ID: 953849013

View in Genome Browser
Species Human (GRCh38)
Location 3:46450915-46450937
Sequence CCTGCCAGGCAGCAGCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 572}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953849013_953849023 26 Left 953849013 3:46450915-46450937 CCGTGCAGCTGCTGCCTGGCAGG 0: 1
1: 1
2: 3
3: 68
4: 572
Right 953849023 3:46450964-46450986 GTTTCTGCGGCATCTCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 244
953849013_953849019 13 Left 953849013 3:46450915-46450937 CCGTGCAGCTGCTGCCTGGCAGG 0: 1
1: 1
2: 3
3: 68
4: 572
Right 953849019 3:46450951-46450973 ACCAGACCCGTCTGTTTCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953849013 Original CRISPR CCTGCCAGGCAGCAGCTGCA CGG (reversed) Intronic
900079089 1:842262-842284 CCTGCCTGGCAGCAGATCAAAGG + Intergenic
900362760 1:2297881-2297903 CCTGCCAGGCTGCAGCCACGGGG - Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900465765 1:2824779-2824801 CCCCCCAGGCATCAGCTCCAGGG - Intergenic
900534461 1:3170213-3170235 GCAGCCAGGCTGCAGGTGCAGGG - Intronic
900611700 1:3547018-3547040 CCCCCCAGCCACCAGCTGCAGGG - Intronic
900673582 1:3870427-3870449 TCTGCCTGGCAGGAGCAGCAAGG - Intronic
900935610 1:5764627-5764649 CCTGCCTTGCAGCGGCTGCTCGG - Intergenic
901012545 1:6209782-6209804 CTCACCAGGCAGCAGATGCAGGG + Intronic
901275312 1:7986671-7986693 CATACCAGGCAGCAGGAGCAGGG + Intergenic
901456156 1:9364072-9364094 CCTGCCAGGCTGCAGCAGTGAGG - Intronic
901648171 1:10727760-10727782 AAGGCCAGGCAGCAGCTGCCAGG + Intronic
901684734 1:10937596-10937618 CCGGCCCGGCTGCAGCTGCGTGG - Intergenic
901754831 1:11435147-11435169 CCTGCCAGGCTGCAGCGGGCAGG - Intergenic
901762082 1:11478346-11478368 GCTGCCAGCCCCCAGCTGCAGGG - Intergenic
902181017 1:14688386-14688408 TGTGCCAGGCAGCAGGTGCTGGG + Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
902674487 1:17999339-17999361 CCTGCCATGGAGCAGCTTCATGG - Intergenic
902994743 1:20215311-20215333 CTTGCCAGGTAGGAGCTGGAAGG - Intergenic
903013764 1:20348677-20348699 CCTCCCAGGCACCAACTGCCAGG + Intronic
903177033 1:21587436-21587458 CATGCCAGGGGGCAGCTCCAGGG + Intergenic
903186314 1:21631235-21631257 CCTGGGCGGCAGCAGCTGCGGGG + Intronic
903206667 1:21787462-21787484 CCTGGGAGGCAGCGGTTGCAGGG + Intergenic
903217640 1:21852080-21852102 CCTGCCCGGCACCAGGTACAGGG - Exonic
903795745 1:25927694-25927716 ACAGGCAGGCAGCAGCTGCTGGG - Intergenic
903886918 1:26546076-26546098 CTTCCCAGGCACCTGCTGCAAGG - Intronic
904251004 1:29224277-29224299 CCAGCCAGACAGGAGCTGCATGG - Intronic
904629380 1:31829739-31829761 CCTGCCAGACGACAGCTGCCTGG - Intergenic
905266009 1:36754935-36754957 GCTGCCTGTCAGCAGCTGCTTGG + Intergenic
905307450 1:37029444-37029466 CAAGCCAGGCTGCAGCTGCAAGG + Intronic
906202808 1:43970958-43970980 ACATCCACGCAGCAGCTGCAGGG - Exonic
906546672 1:46624308-46624330 CCAGGCAGGCAGCAGTGGCAGGG - Intergenic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
907472995 1:54686281-54686303 CCTGTCCGTCAACAGCTGCATGG + Exonic
907519337 1:55012904-55012926 CCTGACACTCAGCAGCTGCCTGG - Intergenic
907718080 1:56946328-56946350 CATGGCAGGGAGCAGCTGGAGGG + Intronic
907886665 1:58598298-58598320 CCTGGCAGAGAGCTGCTGCAGGG + Intergenic
908177790 1:61572867-61572889 CCTGAGAAGCAGCACCTGCATGG + Intergenic
908363281 1:63390847-63390869 CATGCCATGCAGCTGCTGCTGGG + Intronic
909548188 1:76869340-76869362 CCTTCCGGGAAGCTGCTGCATGG + Intronic
909852869 1:80490946-80490968 ACTGACAGGCAGAAGCTACATGG + Intergenic
910051924 1:82984989-82985011 CGTGCCATGCAGCAGCATCAGGG - Intergenic
910349430 1:86278358-86278380 CATGCCATGCAGCAGCTGCCAGG + Intergenic
910915117 1:92279876-92279898 CCTGCGAGGCTGCAGCTAGACGG + Intronic
915287057 1:154859745-154859767 CCTGCCACGCGACATCTGCAAGG - Intronic
915315922 1:155029250-155029272 CTGGCCCGGCACCAGCTGCAGGG - Exonic
915347988 1:155207797-155207819 TCTGCCAGTCAGGATCTGCAGGG - Exonic
915603933 1:156939111-156939133 CACGCCAGGCAACAGCTCCAAGG - Intronic
915834795 1:159168186-159168208 CCTCCCGGGCAGGAGCAGCATGG + Intergenic
918002800 1:180513323-180513345 CATGTCAGGCAGGAGTTGCATGG + Intergenic
920337106 1:205252275-205252297 CCTCCCTGGAAGCAGCTGAAAGG + Intronic
920365433 1:205445756-205445778 CGTGACAGGCAGCAGCAGCTGGG + Intronic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923407862 1:233680568-233680590 CCAGCCAGGCAGCAGTAGAATGG + Intergenic
1062857866 10:788350-788372 CCAGGGTGGCAGCAGCTGCAGGG + Intergenic
1063510225 10:6637488-6637510 CCTTCCAGCCAGCAGGAGCACGG + Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1065880835 10:30036567-30036589 AGTGCCAGGCTGCAGCTGCCTGG - Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067335455 10:45359145-45359167 CCTGCGAGGCTGCAGCTGGGTGG + Intergenic
1068741749 10:60481395-60481417 GCTGCCTGGCAGCAGCAGAATGG + Intronic
1068770540 10:60815599-60815621 CCTGCCACCCATCAGCTCCATGG + Intergenic
1069515528 10:69073851-69073873 ACTGCCAGGGAGCAGCTGAGAGG - Intergenic
1069530277 10:69213030-69213052 CATGCCAGGCAGTATCTGTAAGG + Intergenic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069664650 10:70146352-70146374 CCTGCCTGGCGACAGTTGCAGGG - Exonic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070748103 10:78947315-78947337 CCTGCAGGGCAGCGGCTGCTGGG - Intergenic
