ID: 953848103

View in Genome Browser
Species Human (GRCh38)
Location 3:46444806-46444828
Sequence CTGCAGAAGCAGGTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 459}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953848103 Original CRISPR CTGCAGAAGCAGGTGGAGCC AGG Intronic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900727616 1:4228153-4228175 GTGCAGAAGGAGGTGGCGCCTGG - Intergenic
900961891 1:5927768-5927790 CAGGTGAAGCAGGTGGAGTCGGG - Exonic
901008390 1:6183103-6183125 CTTGAGAAGCTGGTGGTGCCAGG - Intronic
901231331 1:7643082-7643104 CTTCAGAAGCACCTGGACCCTGG - Intronic
901301563 1:8203341-8203363 CCGCAGGCGCAGGTGGAACCAGG + Intergenic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
902124928 1:14201450-14201472 CCGGAGCAGCTGGTGGAGCCTGG + Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903663533 1:24993230-24993252 CAGCAGGAGGAGGTGGAGCAGGG - Intergenic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904091280 1:27946637-27946659 CTGCAGGAGGTGGTGGAGCAGGG + Intronic
904115790 1:28160834-28160856 CAGCAGAAGTAGGAAGAGCCAGG - Intronic
904261711 1:29291389-29291411 CTGCAGGAGAAGGAGGAGTCTGG + Intronic
906058795 1:42935225-42935247 CTGGAGAAGCAGGTTGACTCTGG + Intronic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
908510774 1:64848468-64848490 GTGAAGATGAAGGTGGAGCCTGG + Intronic
908626843 1:66054076-66054098 ATGCAGAAGGCGGTGGATCCAGG + Intronic
909803162 1:79840090-79840112 CTGCAGAAACAGGTGTAGCCAGG + Intergenic
910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG + Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
912502326 1:110130511-110130533 CAGGAGCAGCAGGGGGAGCCAGG + Intergenic
913366799 1:118048012-118048034 CTGCAGAGTCAGGTGCAGGCTGG + Intronic
913556188 1:119969552-119969574 CGGTCGATGCAGGTGGAGCCTGG + Exonic
914830106 1:151165119-151165141 CTGGAGCATCAGTTGGAGCCCGG - Exonic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
915300252 1:154947605-154947627 CTCCAGAGGCAGGTGGGGCCTGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
924044242 1:240011419-240011441 CTGCTGGAGCAACTGGAGCCAGG - Intergenic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
1062860428 10:805700-805722 CTGCAGAAGCAGCCGGGGACAGG + Intergenic
1062977584 10:1696841-1696863 CTCTAGAAGCTGGTGGAGGCTGG - Intronic
1064479569 10:15725795-15725817 TTGCAGAAGCGGGTGAAGGCCGG + Intergenic
1066004569 10:31134383-31134405 CTGAAGAGGCAGCTGGAGCGCGG - Intergenic
1066410617 10:35165219-35165241 CAGCAGGAGAAGGGGGAGCCAGG + Intronic
1066499357 10:35974767-35974789 CAGCAGAAGCAACTGGACCCAGG + Intergenic
1066627187 10:37418666-37418688 CAGCAGAAGCACCTGGACCCAGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067394993 10:45906990-45907012 CTACAGAAGTAGCTGGAGGCTGG - Intergenic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067523661 10:47026112-47026134 CTGCAGAACCATGTGGAGATGGG - Intergenic
1067560354 10:47300686-47300708 CAGCAGCAGCAGCTGGGGCCCGG - Exonic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067863313 10:49876121-49876143 CTACAGAAGTAGCTGGAGGCTGG - Intronic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068235474 10:54227448-54227470 CTGCACAAGCATGGGGATCCTGG + Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1069718892 10:70537895-70537917 CTTCATGAGCAGGTGGGGCCTGG + Exonic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071876744 10:89850959-89850981 CCACAGAAGCAGGTGGAGCAGGG + Intergenic
1072009378 10:91290277-91290299 CTGCAGAAAGAGGTAGGGCCGGG + Intergenic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1072566414 10:96620440-96620462 CTCCAGGAGCAGGTGAAGCTGGG - Exonic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1073733661 10:106320879-106320901 CTGCAGAATCTGGTGGCACCTGG - Intergenic
1074874986 10:117606770-117606792 CGGCTGAAGCTGGTGGGGCCTGG - Intergenic
1075653695 10:124147269-124147291 CTGCAAAAGCAGGTAGAGAGAGG - Intergenic
1076124823 10:127965802-127965824 CTCCAGAAAGAGGTGGAGACTGG - Intronic
1076271370 10:129155193-129155215 CAGGAGAAGCAGGTGGAACAAGG + Intergenic
1076724873 10:132408593-132408615 CTGCAGGAGCGGCTGGGGCCAGG - Intronic
1077034713 11:489052-489074 CTGCAGAGCCAGGCAGAGCCGGG - Intronic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077103309 11:831629-831651 CAGCAGCAGCAGGTGGGCCCAGG - Exonic
1077147424 11:1052388-1052410 CACAAGAAGCTGGTGGAGCCAGG - Intergenic
1077243003 11:1521017-1521039 CGTCAGAAGCAGCTGGGGCCAGG + Intergenic
1077349551 11:2086111-2086133 CTCAAGAAGCAACTGGAGCCTGG - Intergenic
1077919300 11:6631053-6631075 CTGCACCAGCAGCTGGAGGCTGG + Exonic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1079079302 11:17402818-17402840 CAGCGGTAGCAGGTGGAGCTAGG - Intronic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1081758927 11:45563462-45563484 ATGCAGTGGGAGGTGGAGCCAGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083399086 11:62411553-62411575 CTGCAGAAACAGGGAAAGCCAGG + Intronic
1083674320 11:64317058-64317080 CTCCAGCAGCAGGTGGTGCATGG + Exonic
1083885492 11:65571539-65571561 CAGCAGGAGCAGGTGGCCCCTGG - Exonic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084726802 11:70947023-70947045 GTGCAGAGGGAGGTTGAGCCTGG - Intronic
1085390371 11:76179138-76179160 CTGCAGATGCTGGTGGACCAGGG - Intergenic
1085452388 11:76642481-76642503 CTGCAGGAGAAGGCGGAGCTTGG - Intergenic
1085635826 11:78158899-78158921 TTGGAGAAGCAGGTGGGGCCAGG - Intergenic
1085763495 11:79262115-79262137 CAGAAGATGCAGGTGGCGCCTGG - Intronic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1089385550 11:118065165-118065187 GTGGAGAAGCAGGTGGGGCAGGG - Intergenic
1089968061 11:122670297-122670319 TGGCAGCAGCAGGTGGAGGCTGG - Intronic
1090068824 11:123526330-123526352 GTGCAGCAGCTGGGGGAGCCAGG - Intronic
1090879495 11:130821120-130821142 CTGCAGAAACAGGAGGAAACAGG + Intergenic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1094454931 12:30621535-30621557 TTGCAAAAGCAGGTGGACACAGG - Intergenic
1094548994 12:31432078-31432100 GTGCAGGAGGAGGTGGACCCTGG + Intronic
1095813917 12:46400716-46400738 CTGAAGGAGGATGTGGAGCCAGG + Intergenic
1097794468 12:63846735-63846757 CTGCAGGAGGAGGTAAAGCCTGG - Intronic
1097861259 12:64521034-64521056 CTGTAGAAGGATGTGGAGACTGG + Intergenic
1098155490 12:67593587-67593609 CCGCAGCAGCTGGGGGAGCCTGG + Intergenic
1101041883 12:100763634-100763656 CTGCAGGAGCAGCTGGTGTCTGG + Intronic
1101565021 12:105896893-105896915 CTGTAGGACCAGGTTGAGCCTGG + Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101870354 12:108560832-108560854 CTGGAGGAGCAGGTGGGCCCGGG - Exonic
1103267573 12:119643890-119643912 CTTCAGAGGCAGCTGGATCCTGG + Intergenic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104084491 12:125461500-125461522 CTGCAGAGGGATGTGGGGCCGGG + Intronic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104839006 12:131811630-131811652 CTCCAGAAGCTGGTGGGTCCTGG - Intergenic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1106319535 13:28624844-28624866 AGGCAGAGGCAGGTGGTGCCAGG - Intergenic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1109316496 13:60755499-60755521 CTGCACCAGCAGGTGGAGTCTGG + Intergenic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1112369792 13:98784637-98784659 CTGCAGAGGCCGGTGTGGCCTGG + Intergenic
1113583841 13:111449191-111449213 CTGGAGGAGCAGGTAGCGCCTGG - Intergenic
1113666162 13:112143286-112143308 CCGCAGAAGCAGGTGTTTCCAGG + Intergenic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1116795248 14:49383316-49383338 TTTAAGAAGAAGGTGGAGCCTGG + Intergenic
1118166857 14:63345194-63345216 CTGCAGCAGCAACTGGAGCAAGG + Intergenic
1119615332 14:76095273-76095295 CTTCAGATGCAGGTGGACCAGGG - Intergenic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121633657 14:95439435-95439457 TAGCAGGAGCAGGAGGAGCCAGG - Intronic
1121782624 14:96631713-96631735 CAGCAGACGCCAGTGGAGCCGGG - Intergenic
1122030499 14:98908267-98908289 CTGCGGAGGCAGGTGGGGCGGGG - Intergenic
