ID: 953849173

View in Genome Browser
Species Human (GRCh38)
Location 3:46452787-46452809
Sequence GGTAAATTGCCTCACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953849173 Original CRISPR GGTAAATTGCCTCACTGTAA AGG Intronic
906236478 1:44214221-44214243 GGCAAACTGACACACTGTAAAGG - Intronic
907770336 1:57455653-57455675 GGCAAATAGCTTCACTGTGATGG - Intronic
909852913 1:80491652-80491674 GGCGAAATGCCTCATTGTAAAGG - Intergenic
910171165 1:84378509-84378531 GGAAAAATTCCCCACTGTAAGGG - Intronic
912759289 1:112352622-112352644 GCCAAAATGCCTCACTGTCATGG + Intergenic
913379647 1:118195355-118195377 GGAAAATAGCCACACTCTAAAGG - Intergenic
918388937 1:184037851-184037873 GATACATTGCATCACTGTGAAGG - Intergenic
919426454 1:197438177-197438199 GGAAAATTGCATCTCTATAAAGG - Intronic
920493471 1:206437430-206437452 GGCAATTTCCGTCACTGTAATGG + Intronic
923900074 1:238316291-238316313 GGCAAATCTCTTCACTGTAATGG + Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1073271647 10:102269837-102269859 AGTGAATTACATCACTGTAATGG + Intronic
1079521419 11:21331557-21331579 GGTAAACTGCCTGACTCTACTGG + Intronic
1086452494 11:86930853-86930875 GGTAAAGTGCTTCACAGTCAAGG + Intronic
1088217681 11:107531311-107531333 TGTAAATTGCAGCAGTGTAATGG + Intronic
1089927080 11:122269897-122269919 GGTAACGTGCCTCATTGTCATGG - Intergenic
1095657577 12:44687862-44687884 AATAAATTGCCTCCCTGGAAAGG - Intronic
1108227840 13:48307526-48307548 GGTAAATTTCCTCTGGGTAATGG - Intronic
1126653726 15:50953810-50953832 GGGAAATTGCCTCTGTGAAATGG + Intronic
1132724073 16:1331295-1331317 GGTAAATTGGGTCACTGGAGGGG + Intergenic
1133905158 16:10015771-10015793 GGTGAATTGCCTCATTGCAGGGG - Intronic
1141838761 16:86560437-86560459 GGTACATGGACTCACCGTAATGG - Intergenic
1152872087 17:82760576-82760598 TGTAAATGGCAACACTGTAATGG + Intronic
1155873794 18:31060092-31060114 GGTACATTGTATCACAGTAATGG + Exonic
1156097106 18:33547852-33547874 GTTAAATTTCCTAACTCTAATGG + Intergenic
1163168494 19:15514222-15514244 CGTAATTTGCATCACTGAAATGG + Intronic
1164167702 19:22697120-22697142 GGGAAATTGTATCTCTGTAAAGG - Intergenic
926047873 2:9723421-9723443 GGGGAATTGCCTCACAGTTATGG + Intergenic
926438658 2:12863593-12863615 GGGAAATTGTCTCACTGCCAAGG - Intergenic
926702908 2:15815871-15815893 GCTAAATTACCTAACTGCAAAGG + Intergenic
930856606 2:56025766-56025788 GTTAACCTGCCTCAGTGTAAGGG + Intergenic
933486963 2:82936293-82936315 AGTAAATTATCTCACTTTAACGG - Intergenic
941109328 2:161401074-161401096 GGTGAATTGCCTGTCTGAAATGG - Intronic
941976370 2:171409623-171409645 GGGAAATTGTCTTACTGTCAAGG + Intronic
943841708 2:192591588-192591610 GTCAGATTTCCTCACTGTAATGG - Intergenic
946773275 2:223111381-223111403 GGGAAACTGCCTCCCTGGAAGGG + Intronic
1171484840 20:25479168-25479190 GGGAAATTGCGGCACTGAAAAGG - Exonic
1174708106 20:52677444-52677466 GGAAAATTCCCTCACTGTTATGG + Intergenic
1175480897 20:59310021-59310043 GGCCAAGTTCCTCACTGTAATGG - Intronic
1185401922 22:50623350-50623372 GGCAAACTGGGTCACTGTAAGGG + Intronic
951772922 3:26278789-26278811 TGTAAATTTCCTTACTGGAAAGG + Intergenic
952273397 3:31854197-31854219 GAGAGATTGCCTAACTGTAAAGG + Intronic
953849173 3:46452787-46452809 GGTAAATTGCCTCACTGTAAAGG + Intronic
956916214 3:73874186-73874208 GGTATATTGCCTCCCTGAAATGG - Intergenic