1070977263 10:80615047-80615069 CCTGGGAGGCAGCAGCTGAGTGG + Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072408939 10:95183399-95183421 CCTGCCCAGGAGCAGCTGCCAGG - Intergenic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1073431642 10:103491140-103491162 CCTGCCAGGGAGGAGTTGCTGGG + Intergenic
1074113558 10:110439241-110439263 TCTTCCAGCCAGCAGGTGCAAGG + Intergenic
1074327867 10:112470523-112470545 CCTGGCAGGCAGCAGCCCCCTGG + Intronic
1074447581 10:113533241-113533263 GCTTCCAGGGAGCAGCTGGAAGG + Intergenic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1076221092 10:128733749-128733771 CCCGCCCTGCAGCAGGTGCATGG - Intergenic
1076400598 10:130182101-130182123 CCTGCCAGGTTAAAGCTGCATGG + Exonic
1076610328 10:131722316-131722338 CCTGGGAGTCAGCAGGTGCAGGG - Intergenic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1077245817 11:1537508-1537530 CCTCTGAGGCAGCAGCTCCAAGG + Intergenic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077327480 11:1969988-1970010 CCTGCAGGGCTGGAGCTGCAGGG - Intronic
1077610344 11:3639988-3640010 ACTGCCTCGCAGCAGCTGCAGGG + Exonic
1078244725 11:9563666-9563688 TGTGCCATGCAGCAGCTGCTGGG + Intergenic
1078542211 11:12221738-12221760 CCTTTCAGCCAGCAGCTCCAGGG - Exonic
1078722589 11:13898107-13898129 CCTGCCAGCCAGGCCCTGCAAGG - Intergenic
1079182735 11:18208268-18208290 ACAGCCCAGCAGCAGCTGCATGG + Intronic
1080846014 11:36027651-36027673 CCTGCCTGGAGGCATCTGCATGG + Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1082001500 11:47395698-47395720 CCTGCCAGGCAGCAGCCCCCGGG + Intergenic
1082783268 11:57302743-57302765 GCTGGCAGCCAGCAGCTCCAAGG - Exonic
1083501734 11:63115287-63115309 CCTGCAAGGCAGTAGCCTCATGG - Intronic
1083535152 11:63460370-63460392 TCTGCCAAGAAGCAGCAGCATGG + Intergenic
1084174522 11:67416349-67416371 CCTCCCAGGATGCAGCCGCAGGG - Intronic
1084326388 11:68402784-68402806 GCTGACAGGCAGCGGCTGCCTGG - Intronic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084542908 11:69798413-69798435 TCTGCCAGGGAGAAGCTGCATGG + Intergenic
1085517171 11:77118377-77118399 CCTGCCCTGTAGCAGCTGCGGGG + Intronic
1086092890 11:83021525-83021547 CCCGCCCGGCAGCAGCAGCTGGG + Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087007793 11:93486302-93486324 CCTCCCTGGAAGCAGCTGCTTGG - Intronic
1088223550 11:107593139-107593161 CCTGCCAGGCTGCTTCTGCAAGG + Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1089017998 11:115182717-115182739 GCGGGCAGGCAGCAGTTGCAGGG + Intronic
1089153749 11:116385081-116385103 TCTGCCAGGCAGCAGGTGCCAGG + Intergenic
1089639676 11:119839426-119839448 TCCTCCAGGCAGCAGCAGCAGGG + Intergenic
1090386437 11:126359988-126360010 CCTGCCAGGCAGAAGCACCTTGG + Intronic
1090660224 11:128876859-128876881 CATTCCAGGAAGCAGCTGCTTGG - Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1202810462 11_KI270721v1_random:25168-25190 CCTGCAGGGCTGGAGCTGCAGGG - Intergenic
1091430977 12:434426-434448 CCTGGGAGGCAGCGGTTGCAGGG - Intronic
1091544900 12:1495158-1495180 CCTGCCAGGCAGGGGCTTCAGGG - Exonic
1091640328 12:2231110-2231132 CCTGCCAGGCAGCTGGTGACTGG + Intronic
1091991748 12:4961167-4961189 CCAGACAGGCAGCAGGAGCATGG + Intergenic
1092405816 12:8221651-8221673 CCAGGCAGGGAGCAGATGCAGGG - Exonic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094835941 12:34322121-34322143 CCTTCCCAGCAGCTGCTGCATGG - Intergenic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1096219501 12:49820225-49820247 CCTGGGAGGCTGCACCTGCACGG + Intronic
1096442157 12:51652296-51652318 TAAGCCAGGCAGCAGCAGCAGGG - Intronic
1096650322 12:53059237-53059259 CCTGCCGTTCAGCAGCTGTAGGG - Exonic
1096724927 12:53553892-53553914 CCTGACAGGTAGGAGCTGGATGG - Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1101904546 12:108814898-108814920 CCAGCCAGGCAGCAGCGGAGTGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1103204295 12:119116346-119116368 CTTGCCAGGCTGCGGCTGCACGG - Intronic
1103238027 12:119390290-119390312 ACTGACAGGGAGCACCTGCAGGG - Intronic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104915207 12:132260857-132260879 GCGGCCAGGCTGCAGCCGCACGG + Intronic
1104915999 12:132264851-132264873 CCTGACAGGGAGCAGCGCCAGGG + Intronic
1104969020 12:132522856-132522878 TCTGCCAGGCGGCAGGTGCGGGG - Intronic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1111445303 13:88339619-88339641 CCAGCCAGCCACCAGCAGCAGGG - Intergenic
1111985189 13:95058850-95058872 GCTGCCAGGCAGCAGGAGCCCGG + Intronic
1112409734 13:99152735-99152757 ATTCCCAGGCAGAAGCTGCAAGG - Intergenic
1112819527 13:103315115-103315137 CCTCCCAGTTTGCAGCTGCAGGG - Intergenic
1112901719 13:104365097-104365119 GAGGCCAGGTAGCAGCTGCAGGG + Intergenic
1113449779 13:110399763-110399785 CCTGCCAGGAAGATCCTGCAGGG - Intronic
1113707924 13:112446117-112446139 CCCTCCAGGCAGCAGCTTCCCGG + Intergenic
1113791221 13:113029488-113029510 TCTGCCAAGCTGCACCTGCAAGG - Intronic
1116869717 14:50059782-50059804 TTTGCCAGGCTGCAGATGCATGG + Intergenic
1118200187 14:63664028-63664050 CCGCCCAAGCTGCAGCTGCAGGG - Intergenic
1118241290 14:64060977-64060999 CCTGCCATGCTGCTGCTGCTGGG + Intronic
1118841800 14:69519040-69519062 GAAGCCAGGCAGCAGCTGAAGGG + Intronic
1119100785 14:71878399-71878421 ACTGCAAGGCGGCAGCAGCAAGG - Intergenic
1119196477 14:72720498-72720520 CTGGCCAAGCAGCAGCTGAATGG - Intronic
1119380229 14:74223845-74223867 CAGGCCAGGGAGCAGCAGCAGGG - Intergenic
