ID: 953851918

View in Genome Browser
Species Human (GRCh38)
Location 3:46471160-46471182
Sequence CAGTGTGTGCTCTCCTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953851918_953851926 17 Left 953851918 3:46471160-46471182 CCCTTCTAGGAGAGCACACACTG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 953851926 3:46471200-46471222 TTTCTAGAGTGTTCACAGTCTGG 0: 1
1: 0
2: 2
3: 17
4: 188
953851918_953851927 21 Left 953851918 3:46471160-46471182 CCCTTCTAGGAGAGCACACACTG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 953851927 3:46471204-46471226 TAGAGTGTTCACAGTCTGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953851918 Original CRISPR CAGTGTGTGCTCTCCTAGAA GGG (reversed) Intronic