ID: 953852783

View in Genome Browser
Species Human (GRCh38)
Location 3:46478753-46478775
Sequence CAGAATATTTCCAAATATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953852783 Original CRISPR CAGAATATTTCCAAATATCC TGG (reversed) Intronic
902149184 1:14429027-14429049 CAGAAAATATCTAAATATCTAGG + Intergenic
905510121 1:38512806-38512828 CAGAGTCTTTCCAAATGTCAGGG - Intergenic
905945035 1:41894677-41894699 CACAATGTTTTCAAATATCGTGG + Intronic
908594773 1:65675633-65675655 GGTAATATTTCCAAATATACTGG - Intergenic
909109287 1:71454523-71454545 TACAATTTATCCAAATATCCAGG + Intronic
910110500 1:83677861-83677883 AAGAATTTTTTCCAATATCCAGG - Intergenic
910540329 1:88348172-88348194 TAGAATCTTCCCAAATATCCAGG - Intergenic
911449027 1:98040966-98040988 GATAAGACTTCCAAATATCCTGG - Intergenic
912132737 1:106621918-106621940 CAGAAGGATTTCAAATATCCTGG + Intergenic
912826938 1:112913830-112913852 TAGAATATTTTCAGATATCCTGG + Exonic
913955685 1:143289534-143289556 CAGAACATTTCAAAATCTACTGG - Intergenic
913981747 1:143525907-143525929 CAGAACATTTCAAAATCTACTGG + Intergenic
913990337 1:143606117-143606139 AACAATATTTCCAAATACACAGG + Intergenic
914395590 1:147264556-147264578 CAGATTCTTTCTCAATATCCTGG - Exonic
915700318 1:157786132-157786154 CAGAGTATTTAAAAATATCCAGG + Intergenic
916472163 1:165134810-165134832 CAAAATATTTTCAAATATTTTGG - Intergenic
916652180 1:166842696-166842718 CCAGATATTGCCAAATATCCAGG - Intronic
917042577 1:170822337-170822359 CAAAATGTTTCCAATTATTCTGG - Intergenic
917076498 1:171211586-171211608 CAAAATCTTTCCAAATGTTCTGG + Intergenic
917552956 1:176054565-176054587 CAGAATATATCAAAATATGTTGG - Intronic
917645642 1:177026202-177026224 CAGAATATTTCCATCTATCAAGG - Intronic
917867473 1:179211118-179211140 TAGAATTTTTCCAAATATCAGGG + Intronic
918039774 1:180906995-180907017 CATTTTATTTCCAAATTTCCAGG + Intergenic
919350654 1:196449600-196449622 CAAAATACTTTAAAATATCCTGG + Intronic
921893249 1:220373375-220373397 CAGGTAATTTCCTAATATCCAGG + Intergenic
921920924 1:220668213-220668235 CAGAATTTTTCCAAATTTTCAGG + Intergenic
921967755 1:221108862-221108884 CAGAATATTTAAAAATATTTTGG - Intergenic
924119918 1:240785727-240785749 CAGAATATTTTCAAGTAGGCAGG + Intronic
1066205480 10:33185268-33185290 CTGGATAATTCCAAATATCTGGG - Intronic
1067215271 10:44296356-44296378 GGGTATATTTCCAAATATACTGG - Intergenic
1068202749 10:53804353-53804375 CATCATATTTCCAAATCTACTGG + Intronic
1070046349 10:72841187-72841209 AAGAAAAATTCCTAATATCCAGG + Intronic
1071152246 10:82649298-82649320 CAGAATATTTACATATAAACAGG + Intronic
1075619982 10:123919354-123919376 CATAATATTCAAAAATATCCAGG + Intronic
1076926576 10:133493207-133493229 CATAATACCTCCAAATCTCCAGG + Intergenic
1079195547 11:18323227-18323249 CAAAATAATTACATATATCCAGG - Intronic
1080260101 11:30340281-30340303 CAGAATATTTCATACTACCCAGG - Intergenic
1081293326 11:41353471-41353493 GAAAATATTCCCAAATATCAAGG + Intronic