1120555238 14:85921417-85921439 CCAGGCCAGCAGCAGCTGCATGG - Intergenic
1120567065 14:86073049-86073071 CTTGCCAGGAAGCAGTAGCATGG - Intergenic
1121137311 14:91510317-91510339 CCACCCAGGGAGCAGCTGCAGGG + Intronic
1121187056 14:91982713-91982735 CCTGCATGGCAGCAGCTGGGCGG + Intronic
1121274157 14:92656511-92656533 CCTGCCAGCCAGCTGCCCCAAGG - Intronic
1121680795 14:95791294-95791316 TCTCCCAGGCAGCAGCTGATAGG + Intergenic
1122055250 14:99093708-99093730 CCTGCCACGGAGGAGCTCCAAGG + Intergenic
1122066324 14:99176313-99176335 CCTGCCTGACAGGGGCTGCAGGG + Intronic
1122290220 14:100676757-100676779 CCAGCCAGGCAGGAGCTTGAGGG - Intergenic
1122405311 14:101497195-101497217 CAAGCCAGGCAGCAGCTCCAAGG + Intergenic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1122794043 14:104196892-104196914 TCTGCCAGGCAGCGGCTCCCTGG + Intergenic
1122856281 14:104561719-104561741 CCTGACAGGCAGCATCATCAGGG + Intronic
1122939123 14:104973428-104973450 CCTGCCAAGCAGCAGGAGCAGGG + Intronic
1122967468 14:105138050-105138072 CAGGCCAGGCAGCAGCAGCTGGG - Intergenic
1124594000 15:31078725-31078747 CTTTCCAGGCAGCAGGTGCTGGG - Intronic
1126796119 15:52261599-52261621 GCTGCCAGGCAGAAGCTGGTGGG + Intronic
1127674881 15:61229158-61229180 CGAGCCAGGCAGCAGCGGCGCGG - Intronic
1128262255 15:66240717-66240739 TCTGCCATGCACTAGCTGCATGG - Intronic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1130313964 15:82779320-82779342 ACTGCCAGGAAGCAGATACAAGG - Intronic
1130805072 15:87312380-87312402 CCAGCCAGAGAACAGCTGCAGGG + Intergenic
1132185910 15:99801496-99801518 CCTGCCAGGCATCTGCAGCCTGG - Intergenic
1132429768 15:101751202-101751224 CCTGCCAGGCATCTGCAGCCTGG + Intergenic
1132536278 16:482715-482737 CCTGCCTGGGAGCAGCAGCAGGG - Exonic
1132602883 16:781780-781802 CCTGCCCAGCAGCAGCAGGACGG - Intronic
1132643612 16:988951-988973 CCTCCCAGGCAGCTGCTGGGAGG - Intergenic
1132752283 16:1464268-1464290 CCGGCCAGGCACCCGCTCCAGGG + Intronic
1132765190 16:1530939-1530961 CCTGCCAGGCCGAGGCTGCTGGG + Intronic
1132783881 16:1643662-1643684 CCTCCCGGGCAGCAGGTGCGTGG + Intronic
1132976854 16:2715424-2715446 CCTGCCGGGCCGCTTCTGCAGGG + Intronic
1133238552 16:4401452-4401474 CCTGGCACGCAGCAGGTGCTTGG - Intronic
1133774548 16:8886597-8886619 CCTGTAAGGCTGCAGCTGTACGG - Intergenic
1134729203 16:16446650-16446672 TCTGCCAGGCCACTGCTGCATGG - Intergenic
1136297057 16:29309621-29309643 GCTACCAGGCAGCTGCCGCAGGG + Intergenic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1138806939 16:60100954-60100976 CATGCCATGCAGCTGCTGCTGGG + Intergenic
1138806941 16:60100958-60100980 CATCCCCAGCAGCAGCTGCATGG - Intergenic
1139354781 16:66361065-66361087 CCCGCCAGCAGGCAGCTGCATGG + Intergenic
1140607032 16:76551320-76551342 CCTGGGAGGCAAAAGCTGCAGGG + Intronic
1141151663 16:81568506-81568528 TGTGCCAGGCAGGAGCTCCAGGG + Intronic
1141657716 16:85424974-85424996 CATGCCAGGCAGCTGGAGCAGGG + Intergenic
1142016971 16:87754405-87754427 CCTGCAAGCCTGCATCTGCACGG + Intronic
1142058607 16:88015725-88015747 GCTACCAGGCAGCTGCCGCAGGG + Intronic
1142193118 16:88726958-88726980 CCTGCCAGGCCGGAGCGTCAGGG + Exonic
1143582642 17:7835691-7835713 GCTGGGAGGCAGCAGCTGCCTGG + Intergenic
1144773073 17:17770360-17770382 GCTGTCAGGCATTAGCTGCAGGG + Intronic
1144779745 17:17801794-17801816 CCAGCCTGGAGGCAGCTGCAGGG + Intronic
1144783554 17:17819685-17819707 CAGGCCAGGCAGCGGCTGCTGGG + Exonic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1146063480 17:29618837-29618859 CCTGCTAGCCACCACCTGCAAGG - Exonic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1146891118 17:36507058-36507080 CCTGGCAGGCAGCCCCTGCCTGG - Exonic
1147374630 17:40016330-40016352 CCTGACACTCACCAGCTGCAGGG - Exonic
1148201457 17:45752691-45752713 AGTTCCAGGCAGAAGCTGCAAGG - Intergenic
1148229176 17:45920541-45920563 GCTGCCAGGCAGAAGGTGCACGG - Intronic
1148781191 17:50123006-50123028 ACTGCCTGGAAGCAGCAGCAAGG + Intronic
1149548337 17:57521093-57521115 CGTGCCTGGCAGCAGCAGCTGGG + Intronic
1150651996 17:67016407-67016429 CCTTGGAGGCAGCAGCTGAAGGG + Intronic
1151256339 17:72879701-72879723 CCTGTCACTCAGCAGCTGCAGGG - Intronic
1151367332 17:73626112-73626134 CCTGCCAGGCTCCCGCTGCCTGG - Intronic
1151519457 17:74617753-74617775 CATGCCTGGCAGAGGCTGCAGGG - Intronic
1151534220 17:74729642-74729664 GCTGCCTGGCAGGAGCTGCGTGG + Intronic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1151697454 17:75724797-75724819 CCTGCCAGGAGGGGGCTGCAGGG - Intronic
1151713673 17:75820567-75820589 CCTGCCGGGCAGAGGCTCCAGGG + Intronic
1151800599 17:76377149-76377171 TCTGCCAGGCTGCAGATGGATGG + Intronic
1151872171 17:76843894-76843916 CCTCCCAGACAGCAGCCACATGG - Intergenic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152282488 17:79393405-79393427 CCGGCCAGTGAGCAGCCGCAGGG + Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152568130 17:81109244-81109266 ACTGCCAGGCAGGACCTGCTGGG + Intronic
1152784909 17:82242493-82242515 CCTGCCCGGCAGCAGGCCCAGGG + Intronic
1152790166 17:82274373-82274395 CCCCCCAGGCTGCAGGTGCATGG + Intergenic
1153625200 18:7016610-7016632 CCTGCCACGCTGCAGTTGCAGGG + Exonic
1153819889 18:8824191-8824213 CATGCCTGGCAGGTGCTGCAGGG - Intronic
1154032413 18:10765435-10765457 GATGCCAGGCAGCTGCTGCAAGG + Intronic
1155300729 18:24426718-24426740 CCTGGCAGGCGGCGGCTGCAGGG + Exonic
1155914075 18:31538878-31538900 TCTGCATGGCAGCGGCTGCAGGG + Exonic
