCTGCTGCACACAGCCACCCCGG - Intronic
1079447680 11:20571423-20571445 GCCGCTGCACACAGACATGAGGG - Intergenic
1079596836 11:22260421-22260443 TCTGTTGTACATAGACATCATGG + Intronic
1079911137 11:26311685-26311707 TCTACTGTACACAGCAGTCATGG - Intronic
1080227590 11:29977025-29977047 GCTGCTGCACGCAGACATGAGGG - Intergenic
1080395725 11:31888111-31888133 TTTTCTCCACACAGCAATCAAGG - Intronic
1080468776 11:32525062-32525084 TCTCCTTCCCACAGGCATCATGG - Intergenic
1081357030 11:42124211-42124233 GCTGCTGCACGCAGACATGAGGG - Intergenic
1082080618 11:48009902-48009924 TCTACTGCTCTAAGCCATCAAGG + Intronic
1082113838 11:48306603-48306625 CCTGCACTACACAGCCATCATGG + Exonic
1084566024 11:69929558-69929580 TCTGCTCCACACAGTCATTCAGG - Intergenic
1088736897 11:112735170-112735192 TCTGCTTCATACAGTCATCCAGG + Intergenic
1089777981 11:120852323-120852345 TCACCTGCAAACACCCATCAGGG - Intronic
1089987892 11:122830745-122830767 GCTGCTGCACACAGACATGAGGG - Intergenic
1090926716 11:131256574-131256596 GCTGCTGCACGCAGACATGAGGG + Intergenic
1202820405 11_KI270721v1_random:66849-66871 TCGGCTGCACCCCGCCATCTTGG + Intergenic
1091805293 12:3351602-3351624 TCTGCTCCACACAGTCATACAGG - Intergenic
1092480877 12:8858081-8858103 TCTCCTTCACACAGCTATGAAGG + Exonic
1093358705 12:18198954-18198976 GCTGCTGCACAGAGACATGATGG - Intronic
1093532655 12:20186003-20186025 TCTGTATCACACAGTCATCATGG + Intergenic
1094487617 12:30937609-30937631 TCTGCTCCACACAGTCATACAGG + Intronic
1096980496 12:55725881-55725903 TCTTCTCCACACAGCCCTGAAGG + Exonic
1098595982 12:72273231-72273253 TCTGATGCTCACCGCCTTCATGG + Exonic
1099858367 12:88199680-88199702 TGTGCTGTTCACTGCCATCAGGG + Exonic
1100127628 12:91448181-91448203 TTTGCAGCAAACAGCCATCTAGG + Intergenic
1100585200 12:95972977-95972999 ACTGCTGCACACAGCAATTCAGG - Exonic
1101303513 12:103504657-103504679 TGTGCTGCAGACAGGCATGAAGG - Intergenic
1102899417 12:116624836-116624858 TCTGAGGCTCACAGACATCACGG - Intergenic
1104707535 12:130958575-130958597 TCTGCTTCACACAGACAGCCAGG - Intronic
1105412006 13:20178159-20178181 TCTGGTGACCTCAGCCATCAGGG + Intergenic
1106404121 13:29458917-29458939 TCTGCTCCACAACGGCATCAGGG + Intronic
1108952734 13:56114498-56114520 GCTGCTGCACGCAGACATGAGGG + Intergenic
1108956616 13:56166532-56166554 TCTGCAGCGCTCAGCCTTCATGG + Intergenic
1109617513 13:64854851-64854873 TCTGCTCAACAATGCCATCAAGG + Intergenic
1109709448 13:66143410-66143432 GCTGCTGCACGCAGACATGAGGG + Intergenic
1109716522 13:66228463-66228485 GCTGCTGCACACAGACATGAGGG + Intergenic
1112816001 13:103274324-103274346 TATGGTGCACACAGCCTGCAGGG + Intergenic
1112889113 13:104210186-104210208 GCTGCTGCACGCAGACATGAGGG + Intergenic
1113553100 13:111208581-111208603 TCTGCTGGCCACAGCCTTCCAGG - Intronic
1113812564 13:113151442-113151464 CCTGCTGCTCACAGTCCTCAGGG - Intergenic