1086285526 11:85245427-85245449 CAAAATATTTCCTAATACCTTGG - Intronic
1088732781 11:112698031-112698053 CATTTTATTTCCAATTATCCTGG + Intergenic
1089053555 11:115566091-115566113 CAAAGAATTTCAAAATATCCAGG - Intergenic
1090134591 11:124184136-124184158 CAGAGAAATTCCAAATATACAGG + Intergenic
1090684907 11:129105255-129105277 CAAAATACTTCCATATACCCAGG - Intronic
1092502081 12:9058070-9058092 ATTAATATTTCCAAATATTCAGG + Intergenic
1093451010 12:19313491-19313513 CAGAATGTTTCCATCTACCCAGG - Intronic
1093487491 12:19667172-19667194 CAGATTATATCCAGATATCCAGG - Intronic
1093618323 12:21255599-21255621 CAAAATATTTACAAATTTCAGGG + Intergenic
1094756005 12:33469049-33469071 CATAATTTTTTCAAATATACAGG - Intergenic
1095357397 12:41291952-41291974 TAGTATATTTCCAGTTATCCTGG - Intronic
1095756987 12:45779549-45779571 CCAAATATTTCCAAATCTCCTGG - Intronic
1096333105 12:50731878-50731900 CAGAATATCTCCAAAGATAAGGG + Intronic
1096608096 12:52781626-52781648 CTGAATATTTCCAAAAACCGTGG + Intergenic
1097211188 12:57371572-57371594 CAAGATATCTCCAAATATCCAGG + Intronic
1099033382 12:77556787-77556809 CACAATATTTCCAATAACCCAGG - Intergenic
1099130462 12:78823011-78823033 TAAAGTATTTCCAAAAATCCTGG + Intergenic
1099391557 12:82086925-82086947 CAGATTGTTTCCTAATATCCAGG - Intergenic
1099778472 12:87164563-87164585 CAGAAGATATCCAAATATTATGG - Intergenic
1100696006 12:97093752-97093774 AACAATTTTTCCAAATATCTCGG - Intergenic
1101056983 12:100927785-100927807 CAGTATATATCCAGATATGCTGG - Intronic
1101734633 12:107453859-107453881 CAGAATAGTACCAAATTCCCAGG - Intronic
1104072255 12:125356060-125356082 CATAATATTTCAAACTTTCCTGG - Intronic
1104205756 12:126636684-126636706 CAGCATCTTTACAAATATGCAGG + Intergenic
1105729955 13:23202631-23202653 CACAGTATTTTCAAATATCCAGG - Intronic
1105749430 13:23408538-23408560 CACAATATTTCCATAAAGCCAGG + Intronic
1107002264 13:35561830-35561852 AAGAAGCTTGCCAAATATCCCGG + Intronic
1107657549 13:42606947-42606969 AAAAATGTTTCCAAACATCCAGG - Exonic
1108461223 13:50669386-50669408 CAGCATATTTCAAAATATTGAGG + Intronic
1108881338 13:55122004-55122026 CAGAAAATGTCCAAATGACCAGG + Intergenic
1110299596 13:73910686-73910708 CTGAATATTACCAAATAACCAGG + Intronic
1110750139 13:79104232-79104254 AAGAATAATTCCTAAGATCCAGG + Intergenic
1111238178 13:85436620-85436642 CTGTATATTTCAAAATATGCTGG + Intergenic
1111668008 13:91294250-91294272 CAGAATGTTTCCAGAAATCATGG + Intergenic
1112873688 13:104007559-104007581 CATAATATTTACAAATATTTGGG + Intergenic
1114372456 14:22105279-22105301 CAGAATATTTCCACAGATTTTGG + Intergenic
1114903167 14:27091076-27091098 CAGGGAATTTCCAAATATACAGG - Intergenic
1115774763 14:36702989-36703011 CAGAATATTGTCACATATCCTGG + Intronic
1117158066 14:52960494-52960516 TGGGATAATTCCAAATATCCAGG + Intergenic
1117220008 14:53594164-53594186 CAGAATATCTGCACATTTCCAGG + Intergenic