1157239391 18:45995652-45995674 CCTCCAAGACAGCAGCTGCAGGG + Intronic
1157290007 18:46403040-46403062 CCTGCCTGAGAGCAGCTGAAAGG - Intronic
1157622931 18:49026594-49026616 GTAGCCAGGCAGCTGCTGCAGGG + Intergenic
1158115488 18:53990886-53990908 ACTGCCAGGCATCAGCAGGAAGG + Intergenic
1158422217 18:57305202-57305224 TCTGCCAGGCATCTGCTGCAAGG + Intergenic
1159348275 18:67236001-67236023 CCTGCCAGGCAGCATTGGGACGG + Intergenic
1160186852 18:76682468-76682490 CCTACCTGGGAGCAGCTGCCAGG + Intergenic
1160529447 18:79555028-79555050 CCTGCAAGGCAGCCGCTGCTGGG + Intergenic
1161515185 19:4692530-4692552 TCTCCTAGACAGCAGCTGCATGG - Intronic
1161574473 19:5048073-5048095 ACTGCGAGGGAGCGGCTGCAGGG - Intronic
1161769813 19:6225117-6225139 CTTGCCTGGCAGCAGCTGCAGGG - Intronic
1162222752 19:9192123-9192145 AGTGCCCTGCAGCAGCTGCATGG + Intergenic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1162319203 19:9960771-9960793 CCTGCCAGAATGCAGCTGCCTGG - Exonic
1162914386 19:13866097-13866119 CATTACCGGCAGCAGCTGCAGGG + Intronic
1163117568 19:15197659-15197681 TCCACCAGGCAACAGCTGCATGG + Intronic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163957252 19:20655034-20655056 CCTGGGAGGCAGCAGTTGTAGGG + Intronic
1164445569 19:28314761-28314783 CCTGCCAGGGATCAGCTCTAGGG + Intergenic
1164934195 19:32198420-32198442 CCTGGCTGGCAGTGGCTGCAAGG - Intergenic
1165060427 19:33202524-33202546 CCTGCCAGCCGGCACCTCCAAGG - Intronic
1165099200 19:33428494-33428516 CCTGAAGGGCAGCAGCTGCCAGG - Intronic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1166067409 19:40367897-40367919 CCTGGCCGGCAGCAGGGGCAGGG + Intronic
1167582309 19:50352503-50352525 CATCCCTGGCAGTAGCTGCATGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
1168172512 19:54597865-54597887 CTTGCCAGGGAGCAAGTGCACGG + Intronic
925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG + Intronic
925348454 2:3186079-3186101 CCTGCCATCCACCAGCTGCCAGG + Intergenic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925575149 2:5352465-5352487 GTGGACAGGCAGCAGCTGCAAGG + Intergenic
925615651 2:5742374-5742396 TTTGCCAAGCAGGAGCTGCAAGG + Intergenic
925814178 2:7731400-7731422 CCTCTCAGGTAGCAGCTGGAAGG + Intergenic
926233483 2:11022251-11022273 CCTGCCAGGAGGGGGCTGCACGG + Intergenic
926795357 2:16614763-16614785 CCTGCCACGTAGCAGCTGTATGG + Intronic
928245198 2:29620588-29620610 TCTGCCATTCAGCAGCTGCATGG + Intronic
928593863 2:32842435-32842457 CCTTTCTGGCAGCAGTTGCAGGG + Intergenic
929094531 2:38250936-38250958 CCAGGCAGGCAGCTTCTGCATGG - Intergenic
930091629 2:47535216-47535238 CCTCCCTGGCTGCAGCTGAAAGG - Intronic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
930439798 2:51391271-51391293 CCTTCCCAGCAGCAGCTACATGG - Intergenic
931808009 2:65826772-65826794 CCTGCCAGCCAGGAGCAACAGGG - Intergenic
932292328 2:70593031-70593053 CCTGTCAACCAGCAGCAGCAAGG + Intergenic
932460028 2:71876078-71876100 CCTCCCAGCCAGAACCTGCAGGG + Intergenic
933339574 2:81004921-81004943 ACCTCCTGGCAGCAGCTGCATGG - Intergenic
933990455 2:87630107-87630129 GGTGCCACGCAGCACCTGCATGG - Intergenic
934715683 2:96542003-96542025 CCAGGCAGGCAGGACCTGCATGG - Intronic
934840180 2:97619590-97619612 CCAGGCAGCCAGTAGCTGCATGG + Intergenic
935244582 2:101207122-101207144 CCTGGGAGGCAGCAGTTGCAGGG - Intronic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
935925591 2:108065185-108065207 CTTTCCAGGAAGCAGCTGGATGG + Intergenic
936284630 2:111172827-111172849 CCTGCAAGGCAGCAGGTGCGTGG - Intergenic
936303391 2:111320717-111320739 GGTGCCACGCAGCACCTGCATGG + Intergenic
936450019 2:112626891-112626913 TCTGCCAGGCAGCACCATCACGG - Intergenic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
937025325 2:118692849-118692871 CCTGCCAGGCAACAGGCTCAGGG + Intergenic
937076779 2:119112992-119113014 CCAGCCTGGCAGCAGCTGCTGGG - Intergenic
937268995 2:120635400-120635422 CCAGCCACGCAGCAGCCTCAAGG - Intergenic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
937842477 2:126537655-126537677 CCGGCCAGGGAGCAAATGCATGG - Intergenic
937986493 2:127640435-127640457 CCTCCCAGGGCCCAGCTGCAAGG + Intronic
938245022 2:129769651-129769673 ACTGCCTGGGAGCAGCCGCAGGG + Intergenic
938408610 2:131046197-131046219 CCTGCCTGACAGCACCTGCTGGG + Exonic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
938791344 2:134679118-134679140 CCTATCAGCCAGCAGCTGAAAGG - Intronic
939087813 2:137742826-137742848 TCTGGCAGGCAGGAGCAGCAGGG - Intergenic
939264499 2:139853683-139853705 TGTCCCAGGCAGAAGCTGCAAGG + Intergenic
941230985 2:162912501-162912523 CCTGCAAGTCAGAGGCTGCAGGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
942709097 2:178812450-178812472 CCTGCCAGGCAGGAACTGTGTGG - Intronic
942887732 2:180948403-180948425 GCTTCCAGGCAGCAGCAACATGG - Intergenic
942987598 2:182161563-182161585 CTTGCCCGGCAACTGCTGCAGGG - Intronic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
945188704 2:207165565-207165587 TTTGCCCGGCAGCAGCAGCATGG - Exonic
945920613 2:215751316-215751338 CCATCCAGGCAGCAGATGGATGG - Intergenic
946982560 2:225233401-225233423 CCTCCCAGGCTACAGTTGCATGG + Intergenic
947196623 2:227574155-227574177 CCTGGCAAGCAGCAGCTACTAGG - Intergenic
947452257 2:230219791-230219813 ACTTCGCGGCAGCAGCTGCAGGG - Intronic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947712037 2:232321852-232321874 CCAGCCAGGCGGTGGCTGCAGGG + Intronic