1113849016 13:113407487-113407509 CGTGCTGCACACGGCCACCATGG - Intergenic
1115240390 14:31247477-31247499 GCTGCTGCACGCAGACATGAGGG + Intergenic
1115380551 14:32733267-32733289 TCTCCTGCACAGTGCCATCCTGG - Intronic
1115905027 14:38194424-38194446 GCTGCTGCACGCAGACATGAGGG - Intergenic
1116534557 14:46014503-46014525 GCTGCTGCACAGAGACATGATGG + Intergenic
1117801403 14:59447711-59447733 GCTGCTGCACGCAGACATGAGGG - Intronic
1119317417 14:73707121-73707143 GCCGCTGCACACAGACATGAGGG - Intergenic
1120453062 14:84695621-84695643 TCTGCTGCACATACCCATCAGGG - Intergenic
1121915775 14:97835887-97835909 TCTGTTGAACACACACATCAGGG + Intergenic
1122041213 14:98988828-98988850 GCTGCTGCACGCAGACATGAGGG - Intergenic
1122187802 14:100015087-100015109 TGTGGGGCACACAGCCATGATGG - Intronic
1123882277 15:24687659-24687681 GCCGCTGCACACAGACATGAGGG + Intergenic
1126529374 15:49695747-49695769 TCTGCTTCACATAGTCATCCAGG + Intergenic
1127377790 15:58401221-58401243 TCAGCTGCACACAGCCTTTTTGG + Intronic
1127778322 15:62287473-62287495 TCTGGAGCACACAGCCTTTAGGG - Intergenic
1128376669 15:67081402-67081424 ACTGCGGCACACAGGCATGAAGG - Intronic
1128393394 15:67198569-67198591 TCTCCTTCCCACAGCCATTAGGG + Intergenic
1128888610 15:71311055-71311077 TGTGCTCCACACAGTCCTCAGGG + Intronic
1129219917 15:74126162-74126184 TCTGCTGCACACACCCCTACAGG - Intronic
1130843411 15:87722958-87722980 TTTCCTGCACAGAGCCACCATGG - Intergenic
1131557689 15:93413924-93413946 CCTGCTGCTCACACCCCTCAGGG + Intergenic
1132649841 16:1015510-1015532 TCTGCTCTATACAGCCTTCATGG + Intergenic
1133052848 16:3127701-3127723 GCTGCTGCACTCAGCCATTATGG - Intergenic
1133843556 16:9432748-9432770 TCTGTGGCACACAGCAAACAGGG - Intergenic
1135706364 16:24678490-24678512 TCTCCAGCCAACAGCCATCAGGG + Intergenic
1135902696 16:26478312-26478334 TCTGCTCCACATAGCCATTCAGG + Intergenic
1136178302 16:28533655-28533677 GCTTCTGCACGCAGCCATCAGGG + Intronic
1137896382 16:52217198-52217220 GCTGCTGCACACAGACATGAGGG + Intergenic
1139039019 16:62981225-62981247 GCCGCTGCACACAGACATGAGGG + Intergenic
1140227929 16:73093595-73093617 TCTCCTGCAAACAGACAGCACGG + Intergenic
1141925680 16:87167377-87167399 TCTGCTCCACACAGTCATTCAGG - Intronic
1142200998 16:88761138-88761160 CCTGCTGCACACAGCCACGTGGG + Intronic
1142442958 16:90112778-90112800 CCTGATACAGACAGCCATCAAGG - Intergenic
1144439332 17:15267192-15267214 TCTACTGCTGACAGCCAACAGGG - Intergenic
1144825248 17:18102108-18102130 CCAGCAGCACACAGCCGTCACGG + Intronic
1144955616 17:19017519-19017541 TCAGCTGGACAGAGCCATCAGGG - Intronic
1145966078 17:28918468-28918490 TCAGCAGCACACTGCCATGAAGG + Intronic
1146512535 17:33462502-33462524 TCTGCTCCACAGAGTCATCCTGG - Intronic
1146598122 17:34186909-34186931 GCTGCTGCACGCAGACATGAGGG - Intergenic
1146661601 17:34668494-34668516 TCTGCTGGACACAGGACTCAGGG - Intergenic
1148749112 17:49934660-49934682 TCTGCTGGCCACAGCCATCCAGG - Intergenic
