ID: 953853248 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:46481673-46481695 |
| Sequence | CCTGAAAGGCAGAGGTTGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3002 | |||
| Summary | {0: 1, 1: 25, 2: 299, 3: 878, 4: 1799} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953853241_953853248 | 25 | Left | 953853241 | 3:46481625-46481647 | CCTGTAATCATAGCTACTCGGGA | 0: 18 1: 2364 2: 58618 3: 232401 4: 264144 |
||
| Right | 953853248 | 3:46481673-46481695 | CCTGAAAGGCAGAGGTTGCAGGG | 0: 1 1: 25 2: 299 3: 878 4: 1799 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953853248 | Original CRISPR | CCTGAAAGGCAGAGGTTGCA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||