1119345612 14:73921174-73921196 CAGAAAATTTCCAGATAAGCAGG - Intronic
1120161511 14:81150528-81150550 CAAAATATTTCTAAATTTCCAGG - Intergenic
1123160404 14:106273167-106273189 CACAATATTTCAAAATATTTAGG + Intergenic
1125311247 15:38380271-38380293 CCTAATATTCACAAATATCCAGG + Intergenic
1125444080 15:39734483-39734505 CAGATGATTTCAATATATCCTGG + Intronic
1126585794 15:50284938-50284960 CATAATTTTACCAAATATTCCGG + Intronic
1127891540 15:63256221-63256243 GACAAAATTTCCAAATATTCAGG - Intronic
1127915206 15:63449888-63449910 AAGAGTATTTGCAAAGATCCTGG - Intergenic
1130773508 15:86950062-86950084 CAAAATATTTTCTAATTTCCAGG - Intronic
1134299358 16:12975773-12975795 AAGAATCTTTCCAAATATCTGGG - Intronic
1136587360 16:31195730-31195752 CAAATTATTTCAAAATAGCCAGG - Intergenic
1137922875 16:52508985-52509007 TAGACTATTTCCAGAAATCCTGG + Intronic
1138905993 16:61334232-61334254 CAACATATTTCCACATAACCAGG - Intergenic
1142341572 16:89526627-89526649 AACTATATTTCCAAATCTCCTGG - Intronic
1143362628 17:6384273-6384295 TTGAATATTTCCAAAGATCCAGG + Intergenic
1143907066 17:10217351-10217373 CAGATTATTTCAAAATATGGTGG + Intergenic
1148897409 17:50847043-50847065 CAGAATATTTCCAACATTACAGG + Intergenic
1150425109 17:65071063-65071085 CAGAATATTTAAAATTATCTAGG - Intergenic
1151102373 17:71570773-71570795 CTGAACATTCCCAAATTTCCAGG + Intergenic
1151882916 17:76905604-76905626 CAGAACATTCCCAACTTTCCAGG - Intronic
1152043719 17:77922028-77922050 CAGAAAATTTAAAAATAGCCAGG + Intergenic
1153167109 18:2274437-2274459 CAGAATATCTCCAAACCCCCAGG - Intergenic
1153539429 18:6138144-6138166 CAGAATGTTTCCATTCATCCAGG + Intronic
1156680482 18:39582607-39582629 CAGACTATTGCCAAATATATGGG + Intergenic
1157164388 18:45344870-45344892 CAGTTTAATTCCAAATATCTGGG - Intronic
1157164980 18:45350506-45350528 CAGTTTAATTCCAAATATCTGGG + Intronic
1158793224 18:60807847-60807869 AAGAAATTTTCCAAATATCTGGG + Intergenic
1158915462 18:62122186-62122208 CAGAATAATTAAAAAGATCCTGG + Intronic
1159048057 18:63388892-63388914 CAAAATGCTTTCAAATATCCAGG + Intergenic
1160057720 18:75500606-75500628 CAGAATATATCCAAATCCACTGG + Intergenic
1160315132 18:77836762-77836784 TAGAATATTTCAAAAAATCAAGG + Intergenic
1161467733 19:4441289-4441311 CAGAGTCTTGCCATATATCCAGG - Intronic
1164103680 19:22083551-22083573 TAAAATATTTTCAAATATTCTGG + Intronic
1165972243 19:39641525-39641547 AAGAATATATCCAAATGTTCTGG + Intergenic
1165978193 19:39695517-39695539 AAGAATATGTCCAAATGTTCTGG + Intergenic
1166514567 19:43436691-43436713 ACGAATTTTTCCAAATTTCCTGG - Intergenic
926926350 2:17992249-17992271 CAGAATATTGCAAGATATACAGG - Intronic
926974609 2:18501711-18501733 CAGAACATTCCCCCATATCCTGG - Intergenic
926983605 2:18597491-18597513 AAGAATTTTTAAAAATATCCTGG + Intergenic
927337227 2:21939022-21939044 CATATGATTTCCAAATTTCCAGG - Intergenic
928482786 2:31699459-31699481 CAGAATATTTGACATTATCCAGG + Intergenic