947731277 2:232432971-232432993 CCAGCCAGGCGGTGGCTGCAGGG + Intergenic
947871359 2:233440654-233440676 CAGGCCAGGCAGCAGCAGAAAGG + Intronic
948025635 2:234773914-234773936 CCATCCAGGCAGCAGTTGCATGG - Intergenic
948816660 2:240513726-240513748 CCTGGGAGTCAGCAGCTGCCTGG - Intronic
948816830 2:240514824-240514846 CCTGGGAGTCAGCAGCTGCCTGG + Intronic
948884128 2:240874528-240874550 GTTGCCAGGCTGCAGCTGGATGG - Intronic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1170084576 20:12514575-12514597 CCTGACAGGCTGCTGATGCAAGG + Intergenic
1171490017 20:25510286-25510308 CGTGCCAGGAAGGAGGTGCAGGG + Intronic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1172175753 20:32970935-32970957 CCTGGCACACAGCAGCTGCTGGG + Intergenic
1172358929 20:34298898-34298920 CCTGCCTGGCAGCCGAGGCAGGG - Intronic
1172776185 20:37408405-37408427 CCTGGGAGGCAACAGCAGCAGGG - Intergenic
1172906787 20:38376386-38376408 CCTGCCGGGCAGCAGCAGCTCGG + Intronic
1172992884 20:39049196-39049218 CAAGCCAGGCAGGAGCTGCATGG - Intergenic
1173527622 20:43745119-43745141 GCTCCCAGGCACCAGCAGCAAGG + Intergenic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1174566743 20:51470103-51470125 CATGATAGACAGCAGCTGCAAGG - Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175641045 20:60630712-60630734 CCTGCAAGGTTGCAGCTGGAAGG + Intergenic
1175802168 20:61807117-61807139 CCCGCCAGCCCCCAGCTGCAAGG + Intronic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1175820318 20:61905587-61905609 CCTTGCAGGCAGCAGGGGCAAGG - Intronic
1175844990 20:62053429-62053451 CCGGTCAGGCAGGAGCGGCAGGG + Intronic
1175996205 20:62813306-62813328 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996245 20:62813426-62813448 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996266 20:62813486-62813508 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1176128182 20:63485249-63485271 CCTGCCAGGCATCAGACCCAAGG + Intergenic
1176130573 20:63495126-63495148 CCTGCCAGGCAGGCGGGGCAGGG - Intronic
1176219682 20:63964052-63964074 CCTGCCAGGCAGCCCCTACCTGG + Exonic
1177740734 21:25149547-25149569 ATTCCTAGGCAGCAGCTGCATGG - Intergenic
1178098553 21:29241244-29241266 CCTACACAGCAGCAGCTGCAAGG - Intronic
1178920447 21:36735148-36735170 CCTGTCAGTCAGTAGCTGGAGGG + Intronic
1179334042 21:40433379-40433401 GCAGGCAGGCACCAGCTGCACGG + Intronic
1179552207 21:42150584-42150606 CCTGCCTGGCAACAGTTCCAGGG + Intergenic
1179586065 21:42375062-42375084 CCTGCCAGCACGCAGCTGCCAGG + Intronic
1179640710 21:42745712-42745734 CCTGCCAGGCAGCACCACCCTGG - Intronic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1179797708 21:43794932-43794954 GCTGGCAGGAAGCAGGTGCATGG - Intronic
1181038850 22:20182486-20182508 CCTCCCAGGGCTCAGCTGCAAGG - Intergenic
1181163586 22:20971759-20971781 CCTCCCAGGCTGCTGCTGCAGGG - Intronic
1181892647 22:26077362-26077384 CCTCCCTGGGAGCAGCTGCAGGG + Intergenic
1182280954 22:29217419-29217441 TCTGCCACACACCAGCTGCATGG + Intronic
1182368142 22:29792403-29792425 CCTGGCAGGTAGCAGATGAAGGG - Intronic
1183358463 22:37371581-37371603 CCAGCCTGGCAGCAGCTCCTGGG - Exonic
1183489135 22:38107510-38107532 CCTCCCAGGGAGCAGCCACATGG - Intronic
1183490702 22:38114104-38114126 CAGGCCGGGAAGCAGCTGCAGGG + Intronic
1183492356 22:38123338-38123360 TCTGCCAGGACACAGCTGCAGGG - Intronic
1183948683 22:41340716-41340738 CCTGCCAGGCAGAGGAAGCAGGG + Intronic
1184113416 22:42408665-42408687 CCTGCCTGGCAGCAAGTGCCAGG - Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184173000 22:42770310-42770332 CGAGCCAAGCAGCAGCTGCGTGG + Intergenic
1184242980 22:43221172-43221194 ACCGCCAGGCAGCCGCTGCTGGG - Exonic
1184634588 22:45816921-45816943 CCTGCCAAACAGCAGCCGGAAGG + Intronic
1184669390 22:46004831-46004853 CCAAGCAGGCAGCACCTGCATGG + Intergenic
1184679637 22:46063371-46063393 CCTGGCAGGCAGCTGCCCCATGG - Intronic
1184684022 22:46087949-46087971 CCTCCAGGGCTGCAGCTGCAGGG + Intronic
1184698901 22:46156230-46156252 CCTGGCAGGCAGCAGCTAAGGGG - Intronic
1184714609 22:46273772-46273794 CCAGCCAGGCAGCAGCAGGCTGG - Intronic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1185400400 22:50612761-50612783 GTTTCCAGGCAGCAGCTACAGGG - Intronic
949898790 3:8792830-8792852 TCAGCCACTCAGCAGCTGCAGGG + Intronic
950147959 3:10665192-10665214 GGTGCCAGGCAGGAGCTGTATGG - Intronic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
950695776 3:14700104-14700126 CATCCCCAGCAGCAGCTGCAAGG - Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953328453 3:42032325-42032347 CTTCCCAGGCAGTGGCTGCAAGG + Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
953934140 3:47025113-47025135 CCTGCCTAGCAGCCACTGCAGGG + Intronic
954030873 3:47819033-47819055 CCTGGGACGCAGCAGCAGCATGG - Intronic
954327882 3:49873448-49873470 CAAGCCAGGCAGCAACTGCACGG + Intergenic
954429934 3:50465145-50465167 GGTGCCAGGCTGCAGCTGCCCGG + Intronic
954781837 3:53067698-53067720 CTTGGGAGGGAGCAGCTGCAAGG + Intronic
955346728 3:58167165-58167187 CCATCCAGGAAGCAGCTGTAAGG - Intronic
956222762 3:66922237-66922259 TGTGCCAGACAGCAGCTGCCTGG - Intergenic
957247860 3:77735822-77735844 CTTGCCTGGCAGCTGCTTCAGGG + Intergenic
957944098 3:87039850-87039872 ACTGCCAAGCATCAGCTGCCAGG + Intergenic
960614749 3:119586306-119586328 CTTGCCCGGCTTCAGCTGCATGG - Exonic
960835051 3:121897220-121897242 ACTGCCAGGCAGTAGAAGCAGGG - Intronic
