ID: 953849594

View in Genome Browser
Species Human (GRCh38)
Location 3:46455609-46455631
Sequence GACTCAGCTGTGCCTCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953849591_953849594 -8 Left 953849591 3:46455594-46455616 CCTCTGCCGAGAGCAGACTCAGC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 953849594 3:46455609-46455631 GACTCAGCTGTGCCTCCCAAGGG 0: 1
1: 0
2: 1
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953849594 Original CRISPR GACTCAGCTGTGCCTCCCAA GGG Intronic
900218447 1:1494706-1494728 GTCCCAGCTGTACCTCCCAGAGG - Intronic
900225789 1:1533129-1533151 GTCCCAGCTGTACCTCCCAGAGG - Intronic
901745288 1:11368847-11368869 GGATCAGCTGTGCCTCTCCAGGG - Intergenic
902271644 1:15309251-15309273 GAAACAGCTGTGCCTGGCAAGGG - Intronic
904010137 1:27384668-27384690 CCCTCTGCTGTGCCTCCCATGGG + Intergenic
904624020 1:31792208-31792230 CACTCACCTGGGCCCCCCAAAGG + Exonic
906723154 1:48023779-48023801 GAGTCATCTCTGCCTCCCCAGGG - Intergenic
906837952 1:49104183-49104205 GACTCAGAAATGCCTCCCAGAGG - Intronic
908439891 1:64142901-64142923 GTCTCAACTGTGCCTCTGAAGGG - Intronic
910424283 1:87103274-87103296 GAAACAGGTGTGCCTCCCACAGG + Intronic
911307653 1:96250581-96250603 GATGCAGCTGGGCCTCCAAAAGG - Intergenic
912542220 1:110425716-110425738 GGCACAGCAGTGCCTGCCAAAGG - Intergenic
913000473 1:114575437-114575459 CACCCACCTCTGCCTCCCAAAGG + Intronic
913696754 1:121333879-121333901 GAGTAAGATTTGCCTCCCAAGGG + Intronic
914140806 1:144946181-144946203 GAGTAAGATTTGCCTCCCAAGGG - Intronic
914262054 1:146007431-146007453 GACTCAGCTCTGCCACCTAGTGG + Intergenic
915172652 1:153988854-153988876 CACCCACCTCTGCCTCCCAAAGG + Intergenic
915240346 1:154516700-154516722 CACCCACCTGGGCCTCCCAAAGG - Intronic
916819442 1:168384234-168384256 GACTAAGATGTGACTCCCAAGGG + Intergenic
918986852 1:191641536-191641558 GACTCAGCTGGGCCACCCAATGG + Intergenic
920484085 1:206352233-206352255 GAGTAAGATTTGCCTCCCAAGGG + Intronic
920651135 1:207838313-207838335 AGCACAGCTGTGGCTCCCAAGGG + Intergenic
920776745 1:208945726-208945748 TATTCAGCTGGACCTCCCAATGG + Intergenic
920931522 1:210393425-210393447 CACTCAACTGTGACTCCCCAAGG - Intronic
921344511 1:214168385-214168407 TCCTCATCTGTGCCTCCTAAAGG - Intergenic
924772367 1:247088875-247088897 AGCTCAGCGGTGCATCCCAAAGG + Intergenic
1062954892 10:1533570-1533592 GACTCTGCGATGCCTCCCAAGGG + Intronic
1063180377 10:3592857-3592879 GAGTCAGCTGGGCATCTCAATGG + Intergenic
1067228293 10:44389481-44389503 GGATCAGCTCTGCCTCCCAGGGG - Intergenic
1067540085 10:47144722-47144744 GCCTCAGCTGGGCCTCGCCAGGG - Intergenic
1067723701 10:48750255-48750277 GTCACATCTGTGCCTTCCAAAGG - Intronic
1070284147 10:75071385-75071407 GACTCAACTGGGCCTCCCTGGGG + Intergenic
1071492874 10:86147958-86147980 GCCTCACCTGTTCCTCCCCATGG + Intronic
1072535240 10:96357426-96357448 CACTCAGCTGTGTCTCTGAAGGG - Intronic
1073432511 10:103495220-103495242 GACCCAGCAGTGTCTTCCAAAGG - Intronic
1073612278 10:104956376-104956398 ATCTCAGCTGTGCAACCCAAGGG + Intronic
1077031926 11:472259-472281 ACCTCAGCTGTGCCTCCAAGGGG - Intronic
1078065226 11:8074285-8074307 GTCTCAGCTTTGCCACCCTAGGG - Intronic
1078754565 11:14196803-14196825 CACTCACCTCAGCCTCCCAAAGG - Intronic
1080908627 11:36572976-36572998 GATTCATCTTTGCCTCCCCAAGG - Intronic
1083627665 11:64079785-64079807 GACCCAGCTGTACCTCCAGATGG - Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1084614992 11:70229847-70229869 GAATCAGAGGTGCCTCCCAGAGG + Intergenic
1087651250 11:100871299-100871321 CACCCGCCTGTGCCTCCCAAAGG - Intronic
1088708311 11:112483298-112483320 GATTCAGCTGTGCAACCCAGAGG - Intergenic
1088834484 11:113566494-113566516 GATGCAGCTGTGTTTCCCAATGG - Intergenic
1089086025 11:115817440-115817462 GACCCAGCTGTGCATCCCAGAGG - Intergenic
1089086074 11:115817975-115817997 GACCCAGCTGTGCATCCCAGAGG - Intergenic
1089552744 11:119293350-119293372 CACCCACCTTTGCCTCCCAAAGG + Intronic
1089689556 11:120178829-120178851 GCCTGAGCTGGGCCTCTCAACGG + Intronic
1089766935 11:120774832-120774854 CACTCAGCTGGGCCCCCAAATGG - Intronic
1091445402 12:541975-541997 GACTCAGCTGTCTCCTCCAAAGG - Intronic
1091602583 12:1926886-1926908 GACTCAGCTGTGGGGCCCAGGGG + Intergenic
1097351778 12:58556766-58556788 GCCTCAGCAGTGCCTCCCCAAGG + Intronic
1099663763 12:85599472-85599494 CACTCACCTCGGCCTCCCAAAGG - Intergenic
1100486227 12:95030115-95030137 GTCTCACCTCAGCCTCCCAAAGG + Intronic
1100714706 12:97293659-97293681 TTCTTAGCTGTGCCTTCCAAGGG + Intergenic
1101700772 12:107171719-107171741 CACCCACCTCTGCCTCCCAAAGG - Intergenic
1101914315 12:108884607-108884629 GACTCAGCTCTGCCACCTACTGG - Intronic
1103341323 12:120222657-120222679 GGCCCAGCTTTGCCTCCCAAGGG + Exonic
1104505095 12:129324584-129324606 CACCCACCTCTGCCTCCCAAAGG - Intronic
1109821119 13:67656677-67656699 CTCTCACTTGTGCCTCCCAATGG - Intergenic
1109843806 13:67956949-67956971 TAATCAGCGCTGCCTCCCAAAGG - Intergenic
1112848288 13:103671623-103671645 TGCTCACCTGTGCCTCCCAAAGG + Intergenic
1113335230 13:109370671-109370693 ATCACAGCTGTGCCTCACAAAGG + Intergenic
1120140332 14:80923617-80923639 GCCTCAGCTGTCCCTGCCCAAGG + Intronic
1120152390 14:81051551-81051573 GATCCAGCTATGCCACCCAAAGG - Intronic
1122441358 14:101734448-101734470 GACACAGCTGTGCCCTCCACAGG + Intergenic
1124914676 15:33958333-33958355 CACCCACCTCTGCCTCCCAAAGG - Intronic
1125097023 15:35866589-35866611 TACACAGCTGTACCTCCCTAAGG - Intergenic
1125306599 15:38324143-38324165 TGCTAAGCTGTGCCTCTCAAGGG + Intronic
1126788086 15:52195539-52195561 GAACCACCTGTGCTTCCCAATGG - Intronic
1129146875 15:73656388-73656410 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1129352896 15:74967428-74967450 TGCTCACCTATGCCTCCCAAAGG + Intronic
1129750613 15:78060391-78060413 CACCCACCTGGGCCTCCCAAAGG - Intronic
1131017373 15:89069009-89069031 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1131519312 15:93101357-93101379 CACTCACCTCGGCCTCCCAAAGG + Intergenic
1132885995 16:2182233-2182255 GACTCGGGTGTGTCTCCCCATGG - Intronic
1133532171 16:6665367-6665389 CACCCACCTGGGCCTCCCAAAGG - Intronic
1133781669 16:8943701-8943723 GAGTCAACTGTCCTTCCCAAAGG + Intronic
1134752957 16:16640727-16640749 CACTCACCTCAGCCTCCCAAAGG - Intergenic
1134993101 16:18718349-18718371 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1135018080 16:18940870-18940892 CACTCACCTTGGCCTCCCAAAGG + Intergenic
1135320215 16:21490663-21490685 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1135373050 16:21922153-21922175 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1135438739 16:22448549-22448571 CACTCACCTCAGCCTCCCAAAGG - Intergenic
1136088724 16:27903450-27903472 GACTCTACTCTGCCTCCCACGGG - Intronic
1136278731 16:29194617-29194639 GGCACCGCTGTGCCTCCCATTGG + Intergenic
1136330442 16:29572361-29572383 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1136445070 16:30312081-30312103 CACTCACCTCAGCCTCCCAAAGG + Intergenic
1144505642 17:15828091-15828113 CACTCACCTCGGCCTCCCAAAGG + Intergenic
1144904267 17:18627276-18627298 CACTCGCCTCTGCCTCCCAAAGG - Intergenic
1145198112 17:20913736-20913758 GAATAAGCTGTGGTTCCCAAGGG - Intergenic
1150571284 17:66389296-66389318 GACTCACTTGGGCCTCCCAGAGG + Intronic
1151166690 17:72209886-72209908 GAATCACCTGCTCCTCCCAAGGG + Intergenic
1155015539 18:21835325-21835347 AACTCAACTGTTCTTCCCAATGG - Intronic
1160492414 18:79349413-79349435 GTCTGAGCTGGGCCTCCCACGGG - Intronic
1161745504 19:6057166-6057188 GACTCAGCAGTGGCTCCAAAAGG - Intronic
1163709476 19:18837787-18837809 TATTCAGCTGTGACTCCCACAGG - Intronic
1164336027 19:24322098-24322120 GATTTAGCTGAGCCTGCCAATGG - Intergenic
1164549487 19:29197346-29197368 CACTCACCTCGGCCTCCCAAAGG + Intergenic
1165056194 19:33177587-33177609 GGCTTAGCTGAGCCTCGCAAAGG + Intronic
1165856817 19:38883912-38883934 GACTCTTCTGTTCATCCCAATGG + Intronic
1166662446 19:44656156-44656178 ATCTCACCTGGGCCTCCCAAAGG + Intronic
1166770963 19:45281977-45281999 CACTCACCTCGGCCTCCCAAGGG - Intronic
1167132452 19:47595946-47595968 CACTCACCTTGGCCTCCCAAAGG + Intergenic
926814604 2:16787843-16787865 GCCTCCCCTGTGCATCCCAAAGG - Intergenic
927601575 2:24446897-24446919 GACCCACCTCTACCTCCCAAAGG + Intergenic
927827685 2:26320250-26320272 CACTCACCTCGGCCTCCCAAAGG - Intronic
930382766 2:50652711-50652733 GACTCAGCTGTTCCACTCATAGG - Intronic
930661424 2:54058340-54058362 CCCTCAGCTGTGCTTCCCAGGGG + Intronic
937417869 2:121731341-121731363 AACTTCGCTTTGCCTCCCAAGGG + Intronic
937825453 2:126364234-126364256 GACACAGATGTGCCCCACAATGG + Intergenic
937926386 2:127170859-127170881 AACTTCGCTTTGCCTCCCAAGGG - Intergenic
940616932 2:156060333-156060355 GAATCAGGTGTGGCTCCCCATGG + Intergenic
940984934 2:160043436-160043458 GACTCAACTGGGGCTGCCAATGG + Intronic
942173738 2:173311366-173311388 CTCTCAGCTTGGCCTCCCAAAGG + Intergenic
945841070 2:214888804-214888826 TACTCACCTCTGCCTCCCAACGG - Intergenic
947602840 2:231464979-231465001 GGATAAGCTGTGCCTCCAAAAGG - Intronic
948288666 2:236807929-236807951 GACCCACCTGGGCCTCTCAAAGG - Intergenic
948314339 2:237015666-237015688 GAGTCACCTGTGCCTTCCCAGGG + Intergenic
948699614 2:239751576-239751598 GACCCAGCTGTGCGGGCCAACGG - Intergenic
1170337266 20:15283426-15283448 CACTCACCTCGGCCTCCCAAAGG - Intronic
1170969494 20:21104158-21104180 GACTAACCTGTTTCTCCCAAAGG - Intergenic
1172300934 20:33849705-33849727 TACTCAGCTGTGCTGTCCAATGG + Intronic
1174043373 20:47715548-47715570 CACTCAGCTGTGTCTCCCACAGG - Intronic
1174657264 20:52181952-52181974 GACTCAGCTGCTCCTCCTGATGG - Intronic
1175366276 20:58458353-58458375 GACTCAGCTGGGCCTCTCGAGGG + Intergenic
1176412809 21:6458053-6458075 GATTCATCTCTGCCTCCCAGTGG - Intergenic
1178812087 21:35893644-35893666 TACACAGCTGTGGCTCCTAAGGG + Intronic
1179688302 21:43066375-43066397 GATTCATCTCTGCCTCCCAGTGG - Exonic
1180796434 22:18608076-18608098 GACTCAGCTGGGTCCTCCAATGG - Exonic
1181181977 22:21074847-21074869 GACTCAGTAGCCCCTCCCAAGGG - Intergenic
1181225290 22:21387195-21387217 GACTCAGCTGGGTCCTCCAATGG + Exonic
1181253343 22:21547618-21547640 GACTCAGCTGGGTCCTCCAATGG - Exonic
1185376275 22:50483894-50483916 GACTCACATGTGCCTGCCACTGG + Exonic
950165918 3:10798908-10798930 GACTGAGATGTGCTGCCCAAAGG - Intergenic
950481854 3:13249085-13249107 GTCTCAGCTCTACCTCTCAAAGG + Intergenic
953849594 3:46455609-46455631 GACTCAGCTGTGCCTCCCAAGGG + Intronic
954510150 3:51117284-51117306 GAATCAGCCTTGCCTCCCAGGGG + Intronic
954855266 3:53638777-53638799 AGCTCAGCTGTGCCACCCACTGG + Intronic
960963006 3:123085087-123085109 GACCCTTCTGGGCCTCCCAAGGG + Intronic
961034554 3:123633369-123633391 CACTCACCTTGGCCTCCCAAAGG + Intronic
961517269 3:127445778-127445800 GCCTCAGCACTGCCTCCCAGGGG + Intergenic
961548292 3:127651606-127651628 GACTCACCAGTGCCTGCCAGAGG + Intronic
961627360 3:128273295-128273317 TCCTCAGCTGTGCCTCCTTAGGG - Intronic
962737796 3:138341067-138341089 CACTCATCTTGGCCTCCCAAAGG + Intergenic
963213318 3:142717848-142717870 GACCCACCTCGGCCTCCCAAAGG - Intergenic
965538474 3:169849417-169849439 GAAACAGCTGTGCCTTCTAATGG + Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
968653719 4:1769903-1769925 GGCTCAGCTGGGCCTCCCAGAGG + Intergenic
968760909 4:2442463-2442485 GTCACTGCTGTGCCTCCCCAGGG - Intronic
969066911 4:4491734-4491756 GACTGAAATGTGCCTCTCAAAGG + Intronic
969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG + Intronic
969595782 4:8148645-8148667 GACTCTGCTGTGCATGCCCACGG - Intronic
972531637 4:39966751-39966773 CACCCAGCTTGGCCTCCCAAAGG - Intronic
973285591 4:48412441-48412463 GTCTCAGCTTTGGCACCCAAAGG + Intronic
973755097 4:54066254-54066276 GAATCTGCTGAGCATCCCAATGG - Intronic
976041761 4:80894481-80894503 GGCTAAGCTGTGCCTCACACTGG - Intronic
976254668 4:83087607-83087629 CACTCACCTTGGCCTCCCAAAGG - Intergenic
976937092 4:90649860-90649882 CACCCACCTCTGCCTCCCAAAGG - Intronic
980989724 4:139728836-139728858 AGCTCAGCTGTGCAGCCCAAGGG - Intronic
989275952 5:39588766-39588788 GTATCAGCTGTACCTCCCAAGGG + Intergenic
990264262 5:54058767-54058789 GACTCTCCTGTGGCTCCCATGGG - Intronic
991692078 5:69235026-69235048 GCCTCACCTGTCCCTCCCCAAGG - Exonic
992488733 5:77220289-77220311 CCCTCACCTGTTCCTCCCAAGGG - Intronic
992536005 5:77704212-77704234 TACCCAGCTTGGCCTCCCAAAGG + Intronic
994309463 5:98251273-98251295 CACCCACCTGGGCCTCCCAAAGG - Intergenic
995280826 5:110333647-110333669 ACCTCAGCTGTGCCTTCTAAAGG + Intronic
995721796 5:115142952-115142974 GACTCAGCTGCATCTCCCTAGGG - Intronic
1002172498 5:177383357-177383379 GATTCAGCTGCTCCTGCCAAGGG + Intronic
1006651092 6:35552460-35552482 GACTCAACTCTGCCTCCACATGG + Intergenic
1006723060 6:36172694-36172716 GAGCCAGCTGTGCCTCCAATTGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1012267584 6:97164861-97164883 CACCCACCTCTGCCTCCCAAAGG + Intronic
1013521774 6:110940039-110940061 AACTCCCCTGGGCCTCCCAAAGG + Intergenic
1015984444 6:138871559-138871581 CACCCACCTCTGCCTCCCAAAGG - Intronic
1016408810 6:143760490-143760512 AAATCACCTGTGCCTCCGAAAGG + Exonic
1017955485 6:159174206-159174228 GACCCAGCTCTCCATCCCAAAGG - Intronic
1019309930 7:355027-355049 GGCACAGCTGTGGCCCCCAAGGG - Intergenic
1019710416 7:2515881-2515903 GAATCAGCTGTGCCACCCTGCGG + Intronic
1019978395 7:4603037-4603059 GGCTCAGCTGTGCCTCGTATTGG - Intergenic
1020164271 7:5796053-5796075 GACTTTGGTATGCCTCCCAAAGG + Intergenic
1024258765 7:47558724-47558746 GTCCCAGCTCTGCCTCCCCAGGG + Intronic
1024475666 7:49806358-49806380 GAATTAGCTGTGCTTCTCAAAGG + Intronic