930091790 2:47536056-47536078 GAGAATATTTCCAGAAAACCAGG - Intronic
931237815 2:60426419-60426441 AAGAATATTTGCAAAGTTCCTGG - Intergenic
931527635 2:63174569-63174591 AAGAATATTTCAAAATGTCAAGG - Intronic
933275821 2:80283309-80283331 CTTAATATTATCAAATATCCAGG - Intronic
934506507 2:94898564-94898586 CATTATTTTTCCTAATATCCAGG - Intergenic
935140720 2:100350641-100350663 CAGGCTATTCCCAATTATCCAGG - Intergenic
935383899 2:102481160-102481182 CATAATTTTGCCAAATATCGTGG + Intronic
935474978 2:103508177-103508199 CAGAATATTTTCTAATATCTTGG - Intergenic
936663044 2:114563487-114563509 TTGAATTTTTCCAAATTTCCTGG + Intronic
937009638 2:118551048-118551070 AAGAAGAGTTCCAAATATCAGGG + Intergenic
938593961 2:132767711-132767733 CAGTATATTTCCATTTTTCCAGG - Intronic
938665176 2:133527407-133527429 TAGAATATTTCCAATTACCTAGG + Intronic
939236375 2:139499341-139499363 CAGAAAATTAACAAATATTCAGG + Intergenic
939549516 2:143596831-143596853 GAAAATATTTCCAAAATTCCAGG + Intronic
939829572 2:147055885-147055907 CTGAATATTCCAAAATATCATGG - Intergenic
940315177 2:152320588-152320610 CAGCACATTTCCAGATATGCTGG - Intergenic
940561058 2:155297799-155297821 CATAATATTTCCTATTTTCCAGG + Intergenic
942457141 2:176146126-176146148 TTAAATAGTTCCAAATATCCAGG - Intergenic
943971447 2:194412779-194412801 CAGAATATTTCAAATTATGTAGG - Intergenic
945607686 2:211956655-211956677 CAAAATATTTACAAATATTTTGG - Intronic
945647790 2:212521987-212522009 CATAATAATTCTAAATAACCAGG - Intronic
946375134 2:219303222-219303244 AAGTATATGTCCAAATATTCAGG + Intronic
946416261 2:219541461-219541483 CAGTAAATTACTAAATATCCTGG - Intronic
947043994 2:225957338-225957360 CAAAAAATTTAAAAATATCCTGG - Intergenic
948003500 2:234588520-234588542 CAGAATATTTGCAAAACTCATGG + Intergenic
948337844 2:237224419-237224441 CAGAATCTGTCCCAATAGCCTGG - Intergenic
948358981 2:237405032-237405054 CAGAATATATCCAGATATTGAGG + Intronic
1169312941 20:4562668-4562690 AAGATGATTTCTAAATATCCAGG + Intergenic
1170383046 20:15783067-15783089 CTGAATATTTTCAAACATACTGG + Intronic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1172315727 20:33952706-33952728 AAGTTAATTTCCAAATATCCAGG + Intergenic
1173212864 20:41050458-41050480 GAGAACATTTCCAAAATTCCAGG - Intronic
1174445325 20:50587222-50587244 CACAATATTTTAAAAAATCCTGG - Exonic
1177530990 21:22357530-22357552 CAAAATATTTACCAATACCCAGG + Intergenic
1177827421 21:26099895-26099917 TAGAATATTTCCCAATAATCTGG + Intronic
1177853736 21:26378560-26378582 AAGAATATTTCCAGATCCCCTGG - Intergenic
1178454048 21:32730274-32730296 GAGATTATTTTCAATTATCCAGG + Intergenic
1178600321 21:33988806-33988828 GAGAATATTTGTAATTATCCTGG - Intergenic
1178951966 21:36992699-36992721 CAGAGAAATTCCAAAAATCCTGG + Intergenic
949322868 3:2830915-2830937 GAGTCTATTTCCAAATTTCCAGG - Intronic
949641846 3:6044805-6044827 CCGGATGTTTCCAAATATCCAGG - Intergenic
950232182 3:11285587-11285609 CAGAATATTTCCATCTCCCCAGG + Intronic