961402405 3:126656493-126656515 CCTGACAGGTGGCAACTGCAGGG - Intergenic
961512165 3:127409689-127409711 CCTCCCAGCCCACAGCTGCATGG + Intergenic
967627985 3:191708439-191708461 CCTGCCTGGATGCTGCTGCAGGG + Intergenic
968357555 3:198121010-198121032 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
968620787 4:1602677-1602699 CCCGCCAGGCAGGAGCTGCGAGG + Intergenic
968684943 4:1951719-1951741 CATGCCAGGCAGTCGATGCATGG + Intronic
968778374 4:2559761-2559783 CCTGCCAGACTCCGGCTGCACGG + Intronic
968871930 4:3246709-3246731 CCTCCCAGGCAGGAGCAGCTGGG + Intronic
968879221 4:3290658-3290680 CCTGCCAGGCAGCGGCTCAGCGG - Intergenic
968912042 4:3481343-3481365 CCAACCAGGCAGCTGCTGCCTGG - Intronic
969299978 4:6292030-6292052 CCTCCCAGCCTGCACCTGCAGGG + Intronic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
969464205 4:7345017-7345039 CCTTCCAGCCAGCAGCAGGAGGG - Intronic
969467563 4:7366625-7366647 CCTCCCATGCAGCTGCTCCAAGG + Intronic
969608214 4:8212707-8212729 CCGCACAGCCAGCAGCTGCAGGG - Exonic
969760310 4:9176316-9176338 CCAGGCAGGGAGCAGATGCAGGG + Exonic
970756474 4:19433033-19433055 CCTGGGAGGCAGCAGTCGCAGGG - Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
971859371 4:32085457-32085479 CATGACAGGAAGCAGCAGCAGGG - Intergenic
972321409 4:37976802-37976824 CCTGGCAGGCAGGAGCTAAATGG + Intronic
974118491 4:57609727-57609749 TCTGAGAGGCAGCATCTGCAAGG - Intergenic
975365698 4:73524944-73524966 CCTTCCTAGCAGCGGCTGCATGG - Intergenic
976255272 4:83093428-83093450 CCTGCCTGGCAACAGCCCCAGGG - Exonic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
977888671 4:102281374-102281396 CATGACAGGCAGCTGCTGCACGG - Intronic
978010482 4:103676161-103676183 CCTGTGAGCCAGAAGCTGCAAGG - Intronic
978464541 4:108994376-108994398 CCTGCGAGGCTGCAGCTTGATGG + Intronic
979122909 4:116926208-116926230 CCTCTCGGGCAGCGGCTGCAGGG + Intergenic
980480873 4:133385490-133385512 CTTGCAAGGCTGCAGCTGGAGGG - Intergenic
982780340 4:159483805-159483827 CATGCCAGGCAGCTGAGGCAAGG - Intergenic
984930797 4:184845363-184845385 TGTGCCAGGCAGCACCCGCATGG - Intergenic
984950590 4:185004835-185004857 CCTGCCAGCCCGCAGATGCTGGG + Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985810060 5:2076097-2076119 CCTGCCAGGCCCCAGATGGATGG + Intergenic
987069083 5:14318888-14318910 CTTCCGAGGCAGCAGCAGCAAGG + Intronic
987088824 5:14492839-14492861 CCTGGCAGGCAGCAGAGGGAGGG + Intronic
987391694 5:17382153-17382175 GCTGCCAGCCAACAGCAGCAAGG + Intergenic
988997524 5:36728352-36728374 TCTGCCACGGAGCAGCTGGATGG + Intergenic
990122720 5:52475377-52475399 CCTACCAGGCACTAGCTGTAAGG - Intergenic
990465939 5:56071597-56071619 ACTGCCAGGAAGCAGCTGCAAGG - Intergenic
990608179 5:57430925-57430947 TCTGCCAGGCAGGACCTCCATGG + Intergenic
990983504 5:61621685-61621707 CCTTCCAGGCCTCAGCTGCCAGG - Intergenic
991169487 5:63604353-63604375 CCAGCCCAGCAGCAGCTTCAGGG - Intergenic
992390434 5:76326359-76326381 CTTGCCAGACAGCAGATTCAGGG + Exonic
993256971 5:85604424-85604446 CCTGCCATGTAGCTGCTGCAGGG - Intergenic
994428830 5:99628920-99628942 CACCCCAGGCAGCAGCAGCAAGG - Intergenic
995269876 5:110207959-110207981 CTTGCCAGGCAGCTGCCTCAGGG + Intergenic
995486029 5:112640952-112640974 TCTTCCAGGCAGCAGCTGGTGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995638105 5:114219126-114219148 CCTGCCTGGATGCTGCTGCAGGG - Intergenic
995896841 5:117022870-117022892 CCTGGAAGGCTGCAGGTGCACGG - Intergenic
996354612 5:122581831-122581853 CCTTCCAGACAGAAGCTGCTGGG - Intergenic
996755153 5:126927478-126927500 CCAGCCAGGGAGCAAGTGCAGGG - Intronic
996818256 5:127597115-127597137 CTGGCCAGGTAGGAGCTGCAGGG + Intergenic
996906698 5:128609020-128609042 TCTGCCATGCAGCTGCTGCGGGG + Intronic
997197239 5:131988302-131988324 CATGCCAGGCAGCACTTCCATGG + Intronic
997259311 5:132453969-132453991 CCAGCAAGACAGAAGCTGCATGG + Intronic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997675294 5:135708099-135708121 CCTTCCAGGCAGCAGGGGCCTGG + Intergenic
997935899 5:138110705-138110727 CGTCCTGGGCAGCAGCTGCAGGG - Intergenic
997962766 5:138335203-138335225 CCTCCCAGCCAGCCTCTGCAGGG + Intronic
998471389 5:142386557-142386579 CCTCCCAGGAAGCAGGGGCAAGG + Intergenic
998576883 5:143326200-143326222 CCTGCCAGGCAACAGTCACAAGG - Intronic
998736229 5:145144441-145144463 CCTGCCAGGCACCAGAGGGAAGG + Intergenic
999077157 5:148807182-148807204 CATGCGATGGAGCAGCTGCATGG - Intergenic
999189207 5:149733644-149733666 CCTGCCAAGCAGAAGCTCCCAGG + Intronic
999232434 5:150069693-150069715 CCTGCCAGGCAGGAGGGGCTTGG + Intronic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1000707771 5:164532981-164533003 ACTGCCAGGCAGCAGCTGGCTGG + Intergenic
1001287018 5:170431218-170431240 CCTGACAGGCAGTGGCAGCAAGG - Intronic
1001368427 5:171169296-171169318 CCTGCCAGTCACCAGCTGTATGG - Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001831487 5:174793204-174793226 CCACCCAGTCAGCAGGTGCAAGG - Intergenic
1002496464 5:179616173-179616195 CCAGCCAGCCAGCAGCTGAGTGG - Exonic
1002575186 5:180170309-180170331 CCAGCCAGGAGGCAGCTGCAAGG + Intronic
1003394755 6:5743413-5743435 CCTTCCTGACAGCAGCTGAAAGG + Intronic
1004258156 6:14084118-14084140 CCTCCCAGGCAGGAGCTTCAAGG - Intergenic