1149555734 17:57572106-57572128 TCTGCTGCACACACCTGTCAGGG - Intronic
1150296056 17:64008111-64008133 ACTACTGTACACAACCATCAAGG + Intronic
1150566100 17:66342041-66342063 CCTGCTGCACACAGACACCAAGG + Intronic
1150730597 17:67689747-67689769 TCTACTCCACATAGCCAGCAGGG - Intronic
1151618368 17:75229656-75229678 AGTGCTGCACAAAGCCACCACGG - Intronic
1152263474 17:79279664-79279686 TCAGCTCCCCACAGCCAGCAAGG + Intronic
1152408985 17:80112537-80112559 CCCGCTCCACACAGCCCTCACGG + Intergenic
1154163207 18:11995182-11995204 TCTGCTCCACAAAGTCATCCAGG + Intronic
1155887862 18:31229649-31229671 TCTGCTCTACATAGCCATCCAGG + Intergenic
1156923893 18:42554992-42555014 GCTGCTGCACGCAGACATGAGGG + Intergenic
1157621850 18:49021369-49021391 TCTGCAGCACGCAGCCCCCAGGG + Intergenic
1157906170 18:51572115-51572137 GCTGCTGCACGCAGACATGAGGG + Intergenic
1158336590 18:56419227-56419249 GCCGCTGCACACAGACATGAGGG - Intergenic
1158933830 18:62346685-62346707 TGTGGGGCACACAGCCATCACGG - Intronic
1159779618 18:72645950-72645972 TCTGCTGCACACCGTCACCCAGG + Intergenic
1160877777 19:1305166-1305188 TCTGGTCCAAACAGCCATGATGG + Intergenic
1163532780 19:17860342-17860364 TCTGCTTCTCACAGCCATTCCGG - Intronic
1163907396 19:20159168-20159190 GCTGCTGCACGCAGACATGAGGG - Intergenic
1164081068 19:21861798-21861820 GCTGCTGCACAGAGACATGAGGG - Intergenic
1164425452 19:28137594-28137616 GCCGCTGCACAGAGCCTTCATGG - Intergenic
1165510103 19:36261569-36261591 GCCGCTGCACACAGACATGAGGG + Intergenic
1166098664 19:40557440-40557462 TCTGCTGCCCACAGCTGTCCAGG - Intronic
1166498714 19:43325586-43325608 GCCGCTGCACACAGACATGAGGG + Intergenic
1166701166 19:44882451-44882473 TCTGTTTCACACAGCCATTATGG - Intronic
1166764265 19:45243563-45243585 TCTATTGCACACAGCCATGGGGG - Intronic
1166905503 19:46105766-46105788 GCTGCTGCACACAGAGATGAGGG + Intergenic
1167226776 19:48249557-48249579 TTTACCGCCCACAGCCATCATGG + Intronic
1167227408 19:48255964-48255986 TTGACTGCCCACAGCCATCATGG - Intronic
1167301383 19:48680011-48680033 TCTCCTCCCCACAGCCGTCAAGG + Intergenic
1167902368 19:52631404-52631426 GCTGCTGCACGCAGACATCATGG - Intronic
1168458708 19:56536840-56536862 TCCGCTGCAAACAGCCACCTTGG - Intergenic
925950622 2:8906502-8906524 TCTGCTCCACACAGTCATTCAGG - Intronic
926413808 2:12630135-12630157 GCTGCTGCACACAGACATGAGGG - Intergenic
927441380 2:23120373-23120395 TTTGCTGGACACAGCAATCAGGG - Intergenic
928182346 2:29077904-29077926 CCTCCTGCAAACAGCCAGCAAGG - Intergenic
929383821 2:41381939-41381961 GCTGCTGCACAGAGACATAAGGG - Intergenic
929565698 2:42982950-42982972 TCTGCTGTACAAAGTCATCAGGG - Intergenic
930487108 2:52023976-52023998 GCTGCTGCACACAGACTTGAGGG + Intergenic
932864507 2:75327518-75327540 TGGGGTGGACACAGCCATCAGGG - Intergenic
935294676 2:101638660-101638682 TCTGCTGCTCACAGTCATGGTGG - Intergenic