950955208 3:17045845-17045867 CAGAATTTTTCTAAATGTCACGG - Intronic
951907095 3:27716178-27716200 CAGAATATTCCCAAATATCATGG + Intronic
952644779 3:35641767-35641789 CAGAATATTTGTAAATTTTCTGG + Intronic
953852783 3:46478753-46478775 CAGAATATTTCCAAATATCCTGG - Intronic
953852784 3:46478754-46478776 CAGGATATTTGGAAATATTCTGG + Intronic
955911001 3:63860201-63860223 CAGAATTTTTCAAATTAGCCAGG - Intronic
957598941 3:82307002-82307024 CAGAACATTTGAAATTATCCAGG + Intergenic
957918917 3:86723093-86723115 CAGAAAATTAACAGATATCCTGG - Intergenic
958096824 3:88956493-88956515 CAGAGAATTTCAAAATATCAAGG - Intergenic
959632631 3:108525420-108525442 CAGAAAATTTCCAAATAAGTAGG - Intronic
962074221 3:132063776-132063798 CAGAATATTTCCTAGCATCTGGG + Intronic
962298654 3:134216858-134216880 CAGAACATTCCCCAATATCCAGG - Intronic
962887601 3:139642002-139642024 GAGAATATTTCCTGATCTCCAGG - Intronic
964380029 3:156089059-156089081 CTGAATTTTTTCAAAGATCCTGG - Intronic
964958833 3:162397316-162397338 AAGAATCTTTCCTAATCTCCTGG + Intergenic
965482707 3:169240154-169240176 CAGAATATTTTCAAACATTTGGG - Intronic
965996741 3:174892412-174892434 CAGTATATTTTCAAATACACTGG - Intronic
966062779 3:175779965-175779987 TAGAATTTTTCCAAATAGTCAGG + Intronic
970671063 4:18397294-18397316 CAGTGTATTTCCAAACATGCTGG - Intergenic
971680521 4:29693237-29693259 CAGATTATTTTGGAATATCCAGG - Intergenic
971910074 4:32784485-32784507 CTGAATATTGTCAAATATGCAGG - Intergenic
976236144 4:82899784-82899806 AAAAATAATTCCAAATATCCAGG - Intronic
976571714 4:86619499-86619521 CTGAATCTTTCCAAATCTTCAGG + Intronic
976783458 4:88788701-88788723 CACATTATTTCCAAATAAGCTGG + Intronic
978773878 4:112486270-112486292 GAGAATAATTCCATGTATCCAGG - Intergenic
980346213 4:131623679-131623701 CTGTATATTTCAAAATATCTAGG - Intergenic
980580911 4:134748963-134748985 CAAATTATTTCAAAATATCGAGG + Intergenic
980743553 4:136984535-136984557 CATAATATTTTCAAATATTAGGG + Intergenic
981173155 4:141648172-141648194 CAGCATATTTCCTATTATCAGGG + Intronic
981910443 4:149974585-149974607 CAAAATATTAGCAAAGATCCAGG + Intergenic
981969509 4:150649864-150649886 CAAAATGTTTACAAATATGCGGG + Intronic
982324615 4:154117403-154117425 CTGAATTTTTCCAATTATACAGG + Intergenic
982483478 4:155939063-155939085 CTGAATATCTCATAATATCCCGG - Intronic
983032545 4:162821106-162821128 TTGAATATTTCAAAATTTCCAGG - Intergenic
983121510 4:163890961-163890983 CAGTATATTTCCGACTATCCTGG - Intronic
983442938 4:167810489-167810511 CAGAATAATTTCAGAAATCCTGG + Intergenic
984465412 4:180094894-180094916 AAGTATATTTCCTAATATTCAGG + Intergenic
986084225 5:4427201-4427223 GAGAATATTTTCTAATATGCAGG - Intergenic
986465459 5:8016927-8016949 CAAAATATTTCCAAATATTTGGG + Intergenic
986726045 5:10597634-10597656 CAGAAAATTAACAAATATTCAGG + Intronic
987794807 5:22613551-22613573 CTGAATATTTTCAAATATATAGG - Intronic
990825030 5:59889576-59889598 CAGAATATTTTATAATATCAAGG + Intronic
991163645 5:63535176-63535198 CAAAATATTTCCTGATTTCCAGG - Intergenic
993171168 5:84420565-84420587 AAGAAAATTTCCAAATCTTCAGG + Intergenic
994573645 5:101547119-101547141 CAAAATATTTCTAAATTTTCAGG + Intergenic
995616311 5:113968182-113968204 AAGAATATTCCGAAATATTCAGG - Intergenic
995676685 5:114670662-114670684 AAGATTTTTTTCAAATATCCTGG + Intergenic
995966497 5:117913765-117913787 AATAATATTTCTAAATTTCCAGG - Intergenic
996295600 5:121911949-121911971 CAGAATTTTTCAAATCATCCAGG + Intergenic
997313687 5:132913883-132913905 CAGAAAATCTCCAAATATTTGGG + Intronic
1000037116 5:157457556-157457578 CAGAATATATCCAAGTCTGCAGG - Intronic
1003718462 6:8673787-8673809 CAGAATATTTCAAAACAACATGG + Intergenic
1004362347 6:14982552-14982574 CAAAAAATTTCCATATTTCCTGG + Intergenic
1004446657 6:15706344-15706366 CAGAAGAGTTCGAATTATCCTGG + Intergenic
1005130433 6:22501296-22501318 GAGAATTTTTTCAAATGTCCAGG - Intergenic
1005444013 6:25902628-25902650 ATGAATATTTCCAGATTTCCTGG - Intergenic
1005760710 6:28965110-28965132 CAGAAGAATCCCAATTATCCAGG + Intergenic
1007866912 6:44981522-44981544 AAGAATATTTCAAAATATTTGGG - Intronic
1010690924 6:78910361-78910383 TTGAATATTCCAAAATATCCTGG - Intronic
1012667634 6:101995740-101995762 CATAATCTTTCCAAATTACCTGG + Intronic
1013100154 6:106979417-106979439 TGGAATATTTCCATTTATCCGGG + Intergenic
1013972245 6:116034757-116034779 CCTAATATTACCAAGTATCCAGG - Intronic
1013988566 6:116226117-116226139 CAGATTATTTCTTAATATCAAGG - Intronic
1014999494 6:128197490-128197512 AAGTAGATTTCAAAATATCCAGG - Intronic
1016357425 6:143233364-143233386 CCAAATATTTCCAAATTTCCTGG - Intronic
1017513515 6:155135218-155135240 GAGAGTACTTCCAAATACCCAGG - Intronic
1018500073 6:164398242-164398264 CAGAATATTAGGAAATATCTTGG + Intergenic
1020880568 7:13757588-13757610 TGGAATATTTCCTAATTTCCAGG - Intergenic
1021826478 7:24557703-24557725 CAGAAGATTTCCAAATATTTTGG - Intergenic
1022997952 7:35777691-35777713 AAGAATATATGCAAATATCAGGG - Intergenic
1023468673 7:40489162-40489184 CAGATTATTTGAAAATATACGGG - Intronic
1023887692 7:44372950-44372972 CACAATATTTCACAAGATCCTGG + Intergenic
1024208649 7:47185370-47185392 CAGATAATTTAAAAATATCCTGG - Intergenic
1024386413 7:48756952-48756974 AAGAATATTTCCAAATATCTGGG - Intergenic
1028095260 7:86752763-86752785 AAGAATATTTCCTAAAATTCTGG - Intronic
1028271788 7:88800460-88800482 AAGAATATTTCCATAGAGCCTGG - Intronic
1028994085 7:97080249-97080271 AAGAATATTTCCAGAAATACAGG + Intergenic
1029969699 7:104777196-104777218 CATAATATTTCCAAATTTCAAGG - Intronic
1029982793 7:104895005-104895027 CTGCATATTCCCAAATATGCAGG + Intronic
1030416371 7:109248879-109248901 CAGAATTTTTCTAACTCTCCTGG - Intergenic
1031318601 7:120290627-120290649 GAGAATATTTCCAAATCTAATGG + Intronic
1031761867 7:125723276-125723298 CAAAATGTTTCCAAATGTCCTGG - Intergenic
1031915509 7:127559437-127559459 CAGAATACCTACAAATATACAGG - Intergenic