1122116073 14:99527884-99527906 CTGCAGAGGCGGGAGGACCCCGG + Intronic
1122461668 14:101900861-101900883 CTGCAGTGGCAGCTGTAGCCAGG - Intronic
1122650536 14:103223978-103224000 CTGCAGGTGGAGGTGGATCCTGG - Intergenic
1122673926 14:103394366-103394388 CTGTACAAGCAGGTGCAGACGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1202902202 14_GL000194v1_random:50425-50447 CTGCGGAATCCAGTGGAGCCTGG - Intergenic
1123807263 15:23887878-23887900 CTGCATAAGCAGGTATAGCATGG - Intergenic
1123995341 15:25714133-25714155 CTGCAGCAGCATCGGGAGCCTGG - Exonic
1125782293 15:42280502-42280524 CAGCAGAAGCAGTTGGCTCCAGG + Intronic
1126974198 15:54156209-54156231 CTCCAGAAGCAGGTGCACTCAGG + Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128437409 15:67667482-67667504 CTGCAGGGGCTGGGGGAGCCTGG + Intronic
1129869933 15:78933643-78933665 CTGCTGAAGGAGGCGGAGCTCGG + Intronic
1129948077 15:79559553-79559575 GTGCTGAAGCGGGTGGAGTCCGG - Intergenic
1130192134 15:81747498-81747520 ATGTTGCAGCAGGTGGAGCCTGG + Intergenic
1130899493 15:88196423-88196445 CTGCAGAAGAATGTGGAGCAGGG + Intronic
1131750415 15:95500595-95500617 GTGCTGAAGTGGGTGGAGCCAGG + Intergenic
1132525033 16:410205-410227 CCGCAGGAGCTGCTGGAGCCTGG - Intronic
1132548362 16:543936-543958 GTGCACAGGCTGGTGGAGCCTGG + Intronic
1132646917 16:1003420-1003442 CTGTGGCAGCAGGTGGGGCCCGG - Intergenic
1132659552 16:1055292-1055314 CTGAAGAATCAGGCGGAGCACGG - Intergenic
1132866278 16:2094151-2094173 CTGCAGAGGCTGGGGGAGCTGGG - Exonic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1133978831 16:10619017-10619039 CTGCAGAAGCCGGGCTAGCCAGG - Intergenic
1134080745 16:11323375-11323397 GTGCAGATGGAGGTGGAGGCTGG + Intronic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1136110531 16:28061848-28061870 CTGAAGAAGGAGGTGGGGCGGGG + Intronic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136547713 16:30965052-30965074 CTCCAGAACCTGGTGGAGGCGGG + Exonic
1137021429 16:35432204-35432226 TTGCTGGAGCAGCTGGAGCCAGG - Intergenic
1137299739 16:47137344-47137366 ATGCAGAAGCTGCTGGAGCTGGG + Intronic
1137441860 16:48504769-48504791 CTGCGGAAGCTGGTGGGGCAGGG + Intergenic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137714943 16:50592825-50592847 GTGCAGAAGCGGGTGGAGACAGG + Intronic
1137943678 16:52713733-52713755 CTGCAGAATCAGGTTCAGACTGG - Intergenic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138438872 16:57022490-57022512 CTGCAGGAGGAGGTGGGGCTGGG - Intronic
1138601832 16:58060244-58060266 CTGAAAATGCAGGTGGAGCCAGG - Intergenic
1139095755 16:63703225-63703247 CTCCAGAAGCAGGTGCCTCCTGG + Intergenic
1139346992 16:66310363-66310385 CTGAAGAAGGAGGTGGTCCCCGG - Intergenic
1139476868 16:67207228-67207250 CCACAGGAGTAGGTGGAGCCCGG + Exonic
1140878086 16:79172028-79172050 CTGCAGAAGCCTGTGGAGCGAGG + Intronic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141149827 16:81556266-81556288 CTGCAGAAGGAGGTGGCGGCGGG + Intronic
1141628592 16:85274871-85274893 CTGCAGATGCATGTGGGGCCTGG + Intergenic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1141805682 16:86340058-86340080 CTGGAGAGGGAGGTGGGGCCAGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142702627 17:1673346-1673368 CTGCAGAATGAGGTACAGCCTGG - Exonic
1142768117 17:2077024-2077046 CTCCAGAAGCGGATGGATCCTGG + Intronic
1143385262 17:6525484-6525506 GAGCAGAAGCAGGTGCAGCTAGG + Intronic
1143551702 17:7634373-7634395 CTGCGGAACCAGGTGGGTCCTGG - Intergenic
1143659559 17:8316126-8316148 CTGCAGCAGCATGCGCAGCCGGG - Exonic
1143845369 17:9769476-9769498 GGACAGAAGCAGCTGGAGCCAGG - Intergenic
1144648001 17:16988423-16988445 CCACAGAAGTGGGTGGAGCCGGG - Intergenic
1144948517 17:18981948-18981970 CTGCAGGAGGCGGTGGAGCTGGG - Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146515177 17:33483489-33483511 CTGCACTGGCAGGTGGAGCGAGG + Intronic
1146661168 17:34666009-34666031 CCGCAGGAGGAGGTGGGGCCTGG + Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147447656 17:40484579-40484601 CTGCTGAGGAAGGAGGAGCCAGG - Exonic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1147938730 17:44029837-44029859 ATAGAGAAGTAGGTGGAGCCAGG - Intergenic
1148027046 17:44595566-44595588 CAGCAGAGGGAGGTGGTGCCTGG + Intergenic
1148085558 17:44991814-44991836 CTTCTGAAGCAGGTGGAGCTGGG - Intergenic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148533753 17:48420664-48420686 CTGGAGAATCAGGGGGTGCCAGG - Intronic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1150391006 17:64789904-64789926 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1150409788 17:64933958-64933980 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1151692818 17:75697338-75697360 TTGCAGAAGCTGGTGGAGAGTGG - Intronic
1152335464 17:79698018-79698040 CTGCAGGAGCAGGTGGGGGTGGG + Intergenic
1152532949 17:80931147-80931169 CTGCAGGCGGAGGTGGAACCAGG - Intronic
1152650879 17:81492103-81492125 CAGCAGGAGCAGGTGTAGCCAGG + Intergenic
1152757038 17:82091392-82091414 GTGCAGAAGCTGCTGGAGCAGGG - Exonic
1152941906 17:83177223-83177245 CTGCAGAGCCTGCTGGAGCCGGG + Intergenic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154486351 18:14874694-14874716 CAGCAGAATCAGGCAGAGCCTGG + Intergenic
1155002753 18:21703417-21703439 CTGCAGCTGGGGGTGGAGCCGGG + Intronic
1155263250 18:24065619-24065641 GTGCAGTAGTTGGTGGAGCCAGG + Intronic
1155425222 18:25700022-25700044 CTGGAGAAGCTGGAGAAGCCAGG - Intergenic
1156148959 18:34222121-34222143 CTGCAGAAGCCAGTGGGGCTGGG - Intronic
1156475804 18:37404607-37404629 GTGCTGGAGCAGGTCGAGCCAGG - Intronic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1157275843 18:46310795-46310817 CTGCAGTGGCATCTGGAGCCAGG - Intergenic
1157552425 18:48590780-48590802 TGGCAGAAGCCAGTGGAGCCTGG - Intronic
1158545028 18:58388911-58388933 CTGCTATGGCAGGTGGAGCCTGG + Intronic
1158801771 18:60919674-60919696 CTGAAGAAGCAGGGGGACTCTGG + Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160921581 19:1523403-1523425 GTGGAGCAGCAGGTGGACCCTGG - Intergenic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161322210 19:3646510-3646532 CTGCAGTGGGAGGTGGTGCCCGG + Intronic
1161443206 19:4304201-4304223 CTGGAGGAGCTGTTGGAGCCTGG + Intergenic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1163264533 19:16211184-16211206 CTGGAGAAGCACTTGAAGCCCGG - Intronic
1163320759 19:16573149-16573171 CTGCAGAAGGGGGAGGTGCCGGG + Intronic
1163469621 19:17488825-17488847 CTGCAGGGGGAGGGGGAGCCGGG - Intronic
1163953666 19:20614077-20614099 CTGCAGAAGCAGGAGAACTCAGG + Intronic
1164531293 19:29050209-29050231 CAGCAGAACCAAGTGGAGCTGGG + Intergenic
1165005054 19:32797948-32797970 CTACAGAAGACAGTGGAGCCTGG + Intronic
1165942684 19:39423132-39423154 CTGCAGAGGCCCTTGGAGCCAGG - Exonic
1166101942 19:40576375-40576397 CTGGAGAAGCCGCTGGGGCCCGG + Exonic
1166205168 19:41264750-41264772 CTGCAGCCGCACGCGGAGCCCGG + Exonic
1166738284 19:45098889-45098911 CAGCAGCAGGAGGTGGAGCTGGG - Intronic
1166855128 19:45779583-45779605 GTGCAGAAGCGGGTGGAGTTGGG - Intronic
1166863803 19:45824261-45824283 AAGCAGCAGCAGGTGGAGCCTGG - Intronic
1167011703 19:46813107-46813129 CATCAGAGGCAGCTGGAGCCGGG + Intergenic
1167152219 19:47716844-47716866 CTGCTGGAGCAGGAGGTGCCCGG + Exonic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
925457045 2:4024669-4024691 CTGCACATGCAGGTAGAGTCTGG + Intergenic
926146127 2:10398092-10398114 ATGCAGGAGCAGGTGGGGCAGGG - Intronic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927793369 2:26028313-26028335 CTCCAGCAGCAGGTGGTGCATGG + Intergenic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
931089395 2:58869280-58869302 TAGCTGAAGCAGGTGGAGCCAGG + Intergenic
932592795 2:73077152-73077174 CTGCAGAGTCAGGTGCAGACTGG + Intronic
932749537 2:74362594-74362616 CAGCATAAACTGGTGGAGCCAGG - Intronic
933847323 2:86336842-86336864 CTGCAAAAGGAGTCGGAGCCGGG + Intronic
934504481 2:94880005-94880027 CTGCGGAATCCAGTGGAGCCTGG + Intergenic
934530408 2:95083608-95083630 AGCCAGAAGCAGGAGGAGCCTGG - Intergenic
934553730 2:95276875-95276897 CTGCAGAGCCCGGTGGGGCCTGG + Intronic
934562197 2:95319225-95319247 GTGCGGAGGCTGGTGGAGCCGGG + Intronic
934680929 2:96283520-96283542 CGGCAGAGGTAGGTGGGGCCTGG - Exonic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
934847762 2:97673261-97673283 CTGAAGAAGGATGTGGAGCAAGG - Intergenic
935217828 2:100988729-100988751 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935217906 2:100988951-100988973 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
936238441 2:110766820-110766842 CAGCAAAAGCAGGTGGTGCCAGG - Intronic
937434299 2:121867515-121867537 GAGCAGAAGCAGGTGGCACCTGG - Intergenic
938381517 2:130838834-130838856 CTCCAGGAGCAGGTGGAGTGTGG + Intronic
939013223 2:136871660-136871682 CTTCAGAATCAGGTAGGGCCTGG + Intronic
939219867 2:139287931-139287953 CTGCAGCAGAAGGTGGAGCCTGG + Intergenic
940803405 2:158157422-158157444 GTGAAGAAGCAGCTAGAGCCAGG + Intergenic
941677286 2:168357278-168357300 CTGCAGCAGCTGGTCAAGCCAGG - Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
946147584 2:217742651-217742673 GTGCAAAGGCAGGTGGAGACAGG - Intronic
947420445 2:229937616-229937638 CTGCTGAAGCAGGGAGAGCCAGG - Intronic
947531270 2:230910027-230910049 CTGCAGGACCAGCTGGACCCTGG + Exonic
947701759 2:232240242-232240264 CTCCTGGAGCAGGTGGAGCTAGG - Intronic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
948216700 2:236237766-236237788 CTGCAGCAGCAGGCGGACGCAGG + Exonic
948384756 2:237574605-237574627 CCCCAGAAGCAGGTGGGCCCAGG + Exonic
948658329 2:239490809-239490831 CTCCAGAAGGCAGTGGAGCCGGG - Intergenic
948659594 2:239498859-239498881 CTGCAAAGGGAGGTGGGGCCAGG + Intergenic
949002979 2:241628037-241628059 CTGGAGAGGCTGGTGGAGCTGGG - Intronic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1169077229 20:2768604-2768626 CTACAGAGTCAGGTGGGGCCAGG + Intergenic
1169164278 20:3408295-3408317 CTGCAGAAACCGGTAGAGCTAGG - Intergenic
1169783102 20:9330189-9330211 CTGGGAAAGCAGGTGGAGTCTGG - Intronic
1170767656 20:19304543-19304565 ATGTACAAGGAGGTGGAGCCAGG - Intronic
1173640744 20:44600242-44600264 CTGCAGAGGCAGGCAGGGCCAGG + Intronic
1173863668 20:46300380-46300402 AAGCAGAAGCAGGTGGATCCAGG - Intronic
1173865071 20:46308113-46308135 CTCCAGCCGCAGGAGGAGCCGGG - Intronic
1174454195 20:50638134-50638156 CTCCAGAACCACCTGGAGCCAGG + Intronic
1174472643 20:50771911-50771933 CTCCAGAACCACCTGGAGCCAGG - Intergenic
1174797713 20:53536367-53536389 CTGCTGAAGCCCGTGGATCCAGG - Intergenic
1175750558 20:61494087-61494109 CTCCAGGAGCAGGTGGAGACAGG + Intronic
1176032006 20:63017267-63017289 CTGAAGAAGGGGGTGGTGCCTGG + Intergenic
1176621570 21:9065192-9065214 CTGCGGAATCCAGTGGAGCCTGG - Intergenic
1176794951 21:13364686-13364708 CAGCAGAATCAGGCAGAGCCTGG - Intergenic
1177161385 21:17551656-17551678 CTGTAGCAGCAGGTGTATCCAGG + Intronic
1178497311 21:33098242-33098264 TTGCAGAAGCAAGTGGTCCCGGG - Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179438865 21:41379650-41379672 CTGCAGAAAGACGGGGAGCCTGG + Intronic
1179840849 21:44072312-44072334 ATGCAGAAGCAAGAGCAGCCAGG - Intronic
1180099126 21:45576171-45576193 CTGCAGATGCAGGAGGACCCTGG + Intergenic
1180148904 21:45937697-45937719 TTGCAGGTGCAGGTGGGGCCAGG + Intronic
1181462632 22:23094573-23094595 CTGCAGAAGGAGGTAGAGGGGGG - Intronic
1182302155 22:29342958-29342980 CTGCAGAAGCATGGGGGGTCTGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182620731 22:31617110-31617132 CTACAGGAGCAGGTGTTGCCTGG + Intronic
1184111930 22:42400728-42400750 CTCAAGAAGCAGGTGGTGCAGGG - Intronic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184824247 22:46936346-46936368 ATGCAGAACCACGAGGAGCCTGG - Intronic
1184948421 22:47821163-47821185 CTGCAGAGGCAGGGAGAACCAGG + Intergenic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185182233 22:49370018-49370040 CTCCAGAGGCAAGTAGAGCCTGG + Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949828325 3:8186129-8186151 CTGCAGAACAAGGTGGAGTTTGG - Intergenic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
952945738 3:38477065-38477087 CTGCAGAATGAGGTGGGGGCTGG + Intronic
953383658 3:42492623-42492645 CTGCAGAGGAGGGTGGAGGCTGG + Intronic
953589993 3:44242117-44242139 CTGCAGAAGCGGCAGGCGCCAGG + Exonic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
953916915 3:46926216-46926238 CTCCAGGAGGAGGTGGCGCCTGG + Intronic
955331129 3:58048344-58048366 CTGGAGAACAGGGTGGAGCCTGG + Intronic
956683529 3:71803634-71803656 CTGCAGGATCAGGTGGAGTCTGG + Intergenic
959991289 3:112635075-112635097 CAGGAGCTGCAGGTGGAGCCAGG - Intronic
960258215 3:115533624-115533646 CTCTGGAAGCAAGTGGAGCCTGG + Intergenic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961078361 3:124002989-124003011 CTGCTGAAGGAGGTGGGGGCGGG - Intergenic
961126297 3:124421154-124421176 CTGCAGAGCCAGGTGGACTCAGG + Intronic
961356051 3:126340719-126340741 CTGAAAAAGCAGGTGGAGATGGG - Intergenic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
966566276 3:181385062-181385084 CTGCAACAGCATGGGGAGCCTGG - Intergenic
968578988 4:1380967-1380989 CTGCAGAAGCAGGAGCGCCCGGG + Exonic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969217463 4:5733690-5733712 CTCCAGCAGGAGGTGTAGCCCGG - Intronic
969495916 4:7526058-7526080 CTGCAGTTGCAGGTGGGGACAGG - Intronic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
970194400 4:13541267-13541289 CTGCACAAGCAGGAAGCGCCTGG - Exonic
975243736 4:72094131-72094153 CTCAAGCACCAGGTGGAGCCTGG - Intronic
975698119 4:77034535-77034557 CTGCAAAAGCAGGTGAATGCGGG - Exonic
976378673 4:84374756-84374778 CAGCTGAAGCAGGTGTAGCTGGG - Intergenic
976386128 4:84460798-84460820 CTGCAGAACTTAGTGGAGCCTGG + Intergenic
978387772 4:108192765-108192787 CTGCAGAAGGAGGTGGAGAGGGG + Intergenic
979348397 4:119616645-119616667 CTGCAGCAGCTGCTGGAACCAGG - Intronic
980282146 4:130736451-130736473 CTGCAGCAGCAGGGGAAGCATGG + Intergenic
982331207 4:154183951-154183973 TAGGAGAAGCAGGTGGAGACGGG + Intergenic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
983403777 4:167299200-167299222 CTGGAGAAGAAGTTAGAGCCTGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985305693 4:188536921-188536943 CTTCTGAATGAGGTGGAGCCGGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986123717 5:4866706-4866728 CTCCACGAGCAGCTGGAGCCCGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987087367 5:14483390-14483412 CTGCAGAGCCAGGAGGACCCTGG - Intronic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988497620 5:31758404-31758426 CAGCAGATGCATGTGGGGCCTGG + Intronic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
994515877 5:100772527-100772549 ATGCAGAAACTGGTGGAGCTAGG - Intergenic
996102720 5:119460905-119460927 CAGAAGAAGCAGCTGAAGCCAGG + Intronic
996230771 5:121060879-121060901 CTTCAGAAGCATGTGGAGCATGG + Intergenic
996239039 5:121171548-121171570 CTGCTGAAGCTGGTGCTGCCAGG + Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997224483 5:132198675-132198697 CTGCAGAATGCAGTGGAGCCTGG - Intronic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
998200419 5:140114076-140114098 CGGCGGCAGCAGGCGGAGCCGGG + Intronic
999144428 5:149382970-149382992 CTGGAGAAGGAAGTGCAGCCGGG + Intronic
1001116725 5:168946588-168946610 CTGCAGAAGATGCTGGAGCCAGG - Intronic
1001227110 5:169954531-169954553 CAGCAGAATCAGGCAGAGCCTGG + Intronic
1001679736 5:173547386-173547408 CCTCAGGAGCAGGTGGAACCTGG + Intergenic
1002056347 5:176599790-176599812 CTTTTGAAGCAGCTGGAGCCAGG + Exonic
1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG + Intergenic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002280542 5:178127499-178127521 CTGCCCAAGCATGAGGAGCCTGG - Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003336537 6:5178490-5178512 CTGCAGTAGTGGGTGGAGCGGGG + Intronic
1004995347 6:21186012-21186034 ATGCAGAAGCTCTTGGAGCCGGG + Intronic
1005462641 6:26083624-26083646 TTGCAGCAGAAGGTGGAGCCAGG + Intergenic
1005727844 6:28667216-28667238 CTGCAGAAGAACGTGGAGCTAGG + Intergenic