935803028 2:106717521-106717543 TCTCCTGCCCTCAGACATCAGGG - Intergenic
936156072 2:110048206-110048228 TCTGGTGCCCAGAGCCACCAGGG - Intergenic
936188616 2:110323222-110323244 TCTGGTGCCCAGAGCCACCAGGG + Intergenic
938244629 2:129767082-129767104 TCTGGAGCACACAGCATTCAAGG + Intergenic
938945987 2:136212515-136212537 TCTGCTGTCCCCTGCCATCAGGG + Intergenic
943421360 2:187672568-187672590 GCTGCTGCACACAGACATGAGGG + Intergenic
943438496 2:187897055-187897077 TCTTCTGCCCTCAGCCATCCTGG - Intergenic
944074782 2:195716807-195716829 GCTGCTGCACATAACCACCACGG + Exonic
945376321 2:209081702-209081724 GCTGCTGCACGCAGACATGAGGG - Intergenic
945938539 2:215926009-215926031 GCTGCTGCACGCAGACATGAGGG - Intergenic
946543979 2:220716252-220716274 TCTGCTGCAGGGAGCCCTCATGG - Intergenic
947089734 2:226496576-226496598 TCAGCTGCCCACAGCCAACCTGG + Intergenic
947712557 2:232324406-232324428 TCTTCTGCCCTCAGCCACCAGGG - Intronic
947731521 2:232434086-232434108 TCTTCTGCCCTCAGCCACCAGGG - Intergenic
948529637 2:238596110-238596132 GCTTCTTCACCCAGCCATCATGG + Intergenic
948583936 2:239006780-239006802 TCGGCTCCACACAGCCGACAGGG + Intergenic
1169017943 20:2306914-2306936 TCAGCTGTACACAGCCATCTAGG + Intronic
1169970614 20:11265868-11265890 TCTGCTGCAACCACCCCTCAGGG + Intergenic
1170165957 20:13360581-13360603 GCTGCTGCACGCAGACATGAGGG - Intergenic
1171336271 20:24388524-24388546 TCAGCCTCACACAGCCCTCATGG - Intergenic
1173119088 20:40272681-40272703 GCTGCTGCACGCAGACATGAGGG - Intergenic
1173597773 20:44270686-44270708 TCTCCTGCCGACAGCCAGCAGGG - Intronic
1173956422 20:47036446-47036468 TCTGGTGCACACGGGCATTATGG + Intronic
1175021736 20:55858403-55858425 TCTGCTTCATACAGACAACAGGG - Intergenic
1175539169 20:59737375-59737397 ACAGCTGCAAACATCCATCAAGG + Intronic
1175881653 20:62262846-62262868 CCTGCTGCTCACAGCCCTCCAGG - Intronic
1176243244 20:64084677-64084699 TCTGCTCCCCACAACCATCTAGG - Intronic
1177757930 21:25369678-25369700 TCTGCTGCCAACTCCCATCAGGG - Intergenic
1178701062 21:34834503-34834525 GCTGCGGCGCACAGCCATGAGGG - Exonic
1179517608 21:41919650-41919672 TGTGCTGCACACAATCTTCAGGG - Intronic
1179625677 21:42648212-42648234 TCGGAAGCACACAGGCATCAGGG + Intergenic
1180233881 21:46444603-46444625 TCTTCTGCACTCAGTCACCATGG + Intronic
1181616765 22:24060321-24060343 TATCCTCCACTCAGCCATCAGGG - Intronic
1182007335 22:26971730-26971752 TCTGCTCCACAAAGCCATCCCGG - Intergenic
1182654898 22:31882007-31882029 TCTGCTTCCCACTGACATCAGGG - Intronic
1182991077 22:34768443-34768465 TCTGCTTCATAAAACCATCATGG + Intergenic
1183635378 22:39059162-39059184 GCTGCTGCACAGAGACATGATGG + Intronic
1183737952 22:39654283-39654305 TCTCCTGCACACACCCATGCAGG + Intronic
1183978559 22:41526897-41526919 TCTGCCCCACCCAGCCACCAGGG - Exonic
950004325 3:9681936-9681958 TCTCCTCCAGACAGCCGTCATGG + Intronic