1032417397 7:131746890-131746912 CTGACTCTATCCAAATATCCAGG - Intergenic
1033714609 7:143986693-143986715 GAGAATATTTTCAGATATCTTGG - Intergenic
1037069412 8:14624936-14624958 AAGAATAATTCTAAATATCAAGG - Intronic
1038637837 8:29301746-29301768 TAATATAGTTCCAAATATCCAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042723671 8:71849710-71849732 CAGAGTATTTTCACATTTCCAGG - Intronic
1042765656 8:72318655-72318677 CAGAATATTTTTAAATTACCTGG + Intergenic
1043621196 8:82194392-82194414 CAGAATATTCCCAAATATTCTGG - Intergenic
1044367324 8:91364353-91364375 CAGGGTATTTCCAAATAGACTGG + Intronic
1044888906 8:96811097-96811119 TAGTAGATTTCCAAAGATCCAGG - Intronic
1045171512 8:99675655-99675677 CAGATTATTTGAAAATATACAGG - Intronic
1045607209 8:103790206-103790228 CAGAATATTTCCATAAACCCTGG + Intronic
1047893518 8:129339719-129339741 CAAAAAATTTCAAAATATCCAGG - Intergenic
1048225980 8:132585948-132585970 CTAAATATTTCCTGATATCCTGG + Intronic
1049509117 8:143018839-143018861 CCGAATGTTTCCAAAGATCTGGG + Exonic
1051996384 9:23222919-23222941 CAGAACATTTCAAAACAACCAGG - Intergenic
1053583506 9:39431963-39431985 CTGAATATTTACAAATTTCATGG - Intergenic
1053847700 9:42256819-42256841 CTGAATATTTACAAATTTCATGG - Intergenic
1054105086 9:60990706-60990728 CTGAATATTTACAAATTTCATGG - Intergenic
1055241080 9:74187211-74187233 CATAACATTTCCAAATATTTGGG - Intergenic
1055857317 9:80705477-80705499 CAAAATATTTTCAAAAATGCAGG - Intergenic
1056307526 9:85304810-85304832 CAGAAAATATGCAAATATCTGGG - Intergenic
1056382378 9:86066898-86066920 CTGAAGACTTCCAAAGATCCTGG - Intronic
1056420838 9:86424776-86424798 TTGAATATTTCTAAATATCCTGG - Intergenic
1059837816 9:118176964-118176986 CAGAATAATTGAAAATATACTGG - Intergenic
1188368529 X:29340274-29340296 CAGAATATTTTCATCTACCCAGG + Intronic
1188940179 X:36228477-36228499 CACAATACTTCTAAATCTCCAGG - Intergenic
1189122739 X:38412488-38412510 TAGAACATTTCCAAATTTCATGG + Intronic
1190976986 X:55415133-55415155 CAGAATTTTTCTAAATATTCAGG - Intergenic
1193234312 X:79088278-79088300 TAGCATATTTCAAAATATCTAGG - Intergenic
1194405481 X:93491520-93491542 CATAATGTTTCCAAATAAACTGG - Intergenic
1194535386 X:95100224-95100246 CATCAAATTTCCCAATATCCTGG - Intergenic
1195246977 X:103003666-103003688 CAGGATCTGTACAAATATCCTGG - Intergenic
1195458621 X:105098563-105098585 CAAAATATATCCAAATATTTGGG - Intronic
1195593225 X:106656461-106656483 CAGAAGGTTTTCAAATTTCCAGG + Intronic
1195997148 X:110742588-110742610 CAAATTATTTCCAAGTATCAGGG + Intronic
1196980600 X:121209342-121209364 CAGCATATTCCCAAATATGGTGG - Intergenic
1197354291 X:125417524-125417546 CACTGCATTTCCAAATATCCTGG - Intergenic
1197547968 X:127850903-127850925 CAGAAGTTTGTCAAATATCCCGG + Intergenic
1199216366 X:145263917-145263939 CAGAAGATTTCCAAATAAATAGG + Intergenic
1200369436 X:155707266-155707288 TTGAATATTTCCAAATATTTGGG + Intergenic