964212159 3:154240361-154240383 TGTAACTTTCTTCACTGTAAAGG - Exonic
965879139 3:173367416-173367438 GGTAAAATGCCTCCATGTGAGGG + Intergenic
971545313 4:27878993-27879015 GTTTAATTGGCTCACTGTACAGG + Intergenic
971896094 4:32596381-32596403 TGTCAATTGCCTCACTGTTGTGG + Intergenic
972911357 4:43821567-43821589 GGTTAATTGGCTCACTGTTTTGG + Intergenic
976987271 4:91317390-91317412 GGGTAATTGCCTCACTGAGAAGG - Intronic
978752984 4:112273000-112273022 GGTTAATTGTCTGACAGTAAAGG + Intergenic
982939480 4:161531566-161531588 TATAAATTGACTCAATGTAAAGG + Intronic
985465403 4:190189876-190189898 GGCAAATTGATTCACTGTGATGG - Intergenic
985473128 5:58747-58769 GGAGAATGGCCTCACTGAAATGG - Intergenic
989219819 5:38944776-38944798 GTTAAATTGCTTCACTAAAATGG + Intronic
989258669 5:39394841-39394863 GGAAAATTGCTTAACTATAAAGG + Intronic
989348417 5:40455340-40455362 GATAAATTCCTTAACTGTAATGG - Intergenic
993366825 5:87044106-87044128 GCTAAGTTACCTCAGTGTAAAGG - Intergenic
993760472 5:91789943-91789965 TGTAAATTGCATAATTGTAATGG + Intergenic
994607695 5:101990523-101990545 GGTGAATTGTCTCTCTGAAATGG - Intergenic
994619842 5:102150117-102150139 GGAAAATTGCCAGACTTTAAGGG - Intergenic
1000878249 5:166666980-166667002 GTTACATGGCCTCACTTTAAGGG + Intergenic
1008300072 6:49826064-49826086 GATAAATTATCTTACTGTAAGGG + Intergenic
1009516349 6:64623747-64623769 GGTTAATTGCCTTACTGTGAGGG + Intronic
1009753213 6:67899830-67899852 GGTCAGTTGACTGACTGTAAAGG - Intergenic
1012294804 6:97508268-97508290 TGGAAATAGCCTCACTCTAAGGG + Intergenic
1015725508 6:136295483-136295505 GGTAGACTGCCTCTCTGTGAGGG + Intergenic
1017305447 6:152913287-152913309 GGTGAAATGCCCCACTGAAAAGG - Intergenic
1025836939 7:65103280-65103302 GGAAGATTGCCTCAGTGTGAAGG - Intergenic
1025906718 7:65792710-65792732 GGAAGATTGCCTCAGTGTGAAGG - Intergenic
1026523373 7:71134574-71134596 GGTATATGGCCTGACTGTCAGGG + Intronic
1032811077 7:135418365-135418387 GGAAAATTGGCCCACTGTGAAGG - Intronic
1037072930 8:14674891-14674913 GTTAAATTGGCTCACTGTACAGG - Intronic
1037585216 8:20271354-20271376 GGTTAATTATCTCACTGTCAGGG - Intronic
1038514176 8:28170199-28170221 AGTAAATTCCATCTCTGTAAGGG + Intronic
1039745521 8:40422739-40422761 GGGAAATTAACTCACAGTAATGG - Intergenic
1041412864 8:57575753-57575775 GGTCAATTATCTCACTGCAAAGG + Intergenic
1043226006 8:77731042-77731064 TCTTAATTGCCTCACTGAAATGG - Intergenic
1045555603 8:103212047-103212069 AATAAATAGCCTCACTGAAAAGG - Intronic
1048847137 8:138612538-138612560 GGGAAATTGGATCATTGTAAAGG + Intronic
1049005658 8:139854021-139854043 GGCAAATGGTCTCACTGAAAGGG + Intronic
1050203651 9:3175655-3175677 GGGAAAATTCTTCACTGTAAAGG - Intergenic
1050627887 9:7525045-7525067 GTTAAATTTCCTGATTGTAATGG - Intergenic
1050846828 9:10231618-10231640 GGCAAATTGCCTAAGTGTTAAGG - Intronic
1052231403 9:26158506-26158528 TGTAAATTTCCTCACTGATAAGG - Intergenic
1061178970 9:129013012-129013034 GGTAACTTGGCTCAGTGTGAGGG - Exonic
1061665508 9:132158780-132158802 TGCAAATTTCCTCATTGTAAAGG + Intergenic
1187699240 X:21948971-21948993 GGAAAAGTGCCTAGCTGTAAGGG - Intronic
1190224616 X:48535456-48535478 GGAGAAATGCCTCACTGTTAAGG + Intergenic
1199108679 X:143904212-143904234 GGTAAACTACCTTACTGTCAAGG - Intergenic
1200896663 Y:8383103-8383125 GGTAATTCTCCTCTCTGTAATGG - Intergenic