950328782 3:12139122-12139144 TCTGAGGCACTCAGCCATCCTGG - Intronic
950926707 3:16747947-16747969 GCCGCTGCACACAGACATGAGGG - Intergenic
953563274 3:44011446-44011468 ACTGCTGGACACAGGCCTCAGGG - Intergenic
953769832 3:45771557-45771579 CCTACAGCACGCAGCCATCAGGG + Intronic
953847967 3:46443876-46443898 TCTGCTGCACACAGCCATCACGG - Intronic
954600378 3:51863061-51863083 ACTGCTGCATGCAGCCCTCAGGG + Exonic
954601482 3:51874068-51874090 ACTGCTGCATGCAGCCCTCAGGG - Exonic
955032761 3:55237050-55237072 GCTCCTGCACACACCCTTCATGG - Intergenic
959288134 3:104441993-104442015 GCTGCTGCACGCAGACATGAGGG + Intergenic
961674466 3:128556037-128556059 TCTGCTGCAGACAGCCTGCACGG - Intergenic
962250824 3:133835003-133835025 GCTTCTGCAAACAGCCCTCATGG + Intronic
962386959 3:134939451-134939473 GCTGGTGCTCACAGCCCTCAGGG + Intronic
963202668 3:142600669-142600691 TGAGCTGCACACAGCGATGAGGG + Intronic
963520686 3:146357394-146357416 CCTGCTGCACACAGACTTGAGGG - Intergenic
963521870 3:146365898-146365920 GCTGCTGCACAGAGACATAATGG - Intergenic
963663564 3:148155281-148155303 GCTGCTGCACAGAGACATGATGG - Intergenic
964358432 3:155870866-155870888 TCCGTTGCACAGAGCCATCGGGG - Exonic
964906308 3:161723964-161723986 ACTGCTGCACGCAGACATGAGGG + Intergenic
965713632 3:171580049-171580071 GCTGCTGCACGCAGACATGAGGG - Intergenic
966085679 3:176065171-176065193 GCTGCTGCACAGAGACATGATGG - Intergenic
966104884 3:176323717-176323739 GCTGCTGCACGCAGACATGAGGG + Intergenic
967561595 3:190923742-190923764 GCTGCTGCACGCAGACATGAGGG - Intergenic
968363229 3:198163738-198163760 CCTGATACAGACAGCCATCAAGG - Intergenic
969653808 4:8484487-8484509 GCTGCTGCACAGAGACATGATGG + Intronic
970042291 4:11809909-11809931 GCTGCTGCACACAGACATGAGGG - Intergenic
970256199 4:14172603-14172625 GCCGCTGCACACAGACATGAGGG + Intergenic
970532952 4:17001296-17001318 GCTGCTGCACGCAGACATGAGGG - Intergenic
970853836 4:20632373-20632395 GCTGCTGCACGCAGACATGAGGG + Intergenic
972822091 4:42713438-42713460 TCTGCTGGACAGACCCACCATGG - Intergenic
974301366 4:60071967-60071989 TCTTCTGCATACAGCTATCGAGG - Intergenic
975864873 4:78715940-78715962 GCTGCTGCACGCAGACATGAGGG + Intergenic
976457137 4:85261087-85261109 TCTGCTACACTCAGGCATTATGG + Intergenic
977010524 4:91627712-91627734 GCTGCTGCACACAGACATGATGG - Intergenic
977022587 4:91775285-91775307 ATTGCTGAACACAGCCTTCAAGG - Intergenic
977782191 4:100993649-100993671 GCTACTGCACACAGACATGAGGG + Intergenic
978516284 4:109571682-109571704 TCTGCTCCACACAGTCATTCAGG + Intronic
979146824 4:117255720-117255742 GCTGCTGCACGCAGACATGAGGG - Intergenic
980003146 4:127513553-127513575 GCTGCTGCACACAGACATGAGGG + Intergenic
980611561 4:135169382-135169404 GCTGCTGCACGCAGACATGAGGG + Intergenic
981824437 4:148924073-148924095 ACTGCAGCACACTGCCATGAGGG + Intergenic
981908736 4:149953646-149953668 TCTGCTGCCCAAATGCATCAAGG - Intergenic
982097120 4:151933409-151933431 GCTGCGGCACACTGCCATCCAGG - Intergenic
986329480 5:6706969-6706991 TCTGCTCCACACAGTCATTCAGG - Intergenic
986660790 5:10057979-10058001 TCTGCAGCCCCCACCCATCAGGG - Intergenic
986905980 5:12493379-12493401 GCTGCTGCACGCAGACATGAGGG - Intergenic
987497914 5:18670935-18670957 GCTGCTGCACGCAGACATGAGGG + Intergenic
987885126 5:23802767-23802789 TCTGCTCCACAAAGACATCTAGG + Intergenic
988992209 5:36682602-36682624 TCTGCTCCACAAAGCCTTCAAGG + Intronic
990296879 5:54410696-54410718 TCTCCTGCCGACAGCCAGCAAGG + Intergenic
993697456 5:91078650-91078672 TCTGCTGCACATGGCCAGCGTGG - Intronic
994017099 5:94979741-94979763 TCTGCTCCACACAGTCATCACGG - Intronic
994295358 5:98082698-98082720 GCTGATGCACACAGACATGAGGG - Intergenic
995296888 5:110533466-110533488 GCTGCTGCACACAGACATGAGGG - Intronic
996358407 5:122620948-122620970 GCGGCTGCACACAGACATGAGGG + Intergenic
996633121 5:125661123-125661145 TCTTCTGCTCATAGTCATCATGG - Intergenic
998581612 5:143382934-143382956 TCTACTGCCCACAGTCATCCTGG + Intronic
998721604 5:144957948-144957970 TCTGCTACACACAGTCTTCAGGG + Intergenic
1000097497 5:157984748-157984770 TCCGCTGCACAAAGCCCTCCTGG + Intergenic
1000935425 5:167300005-167300027 GCTGCTGCACGCAGACATGAGGG + Intronic
1002000737 5:176195086-176195108 TTTGCTGCACAAAGACAGCAGGG + Intergenic
1002253601 5:177943884-177943906 TTTGCTGCACAAAGACAGCAGGG - Intergenic
1003504742 6:6731047-6731069 CCTGTTGCCCACAGCCAGCAAGG - Intergenic
1004030156 6:11860356-11860378 CCTTCTGCCAACAGCCATCAAGG + Intergenic
1004523759 6:16386609-16386631 TCTGCTGCACAAGGCCACCAGGG + Intronic
1006911650 6:37567097-37567119 TGTCCTGCACTCTGCCATCAGGG + Intergenic
1006918354 6:37610806-37610828 TCTGCTCCACACAGACATTTAGG + Intergenic
1006950075 6:37814592-37814614 CCTGCTGCTCACACCCATCTTGG - Intergenic
1008330882 6:50242331-50242353 TCCTCTGAACATAGCCATCAAGG + Intergenic
1010071474 6:71750423-71750445 GCTGCTGCACGCAGACTTCAGGG + Intergenic
1010829481 6:80512396-80512418 GCTGCTGCACGCAGACATAAGGG + Intergenic
1010841085 6:80649844-80649866 GCTGCTGCACGCAGACATGAGGG + Intergenic
1010894327 6:81347226-81347248 GCTGCTGCACACAGACATGAGGG + Intergenic
1011144045 6:84192059-84192081 TCTGCTCCACACAGTCATTTAGG - Intronic
1011366748 6:86590708-86590730 TCTACTGCTCTCAGACATCAGGG + Intergenic
1012014178 6:93832155-93832177 GCTGCTGCACGCAGACATGAGGG + Intergenic
1012675308 6:102105584-102105606 GCTGCTGCACGCAGACATGAGGG - Intergenic
1013093142 6:106919681-106919703 TCTGCTCCACACAGTCATTCGGG + Intergenic
1014396282 6:120928803-120928825 GCTGCTGCACGCAGACATGAGGG - Intergenic
1014985269 6:127998791-127998813 ACAGCTGCATCCAGCCATCAGGG - Exonic
1015087726 6:129315523-129315545 TCTGCAGCACACGACCACCAAGG + Exonic
1015266959 6:131299081-131299103 GCTGCTGCACGCAGACATGAGGG - Intergenic
1015287837 6:131506422-131506444 GCTGCTGCACACAGACATGAGGG + Intergenic
1017042332 6:150317501-150317523 TCTGCTCCACACCCCTATCAAGG - Intergenic
1017861339 6:158400764-158400786 TCTGTTGCACACATCCACCCAGG - Intronic
1018495183 6:164340820-164340842 GCTGCTGCACGCAGACATGAGGG + Intergenic
1019011393 6:168846412-168846434 TCTGCTGCACCCTCCCAGCAGGG - Intergenic
1019181188 6:170188115-170188137 TCTGCTCCTCACAGCCAGCCTGG + Intergenic
1019252451 7:24973-24995 CCTGATACAGACAGCCATCAAGG + Intergenic
1020003229 7:4767382-4767404 TCTGCTGCAAGGAGCCACCACGG + Exonic
1020364671 7:7368110-7368132 TATGTTTCACACAGCAATCAGGG + Intronic
1022842981 7:34182273-34182295 GCTGCTGCAGAGAGCCACCATGG + Intergenic
1023572986 7:41591924-41591946 TCTGCTCCACAAAGTCTTCAGGG + Intergenic
1023698675 7:42872694-42872716 GCTGCTGCACGCAGACATGAGGG + Intergenic
1024969101 7:55052529-55052551 TCAGCAGGACACAGCCAGCACGG - Intronic
1026996062 7:74617515-74617537 TTTGCTGCTCAGAGCCTTCATGG + Intergenic
1027433975 7:78144676-78144698 TCTGCTGGACAGTGCCATCGTGG + Intronic
1030445595 7:109644411-109644433 GCTGCTGCATACAGACATGAGGG + Intergenic
1031539134 7:122971848-122971870 TGTGCCTCACTCAGCCATCATGG - Intergenic
1032060857 7:128723873-128723895 TCTTCTCCACACAGCAAGCATGG + Intronic
1035002565 7:155625384-155625406 TCTGCTCCACACAGTCATTCAGG + Intronic
1037486828 8:19356001-19356023 TCTGCTCCACACAGTCATTCAGG + Intronic
1039360921 8:36876120-36876142 TCTCCTGCCCACAGCCACCGAGG + Intronic
1039404140 8:37298247-37298269 GCAGCTGCACTCAGCCACCAAGG - Intergenic
1039786282 8:40837338-40837360 TCTGCTCCACACAGTCATCCAGG - Intronic
1039952316 8:42181842-42181864 TCTGCACCAGACAGCCATGAAGG + Intronic
1041197186 8:55411841-55411863 TCTGCTGCAGCCACCCATGAAGG + Intronic
1041932535 8:63302724-63302746 TCTCCAGCCCACAGCCAGCAAGG + Intergenic
1042684729 8:71425549-71425571 CCTTCTGCACACAACCATAAGGG + Intronic
1044264872 8:90169705-90169727 TCTGCTCCACACAACCATTCAGG + Intergenic
1044282135 8:90368335-90368357 TCTGCTCCACACAGTCATTAGGG + Intergenic
1045057495 8:98382171-98382193 CCTGCTGCACAGAGCCAGGAAGG - Intergenic
1045314256 8:101029513-101029535 TCAGCTCCACACAGCCGCCACGG + Intergenic
1045398442 8:101785511-101785533 TCTGCTCCACACAGTCCTCCAGG - Intronic
1045784254 8:105902503-105902525 TCTGCAGGATACAGCCACCACGG + Intergenic
1046294335 8:112199453-112199475 GCTGCTGCACACAGACATGAGGG - Intergenic
1046386133 8:113511595-113511617 GCCGCTGCACACAGACATGAGGG + Intergenic
1046440226 8:114244967-114244989 GCTGCTGCACACAGACATGAGGG - Intergenic
1046443463 8:114285616-114285638 GCTGCTGCACACAGACATGAGGG - Intergenic
1046512294 8:115215857-115215879 GCCGCTGCACACAGACATGAGGG - Intergenic
1046980318 8:120329932-120329954 TCTGCTCCACACAGTCATTTAGG + Intronic
1047195981 8:122721819-122721841 CCTGCTGCACAGAGACTTCAGGG - Intergenic
1049181315 8:141224109-141224131 TCTGCTGCACACAGAATTCTGGG + Intronic
1051052846 9:12951974-12951996 GCTGCTGCACACAGACATGAGGG - Intergenic
1053059722 9:35021584-35021606 GCTGCCGCACACAGACATGAGGG + Intergenic
1053169790 9:35870263-35870285 CCTGGGGAACACAGCCATCATGG - Exonic
1053783444 9:41633561-41633583 ACTGCTGCACAGAGACATGATGG + Intergenic
1054925195 9:70581839-70581861 TCTGCTGCCCTCAACAATCAAGG + Intronic
1055233283 9:74089290-74089312 GCTGCTGCACGCAGACATGAGGG - Intergenic
1056061370 9:82887379-82887401 GCCGCTGCACACAGACATGAGGG - Intergenic
1056233375 9:84569281-84569303 TCTGATGCACACAGTCATGAGGG - Intergenic
1056324103 9:85462276-85462298 GCTGCTGCACACAGACATGAGGG - Intergenic
1056786544 9:89596733-89596755 TCGGCTCCACACAGCCATGCAGG + Intergenic
1057822169 9:98341104-98341126 TGTGCTGCCCACAGACATAAGGG + Intronic
1057982301 9:99673789-99673811 GCTGCTGCACACAGACATAAGGG - Intergenic
1058930022 9:109709701-109709723 ACTGATGGACACAGGCATCAGGG + Intronic
1059398115 9:114051601-114051623 TCTGCTGCCCACAGCCCTCGGGG + Exonic
1060025738 9:120169485-120169507 TCTGCTCCATACAGTCATCCAGG - Intergenic
1060226423 9:121793958-121793980 GCTGCTGCACGCAGACATGAGGG - Intergenic
1060743366 9:126113972-126113994 ACTGCCGCACACAGCCCTCTTGG + Intergenic
1061583282 9:131550704-131550726 GCTGCTGCACGCAGACATGAGGG - Intergenic
1061709329 9:132476892-132476914 TCTGCTGCCTTCAGCCACCAAGG + Intronic
1061855570 9:133440306-133440328 TCAGCTCCACACAGCTAACAGGG + Intronic
1061952101 9:133942412-133942434 TCTGCTGCTTAAAGCCACCACGG + Intronic
1062527473 9:136983823-136983845 TCTGCCGCACAGAGCCGTCGAGG - Intronic
1062624862 9:137438159-137438181 GCTCCTGCCCACAGACATCAAGG - Exonic
1062747916 9:138227398-138227420 CCTGATACAGACAGCCATCAAGG - Intergenic
1185960474 X:4542563-4542585 GCGGCTGCACACAGACATGATGG + Intergenic
1187924167 X:24235279-24235301 TCGGCTGCACAGAGTCATCTGGG - Intergenic
1189738186 X:44092583-44092605 TCTGCTGAGCCCAGCCTTCAAGG + Intergenic
1191858964 X:65650372-65650394 GCCACTGCACCCAGCCATCAAGG + Intronic
1193248467 X:79259340-79259362 TCTGTTGCACACAGACAGGAAGG - Intergenic
1194760605 X:97792039-97792061 GGTGCTGCTGACAGCCATCATGG - Intergenic
1195703369 X:107721431-107721453 TCTGCTGTCCAACGCCATCAGGG - Intronic
1196073299 X:111547553-111547575 GCTGCTGCACACAGGCATGAGGG - Intergenic
1196220770 X:113110799-113110821 GCTGCTGCACGCAGACATGAGGG + Intergenic
1197065123 X:122225666-122225688 GCTGCTGCACACAGACATGAGGG - Intergenic
1197625974 X:128802943-128802965 TCTGCTCCACTCAGTCATCAGGG - Intergenic
1198373965 X:136019253-136019275 TCTGCTGCATAGGGTCATCAGGG + Intronic
1198828071 X:140719722-140719744 TCTGCAACACACAGCCTTCCTGG + Intergenic
1199576693 X:149319288-149319310 GCCGCTGCACACAGACATGAGGG - Intergenic
1200532633 Y:4357485-4357507 GCTGCTGCACGCAGACATGAGGG + Intergenic
1201473349 Y:14356787-14356809 GCTGCAGCACACAGACATGAGGG + Intergenic