1024939766 7:54750223-54750245 CACCCACCTCTGCCTCCCAAAGG + Intergenic
1028456192 7:91040541-91040563 GACTCAGCTGTGGATTCTAAGGG - Intronic
1032074095 7:128828184-128828206 CACGCAGCTGGGCCTCACAAGGG - Intergenic
1033080012 7:138287334-138287356 CACCCAACTCTGCCTCCCAAAGG + Intergenic
1033338334 7:140472174-140472196 CACTCACCTCAGCCTCCCAAAGG - Intronic
1035606769 8:934539-934561 GAGTCAGCTGCGCCTCCCAGGGG + Intergenic
1037861727 8:22410149-22410171 GGCTCAGCTGTGCCGCCCCAGGG - Intronic
1039447454 8:37643990-37644012 TACTGAGCTCTGCCTCCCAAAGG - Intergenic
1039976409 8:42369973-42369995 CACTCACCAGTGACTCCCAAGGG - Exonic
1041800183 8:61789882-61789904 CACTCATCTGTGTCCCCCAAGGG - Intergenic
1042180645 8:66083983-66084005 CCCTCACCTGTGCCTTCCAAGGG - Intronic
1042623642 8:70732871-70732893 CACCCAGCTCAGCCTCCCAAAGG - Intronic
1042938746 8:74086736-74086758 GGCAGGGCTGTGCCTCCCAAGGG - Intergenic
1044199426 8:89415570-89415592 ATCTCACCTGTGCCTCCTAATGG - Intergenic
1047089668 8:121559520-121559542 GACTCAGCTGTATCTTCCCAGGG + Intergenic
1047339533 8:123967355-123967377 GAATGAGCTGTACCTCCCACAGG - Intronic
1048875526 8:138834225-138834247 AACTCACCTGTGCCCCCCCAGGG + Intronic
1050019907 9:1272111-1272133 GTCTCAGCCCTGCCTCTCAAAGG + Intergenic
1051487712 9:17626328-17626350 GGCTCAACTGTCCCTCACAAAGG - Intronic
1051862640 9:21644229-21644251 GCCTCAGCTGTGCCTTCTATAGG - Intergenic
1053102526 9:35382806-35382828 CACTCACCTCGGCCTCCCAAAGG + Intronic
1056217276 9:84416861-84416883 GACGCTGCTGTACCTCCCACTGG - Intergenic
1056652527 9:88479536-88479558 GAGGCACCTGTGCTTCCCAATGG - Intergenic
1057225504 9:93290959-93290981 GACTCCCCTGAGCCTCCTAACGG + Intronic
1059009067 9:110437085-110437107 CACTCAGCTTTGTGTCCCAAAGG + Intronic
1060521090 9:124294564-124294586 GACCCATCGGTGCCTCTCAATGG - Intronic
1060875919 9:127083561-127083583 GACACAGCTGGGCCTCACAAGGG - Intronic
1185918538 X:4063290-4063312 GATTGAACTGTGGCTCCCAAAGG + Intergenic
1186590385 X:10924509-10924531 GAATCAGCTCAGCCTCCCTAGGG - Intergenic
1187477037 X:19620551-19620573 GACTCAGCTGAGCAGCCCGAGGG - Intronic
1188789103 X:34386424-34386446 GGCTCGTCTGTGCCTCCCCATGG - Intergenic
1189007711 X:37011872-37011894 CACCCATCTGGGCCTCCCAAAGG - Intergenic
1189362571 X:40363976-40363998 CACCCACCTCTGCCTCCCAAAGG - Intergenic
1190074576 X:47307076-47307098 CACTCACCTCGGCCTCCCAAAGG - Intergenic
1195750280 X:108157283-108157305 GCATGAGCTGTGCCTGCCAAGGG + Intronic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic
1199327547 X:146516843-146516865 GAACCATCTTTGCCTCCCAAGGG + Intergenic
1199549609 X:149044349-149044371 GACTCTGCTGTGTCTCCTGAGGG + Intergenic
1200848398 Y:7856149-7856171 CACTCACCTCAGCCTCCCAAGGG + Intergenic