ID: 953850887

View in Genome Browser
Species Human (GRCh38)
Location 3:46464732-46464754
Sequence GGTCCCTGTGTCCGGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953850887_953850896 20 Left 953850887 3:46464732-46464754 CCAGCCAACCGGACACAGGGACC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 953850896 3:46464775-46464797 CGCAGGAGACGCCCATCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 67
953850887_953850890 -4 Left 953850887 3:46464732-46464754 CCAGCCAACCGGACACAGGGACC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 953850890 3:46464751-46464773 GACCAAAGCGCCTAGCAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 51
953850887_953850895 17 Left 953850887 3:46464732-46464754 CCAGCCAACCGGACACAGGGACC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 953850895 3:46464772-46464794 GGGCGCAGGAGACGCCCATCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
953850887_953850891 -3 Left 953850887 3:46464732-46464754 CCAGCCAACCGGACACAGGGACC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 953850891 3:46464752-46464774 ACCAAAGCGCCTAGCAGACAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
953850887_953850893 3 Left 953850887 3:46464732-46464754 CCAGCCAACCGGACACAGGGACC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 953850893 3:46464758-46464780 GCGCCTAGCAGACAGGGCGCAGG 0: 1
1: 0
2: 2
3: 10
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953850887 Original CRISPR GGTCCCTGTGTCCGGTTGGC TGG (reversed) Intronic