ID: 953853241

View in Genome Browser
Species Human (GRCh38)
Location 3:46481625-46481647
Sequence TCCCGAGTAGCTATGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557545
Summary {0: 18, 1: 2364, 2: 58618, 3: 232401, 4: 264144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953853241_953853244 11 Left 953853241 3:46481625-46481647 CCTGTAATCATAGCTACTCGGGA 0: 18
1: 2364
2: 58618
3: 232401
4: 264144
Right 953853244 3:46481659-46481681 AAGAATCACTTGAACCTGAAAGG 0: 7
1: 291
2: 4964
3: 34790
4: 85087
953853241_953853246 24 Left 953853241 3:46481625-46481647 CCTGTAATCATAGCTACTCGGGA 0: 18
1: 2364
2: 58618
3: 232401
4: 264144
Right 953853246 3:46481672-46481694 ACCTGAAAGGCAGAGGTTGCAGG 0: 1
1: 25
2: 330
3: 976
4: 2240
953853241_953853245 17 Left 953853241 3:46481625-46481647 CCTGTAATCATAGCTACTCGGGA 0: 18
1: 2364
2: 58618
3: 232401
4: 264144
Right 953853245 3:46481665-46481687 CACTTGAACCTGAAAGGCAGAGG 0: 29
1: 911
2: 11852
3: 37975
4: 82821
953853241_953853248 25 Left 953853241 3:46481625-46481647 CCTGTAATCATAGCTACTCGGGA 0: 18
1: 2364
2: 58618
3: 232401
4: 264144
Right 953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG 0: 1
1: 25
2: 299
3: 878
4: 1799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953853241 Original CRISPR TCCCGAGTAGCTATGATTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr