ID: 953853248

View in Genome Browser
Species Human (GRCh38)
Location 3:46481673-46481695
Sequence CCTGAAAGGCAGAGGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3002
Summary {0: 1, 1: 25, 2: 299, 3: 878, 4: 1799}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953853241_953853248 25 Left 953853241 3:46481625-46481647 CCTGTAATCATAGCTACTCGGGA 0: 18
1: 2364
2: 58618
3: 232401
4: 264144
Right 953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG 0: 1
1: 25
2: 299
3: 878
4: 1799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953853248 Original CRISPR CCTGAAAGGCAGAGGTTGCA GGG Intronic
Too many off-targets to display for this crispr