1005961336 6:30695708-30695730 CTGCAGAATCACGTGAACCCGGG - Intergenic
1006160676 6:32039071-32039093 CTGCAGGAGGAGGTGGGGGCTGG - Intronic
1006226026 6:32536994-32537016 GTGCATGAGTAGGTGGAGCCTGG - Intergenic
1006732045 6:36243578-36243600 CTGAGGAAGGAGGTGCAGCCTGG + Intronic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007971782 6:46059038-46059060 CTGCACATCCAGGTTGAGCCTGG - Intronic
1008711320 6:54230496-54230518 CTGCAGAAGAGGCTGGAGGCAGG + Intronic
1010360431 6:74987060-74987082 CTGCAGGAGCTGGAGCAGCCGGG - Intergenic
1013596024 6:111661908-111661930 GTGCTGGAGCAGGTGGAGCGAGG - Exonic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014161878 6:118179069-118179091 GAGCAGAAGCAACTGGAGCCAGG + Intronic
1014175367 6:118325918-118325940 CGGCAGAAGCAGTTGTGGCCAGG - Intergenic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1017593862 6:156007560-156007582 TTGCAGAAGAAGTTGAAGCCAGG - Intergenic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1019100646 6:169626464-169626486 CTGCACCAGCAGGAGGGGCCTGG - Intronic
1019422670 7:958357-958379 CAGCTGAGGCAGGTAGAGCCAGG - Intronic
1019499279 7:1356238-1356260 CTGCAGATCCCGGAGGAGCCTGG - Intergenic
1020917434 7:14213614-14213636 TTGCAGAAGCAGGTGTTACCTGG + Intronic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1022613147 7:31897216-31897238 CTGCTGATGCAGGTGCAGTCAGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1024011622 7:45271721-45271743 CTGCAGATGTGAGTGGAGCCTGG + Intergenic
1024608867 7:51046046-51046068 GTGCAGAAGCAGGTGGGGGTGGG + Intronic
1024954162 7:54898736-54898758 CTGGAGAAGCAGGTCGTGCTCGG - Intergenic
1025739429 7:64183538-64183560 CTGCAGCAGATGGGGGAGCCAGG + Intronic
1026243693 7:68599288-68599310 CTACATAAGTAGATGGAGCCTGG - Intergenic
1026849117 7:73713979-73714001 CTGGCAAAACAGGTGGAGCCTGG - Intronic
1027453371 7:78358543-78358565 TTGCAGAACCAAGTGGGGCCAGG + Intronic
1029045288 7:97621427-97621449 CTGCAGGACCAGGCTGAGCCTGG - Intergenic
1029216558 7:98954589-98954611 CTGCAGAACCTGCTGGTGCCTGG - Intronic
1029366576 7:100120198-100120220 CTGCAGAGGCTGCAGGAGCCGGG + Intronic
1029591570 7:101510537-101510559 CTGCAGAGACAGGGCGAGCCTGG + Intronic
1029598441 7:101549938-101549960 CTGCAGAGGCAGGGCGAACCTGG - Intronic
1029729399 7:102429582-102429604 GTGCAGAAGCAAGTGGGGACAGG + Intergenic
1029968515 7:104765860-104765882 CTGCACAAGTGTGTGGAGCCTGG - Intronic
1031474449 7:122205388-122205410 CTGCAGAAGATGGCAGAGCCTGG + Intergenic
1031915544 7:127559682-127559704 GTTCAGAAGAAGGTGGAGGCTGG - Intergenic
1032017597 7:128389682-128389704 CAGGAGCAGCAGGTAGAGCCAGG - Intergenic
1032036504 7:128525324-128525346 CAGGAGAGGCAGGTGGACCCGGG + Intergenic
1032205039 7:129856093-129856115 CGGCACAATCAGGTGGAGGCAGG + Intronic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1033083967 7:138325180-138325202 CTGCAACAGCTGGTGCAGCCTGG - Intergenic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034532315 7:151703659-151703681 CTGAGGAGGCAGGTGGTGCCTGG - Intronic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034924449 7:155110088-155110110 TTCCTGAAGCAGGTGCAGCCGGG - Intergenic
1035060025 7:156062355-156062377 CTGCAGGAGCAGGGGGAGTTGGG - Intergenic
1035665417 8:1376571-1376593 CTGCTGAAGAAGGGGGAGCCGGG + Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1036780131 8:11641151-11641173 CGGGAGAGTCAGGTGGAGCCTGG - Intergenic
1037839159 8:22231795-22231817 CTGCAGAGCCCAGTGGAGCCAGG - Exonic
1038816703 8:30912152-30912174 CTGCAGGAGCCGGTGGACGCGGG - Intergenic
1040568996 8:48591701-48591723 CTGATGAAGCAGGTGGACCTGGG - Intergenic
1040778284 8:51073756-51073778 CTGCAGGAGCAGGTCGTGGCTGG - Intergenic
1042298568 8:67250099-67250121 TTGGAGAGGCAGGTGGAGCCAGG + Intronic
1042346052 8:67729149-67729171 CTGCAGTCCCAGGTAGAGCCTGG - Intronic
1043310080 8:78847938-78847960 CAGCAGAAGCAGGTGGGGGGGGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044701482 8:94969059-94969081 TTGCAGAAGAAGTTGGAGTCTGG + Intronic
1047289252 8:123514812-123514834 CTGCAGAAGCAGGAGGTATCAGG - Intronic
1048572027 8:135664444-135664466 CTGCAGAAGCAGCTGCTGCTCGG + Intergenic
1049002300 8:139833805-139833827 CTTCAGGAGCAGGAGGGGCCGGG + Intronic
1049018379 8:139937508-139937530 CTTCAGGAGCAGGCGGAGGCTGG + Intronic
1049229846 8:141476278-141476300 CTGCAGAGGCAGGTGGGCCAGGG - Intergenic
1049288579 8:141789939-141789961 CGGCAGCGGCAGGTGGAGCAGGG - Intergenic
1049341293 8:142113952-142113974 CTGAAGAAGCTGGTGGGCCCAGG - Intergenic
1049434387 8:142579722-142579744 CCTCAGAGGCAGGTGCAGCCCGG - Intergenic
1050325036 9:4490433-4490455 CGGCGGCAGCAGGAGGAGCCGGG + Exonic
1050746536 9:8882790-8882812 CAGGAGAATCAGGTGAAGCCAGG + Intronic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1053013306 9:34647572-34647594 CCCCAGCAGCAGTTGGAGCCAGG - Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053174008 9:35909553-35909575 CTGCAGCACCAGGTACAGCCAGG + Intergenic
1053887275 9:42653506-42653528 CAGCAGAATCAGGCAGAGCCTGG + Intergenic
1054226296 9:62460957-62460979 CAGCAGAATCAGGCAGAGCCTGG + Intergenic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1055167491 9:73214755-73214777 CTGCAAGATCAGGTAGAGCCAGG + Intergenic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1056199558 9:84261684-84261706 CTGCAGAACCAGGAAGAACCTGG - Intergenic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1056950347 9:91036446-91036468 CTGGACAAGCAGGTGCTGCCAGG - Intergenic
1057076669 9:92141665-92141687 CCGCAGTACCAGGTGGAGACAGG - Intergenic
1057180118 9:93025201-93025223 CTGCAGCAGCCTGGGGAGCCAGG + Intronic
1058152339 9:101476703-101476725 CTGAAGAAGCCGGTGGAACTGGG + Exonic
1058628350 9:106959337-106959359 CTGCAGAATCAAGTGGAACAGGG - Intronic
1058636577 9:107044041-107044063 CGGGAGCAGCAGATGGAGCCGGG + Intergenic
1059399286 9:114058906-114058928 GGGCAGAAGCAGGTGGGGTCAGG - Intergenic
1060482117 9:124022775-124022797 CTGCAGCTGCGGGGGGAGCCGGG + Intronic
1060804338 9:126565043-126565065 CTGCAGTAGGAGGTGGAGCTGGG - Intergenic
1061267203 9:129513859-129513881 CTGCAGGGGGAGGTGCAGCCAGG + Intergenic
1061792948 9:133068148-133068170 CTGCTGAGGCAGGCGGGGCCTGG - Intronic
1061795554 9:133083932-133083954 CTGCTGAGGCAGGCGGGGCCTGG - Intronic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1061970388 9:134041749-134041771 CTGCAGGAGCAGGTGGGCACTGG - Exonic
1062010488 9:134264273-134264295 CTGCAGACGCAGCTGGTACCTGG + Intergenic
1062381502 9:136288995-136289017 CGGCAGCGGCAGGTGGAGCCCGG + Intronic
1062540271 9:137038942-137038964 ATGCAGAGCCAGGTGGACCCAGG - Intergenic
1062570420 9:137182591-137182613 CAGCAGGAGCCGGTGGAGTCTGG - Intronic
1203565349 Un_KI270744v1:83882-83904 CTGCGGAATCCAGTGGAGCCTGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186595326 X:10975162-10975184 CTTTAGAAGCAGGTGCAACCAGG - Intergenic
1188881865 X:35499561-35499583 ATGCAGGAGCGGGGGGAGCCGGG - Intergenic
1190825538 X:54014771-54014793 CTGGAGAAGCCTGTGGAGCTTGG - Intronic
1193707906 X:84845075-84845097 CTGCACAAGCAGGGAGACCCTGG + Intergenic
1193711311 X:84883851-84883873 CTGCACAAGCAGGGAGACCCTGG - Intergenic
1195533386 X:105982735-105982757 CTGTGGGAGCAAGTGGAGCCTGG + Intergenic
1195745800 X:108116733-108116755 CTGGAGAGGAAGGTGGAGCCAGG - Intronic
1197839482 X:130730245-130730267 CTGCAGTAGCTGGTGGGGACAGG + Intronic
1199270025 X:145872577-145872599 CAGCAGTAGCAGGGGGAGCCTGG + Intergenic
1199489546 X:148383132-148383154 CTGCAGAAGCAGGTGAGTCAGGG + Intergenic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic
1200397491 X:155999668-155999690 CCCCAGAAGCAGCTGGAGCCTGG - Intronic
1200910857 Y:8530175-8530197 CTGCAGAAACACGTGGACTCAGG + Intergenic
1201158095 Y:11150645-11150667 CTGCGGAATCCAGTGGAGCCTGG - Intergenic
1201798467 Y:17927046-17927068 GTGCAGAACCATCTGGAGCCAGG - Intergenic
1201803086 Y:17978911-17978933 GTGCAGAACCATCTGGAGCCAGG + Intergenic
1202359787 Y:24095736-24095758 GTGCAGAACCATCTGGAGCCAGG - Intergenic
1202510991 Y:25574378-25574400 GTGCAGAACCATCTGGAGCCAGG + Intergenic