1004310535 6:14541069-14541091 TCTGCGAGGCAGCAGCTGAAGGG - Intergenic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1005494714 6:26378181-26378203 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005499207 6:26415076-26415098 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005503899 6:26453284-26453306 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1006180348 6:32150398-32150420 AGTGCAAGGCTGCAGCTGCAGGG + Exonic
1006192716 6:32219577-32219599 CCCGCCAGGTATCAGCTGGATGG - Exonic
1006430897 6:33995108-33995130 CCTGGCAGGCAGCAGCAGTGTGG - Intergenic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1007946367 6:45830614-45830636 CCTGCCTGGAAATAGCTGCATGG - Intergenic
1008848691 6:55997762-55997784 CATGCCATGCAGCTGCTGCCAGG + Intergenic
1008848695 6:55997766-55997788 ACCCCCTGGCAGCAGCTGCATGG - Intergenic
1010328030 6:74587803-74587825 CATTCCAGGCCGCAGCTCCAAGG + Intergenic
1011243838 6:85300831-85300853 CCTGCCAACCAGCAGCTGGCTGG - Intergenic
1011310009 6:85971450-85971472 TATGCTAAGCAGCAGCTGCAAGG + Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1015395087 6:132724842-132724864 CATGCCAGTCAACAGCTGCAGGG + Exonic
1016180419 6:141139675-141139697 CTGCCCAGGCGGCAGCTGCACGG - Intergenic
1018206166 6:161439161-161439183 CCTGCGATGCCGCAGCTGAAAGG + Intronic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019505489 7:1388467-1388489 ACTGACAGACAGCAGCTGCTGGG - Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019863869 7:3686749-3686771 AATGGCAGGCAGGAGCTGCAGGG + Intronic
1020093589 7:5355210-5355232 CCTGCCAGGCAGCAGGTTCTGGG + Intronic
1020100412 7:5391189-5391211 TCTCCCAGGCAGGAGCTGCCAGG + Intronic
1020148289 7:5662102-5662124 CCTGCACAGCTGCAGCTGCACGG - Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020524577 7:9242745-9242767 CATACAAGGCAGCCGCTGCATGG + Intergenic
1020830545 7:13089504-13089526 CCTGCCAGGCAGAAAGTGAAGGG + Intergenic
1021480349 7:21108400-21108422 CCAGCCAGGAAGCGGCTGCTGGG - Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1022123942 7:27337852-27337874 CCTGGGAGGCGGCAGTTGCAGGG + Intergenic
1022149541 7:27586981-27587003 CGTGCCACCCAGCTGCTGCATGG + Intronic
1022923381 7:35037561-35037583 CCAGCCAGGCAGCAGCCGCCCGG - Intronic
1023568944 7:41552868-41552890 TCTGCAAGGCAGCAGCTGGCAGG - Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1024506407 7:50165840-50165862 CCTCCCAGGAAGCAGCCTCATGG + Intergenic
1024945325 7:54802302-54802324 CGTGCCAGCCAGGAGCTGCTTGG - Intergenic
1029457674 7:100679260-100679282 CCTGCCAGGCAGCTGGGGCTGGG + Intergenic
1030068597 7:105679377-105679399 CCAGACAGACAGCAGCTCCAGGG - Intronic
1032075774 7:128835455-128835477 CCAGCCAAGCAGCCGCTGCTTGG - Exonic
1032402008 7:131630158-131630180 GATCCCAGGCAGCAGCTGAAAGG - Intergenic
1032616692 7:133480282-133480304 CCTGCTTGGCAGCAGATGCTGGG - Intronic
1035199138 7:157248886-157248908 CCTGCCGGGAAGCTGCTGAACGG - Intronic
1035526541 8:317421-317443 CCTGCCTGGCAGCAGATCAAAGG - Intergenic
1035571688 8:676550-676572 TCTGTCAGGGAGCAGCAGCACGG - Intronic
1035654211 8:1293296-1293318 CCAGCCAGGCAGCAGCAGGCTGG + Intergenic
1035825334 8:2639086-2639108 GAGGCCAGGCAGAAGCTGCAAGG - Intergenic
1036263934 8:7260063-7260085 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036265230 8:7267685-7267707 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036266531 8:7275307-7275329 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036267837 8:7282929-7282951 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036269141 8:7290551-7290573 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036297451 8:7548882-7548904 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036298755 8:7556529-7556551 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036300060 8:7564179-7564201 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036301364 8:7571824-7571846 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036302661 8:7579473-7579495 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036315974 8:7718602-7718624 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036317281 8:7726250-7726272 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036318589 8:7733898-7733920 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036319898 8:7741545-7741567 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036321205 8:7749193-7749215 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036322514 8:7756841-7756863 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036323822 8:7764489-7764511 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036325124 8:7772137-7772159 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036352218 8:8019817-8019839 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036353517 8:8027465-8027487 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036846205 8:12172590-12172612 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036867571 8:12414909-12414931 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036979693 8:13456532-13456554 CCTGGGAGGCAGGAGTTGCAGGG - Intronic
1037813096 8:22098170-22098192 CCTGCCAGGCCCCAGCTGGACGG + Exonic
1037944755 8:22981876-22981898 CCGCCCAGGCTGCAGCAGCAAGG - Intronic
1038446659 8:27609211-27609233 CCTGCCAGCAGGCAGCAGCATGG + Intronic
1040275615 8:46012231-46012253 CCTTCCTGGCAGCCCCTGCATGG - Intergenic
1040400233 8:47043316-47043338 CCTGACAGGCAACAGCATCAAGG - Intergenic
1040560256 8:48517448-48517470 CTTGCCTGGCTGCAGGTGCAGGG + Intergenic
1040739731 8:50558231-50558253 GCTCCATGGCAGCAGCTGCATGG + Intronic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1042395369 8:68285842-68285864 CCTACCAGGCAACACCAGCAGGG - Intergenic
1042832667 8:73049030-73049052 CCAGCCAGGCAACAGCTGAGAGG + Intergenic
1042961171 8:74305274-74305296 GCTGCCTGGCAGCTGCTGCTTGG + Intronic
1046398805 8:113676544-113676566 CCTGCCTGGCTGCTGCTGCAGGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048377514 8:133835498-133835520 CCTCACAGGCAGCATCTCCAGGG - Intergenic
1048461612 8:134626004-134626026 CCTGAGAGCCAGCAGCCGCAGGG + Intronic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049090466 8:140510638-140510660 CCTCCCAGCCGGCAGCTGCAGGG + Intergenic
1049235424 8:141510149-141510171 CCCGCCAGGCCGCAGCTGCTAGG - Intergenic
1049245025 8:141557800-141557822 CCTGCCGGGGAGGGGCTGCAAGG + Intergenic
1049275156 8:141716686-141716708 CCTGCCACCCAGCAGCTCTAAGG + Intergenic
1049291732 8:141806912-141806934 CCTCCCAGGCCCCAGCTGGATGG - Intergenic
1049306710 8:141907884-141907906 GCTGGGAGGCAGCAGCTCCAGGG + Intergenic
1049479746 8:142816237-142816259 CCAGCCAGGCAACACCCGCAAGG + Intergenic
1049494278 8:142922468-142922490 CCTGGCGGGCAGCATCAGCAGGG - Intergenic
1049622575 8:143605256-143605278 CCGGCCTGGCTGTAGCTGCACGG + Exonic
1049708607 8:144053863-144053885 CCTGGCACTGAGCAGCTGCAGGG - Intronic
1049985591 9:947969-947991 CCTCCCAGTCAGCAGCAGCAAGG - Intronic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1051516743 9:17938216-17938238 CCTCCCTGACAGCAGCTCCATGG - Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1052917056 9:33931462-33931484 GCTCCCAGGCAGCAGTGGCACGG + Intronic
1052988006 9:34502078-34502100 CCTGCCAGCCAGCAGCAGCTTGG - Intronic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1054351584 9:64021294-64021316 TCTGTCCTGCAGCAGCTGCACGG + Intergenic
1054766546 9:69047150-69047172 CCTGCCAACCAGTATCTGCATGG + Intronic
1056226460 9:84500364-84500386 CCTGCAAGGCAGCAGTACCAGGG + Intergenic
1056266534 9:84902118-84902140 CCTGGGAGTCAGAAGCTGCAGGG + Intronic
1057261318 9:93586431-93586453 CCCACCAGGGAGCTGCTGCAAGG - Intronic
1057552106 9:96059029-96059051 GCTGCCAAGCAGCAGCTCCTAGG - Intergenic
1057606206 9:96499376-96499398 CCTGCCCGGCACCAGAGGCAAGG + Intronic
1057801878 9:98195831-98195853 CCTGGAAGGCAGCAGCCCCAGGG + Intergenic
1058249187 9:102669721-102669743 CATGCCATGCAGCCACTGCACGG + Intergenic
1059242601 9:112820011-112820033 CCTCACAGGCACCAGCTGCCAGG - Intronic
1059283569 9:113154355-113154377 TCTGCCAGGAACCAGCTGCGTGG - Intronic
1060894344 9:127208137-127208159 AGTGCCAGGCAGCAACTGCCAGG + Intronic
1061060515 9:128247959-128247981 CCTGCCAGGCATCTGCAGCCTGG + Intronic
1061161759 9:128899420-128899442 CCAGACAGGCAGCACCTCCAGGG - Intronic
1061163761 9:128910909-128910931 TCTGCCATGCAGCAGCCCCACGG + Intronic
1061375168 9:130219824-130219846 CCTGTGTGGCAGCAGCTGGAGGG + Intronic
1061389310 9:130308533-130308555 GGTCCCAGGCAGCTGCTGCAAGG - Intronic
1061424053 9:130488356-130488378 CCACCCAGACAGCAGCTGCAGGG + Intronic
1061852747 9:133425455-133425477 CCTGGGAGTCAGCAGCTGCCTGG + Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062384987 9:136305659-136305681 CCAGCCACTCAGCAGCTGCCTGG + Intronic
1062615380 9:137393755-137393777 CCTGCCTGGCAGCCCCTCCATGG - Intronic
1062741403 9:138177500-138177522 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1185468806 X:370630-370652 CCTGGCAGGGAGCTGCAGCAAGG - Intronic
1185890259 X:3816182-3816204 CCTCCCAGGCAGCGACCGCAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186762147 X:12734285-12734307 CAAACCAGGCAGAAGCTGCAAGG + Intergenic
1186817991 X:13256742-13256764 CCTGCCTAGCAACAGCTGAAGGG - Intergenic
1187213693 X:17254215-17254237 GCTGCCAGGCAGCTGCTGGAGGG - Intergenic
1187234735 X:17456673-17456695 CCTGCAAGGTAGCAGCTGGTGGG - Intronic
1188223611 X:27570514-27570536 CATGCCAGACAGAAACTGCATGG - Intergenic
1193758857 X:85440999-85441021 CCAGCCAGACATCAGCAGCAGGG - Intergenic
1194073055 X:89351013-89351035 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1194990538 X:100542777-100542799 CCAGCCAGGCAGCAGCTGTGTGG + Intergenic
1195085865 X:101413219-101413241 CCTGCTAGCCAGCAGCTGAGTGG + Exonic
1195687974 X:107602601-107602623 CATGCCAGGCAGGATCTTCATGG - Exonic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1195760081 X:108236470-108236492 ACTGCCAGGTAGCTGCTCCAGGG + Intronic
1195917720 X:109952266-109952288 CCTGCCAGGCACTAGCAGCTAGG + Intergenic
1196825190 X:119735196-119735218 CCTGCCCGGCAGCCGCTCCTAGG - Intergenic
1197133778 X:123037000-123037022 CCTGCCAAGCAGAAAATGCAGGG - Intergenic
1197263010 X:124336676-124336698 CCCCCAAGGCAGCTGCTGCAAGG + Intronic
1198189362 X:134287556-134287578 CCTGGCTGCCAGCAGCTCCATGG - Intergenic
1200127098 X:153820792-153820814 CCTGCCAGCCGCCAGATGCAGGG - Intronic
1200235015 X:154463943-154463965 CCTTCGCGGCAGCACCTGCACGG - Exonic
1200727292 Y:6686753-6686775 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1200728444 Y:6702528-6702550 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1200826476 Y:7650014-7650036 TCTCCCAGACAGCAACTGCATGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202200105 Y:22337324-22337346 TCCTCCAGGCAGCAACTGCATGG + Intronic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic