ID: 953860106

View in Genome Browser
Species Human (GRCh38)
Location 3:46537046-46537068
Sequence TGGCAAGGATCCCTGAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953860103_953860106 -4 Left 953860103 3:46537027-46537049 CCAAGCCAAGGTGGCAGGATGGC 0: 1
1: 0
2: 4
3: 55
4: 340
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860105_953860106 -9 Left 953860105 3:46537032-46537054 CCAAGGTGGCAGGATGGCAAGGA 0: 1
1: 0
2: 3
3: 32
4: 687
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860093_953860106 27 Left 953860093 3:46536996-46537018 CCCATCTATCTTGCTGCCAACCA 0: 1
1: 0
2: 0
3: 10
4: 161
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860094_953860106 26 Left 953860094 3:46536997-46537019 CCATCTATCTTGCTGCCAACCAC 0: 1
1: 0
2: 0
3: 30
4: 487
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860096_953860106 11 Left 953860096 3:46537012-46537034 CCAACCACTGGATTCCCAAGCCA 0: 1
1: 0
2: 3
3: 14
4: 156
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860092_953860106 28 Left 953860092 3:46536995-46537017 CCCCATCTATCTTGCTGCCAACC 0: 1
1: 0
2: 2
3: 11
4: 248
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860098_953860106 7 Left 953860098 3:46537016-46537038 CCACTGGATTCCCAAGCCAAGGT 0: 1
1: 0
2: 0
3: 12
4: 142
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162
953860101_953860106 -3 Left 953860101 3:46537026-46537048 CCCAAGCCAAGGTGGCAGGATGG 0: 1
1: 0
2: 3
3: 18
4: 301
Right 953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953860106 Original CRISPR TGGCAAGGATCCCTGAGTCT AGG Intronic
901162226 1:7187216-7187238 TGGTCAGGATTCTTGAGTCTGGG - Intronic
903109116 1:21113921-21113943 TGGCAAGAATACCTGAGCCCAGG + Intronic
903494902 1:23759260-23759282 TGGCCAGGCTCTCTGAGCCTTGG + Intronic
904337832 1:29809645-29809667 TGGGAAGGATCCCTGTCTCCTGG + Intergenic
905318884 1:37101584-37101606 GGGCAAGCCTCACTGAGTCTCGG - Intergenic
907158300 1:52354030-52354052 TGGGAAGGAACCCTGGGTTTGGG - Intronic
912306304 1:108571034-108571056 GGGCAAAGAACCGTGAGTCTAGG + Intronic
913485986 1:119333268-119333290 TGGGGAGAATCCCTTAGTCTGGG + Intergenic
918462425 1:184790137-184790159 TGGACAGGATCCGTGAGTCTTGG - Intergenic
920229780 1:204462563-204462585 TGCCAGGCAACCCTGAGTCTAGG + Intronic
921943909 1:220873178-220873200 TGTCAAGGATGCCTGCTTCTGGG + Intergenic
1063003240 10:1944490-1944512 AGGCAAGGAGCACTGAGTGTGGG - Intergenic
1070153459 10:73819341-73819363 AGGCAGGGGCCCCTGAGTCTGGG - Intronic
1072233483 10:93432782-93432804 AGGCAAGAATCCCTGAGTCGAGG - Intronic
1075945895 10:126432768-126432790 TGGCAAAGATTCCTGTGTGTTGG + Intronic
1076307089 10:129473062-129473084 TGTCAAGGCTCCCAGTGTCTCGG - Intronic
1076564835 10:131391158-131391180 TTGCCTGGATCCCTGAGTCAGGG - Intergenic
1079156016 11:17948875-17948897 TAGCCAGTCTCCCTGAGTCTTGG + Intronic
1083667199 11:64282132-64282154 GGGCAAGGATTCCTGACGCTTGG + Intronic
1084417652 11:69042751-69042773 TGGCCAGCATCCCTGGTTCTAGG + Intergenic
1084557686 11:69884644-69884666 TTACAGGGACCCCTGAGTCTGGG + Intergenic
1085224790 11:74909914-74909936 TGGCCAGGATCCCTGAGCTCTGG + Intronic
1085816020 11:79738499-79738521 TGGCAAGGAATTCTGAGCCTAGG + Intergenic
1086103870 11:83128948-83128970 TGGGAGGGATCCCAGAGCCTGGG - Intergenic
1088832508 11:113549651-113549673 TGTCAATGAACCCTTAGTCTAGG + Intergenic
1090958391 11:131534437-131534459 TGTGAAGCATCCCTGAATCTTGG + Intronic
1093036545 12:14337114-14337136 TGGCCAGGATTCATGAGTCCAGG + Intergenic
1095123555 12:38446880-38446902 AGGCAAGGACCCCTGAGTTTAGG - Intergenic
1101655703 12:106718132-106718154 TGGCTGGGATCCCTGGGGCTGGG + Intronic
1102655787 12:114481233-114481255 TGGCAAGGAGCCCTGGCGCTTGG + Intergenic
1103261599 12:119593671-119593693 TGGCCAGGGTCCCTGAGCCCGGG + Exonic
1103831506 12:123783318-123783340 TGGGAAAGAGCCCGGAGTCTGGG + Intronic
1104920478 12:132287957-132287979 CGGCATGGACCCCTGAGGCTGGG + Intronic
1110810000 13:79802230-79802252 TGGCAAAGATCCTTGAATCGAGG + Intergenic
1113057698 13:106287496-106287518 TGGGAAGGATCCAGGAGTCATGG + Intergenic
1113825553 13:113250357-113250379 TGGCAGGATTGCCTGAGTCTGGG + Intronic
1115310448 14:31973925-31973947 TCTCAGGGGTCCCTGAGTCTGGG - Intergenic
1115631118 14:35246381-35246403 GGGCAAGGGTATCTGAGTCTAGG + Intronic
1117288027 14:54306459-54306481 TGGCAATGAGGTCTGAGTCTTGG - Intergenic
1117416076 14:55497166-55497188 TTGTAAAGATACCTGAGTCTTGG - Intergenic
1117808764 14:59522772-59522794 TGGCAAGGTTCCCTTGCTCTGGG + Intronic
1117823478 14:59675744-59675766 TGGCTGGGATCCCTGGGTGTTGG - Intronic
1122125066 14:99574488-99574510 TGGCAGGGTTCCCTGTGCCTCGG - Intronic
1122226883 14:100285536-100285558 TGTCCAGAATCCCTGAGTGTGGG + Intergenic
1123410709 15:20056555-20056577 TGACAAGGTTCACTGCGTCTGGG - Intergenic
1123520038 15:21063261-21063283 TGACAAGGTTCACTGCGTCTGGG - Intergenic
1125795690 15:42402557-42402579 TGGTAAGTGTCCCTGAGTGTGGG + Intronic
1128608194 15:69054029-69054051 TGGCAAAGCTCCTTTAGTCTGGG + Intronic
1132424082 15:101699294-101699316 TGGGAAGGGTCCCTGAGGCTTGG - Intronic
1133174703 16:4005454-4005476 TGGGAGGGATGCCTGAGGCTAGG - Intronic
1133323543 16:4929777-4929799 AGGGGAGGATCCCTGAGTCCAGG - Intronic
1133502086 16:6376185-6376207 TCCCAAGGATCCTGGAGTCTAGG - Intronic
1136909741 16:34135613-34135635 TGTCTAGGATCACTGAGTCCAGG - Intergenic
1138204626 16:55115558-55115580 TGGCAAGGACCCCAGAGGATAGG + Intergenic
1138269491 16:55685001-55685023 TGGCTAGGGTCCCTGAGTTAGGG + Intronic
1139435565 16:66934754-66934776 TGGCAGGGATCCTAGTGTCTCGG + Exonic
1139437957 16:66947801-66947823 TGGCAGGGCTCCCAGTGTCTCGG + Intergenic
1141874492 16:86813305-86813327 TGTCTAGGATCTCAGAGTCTGGG + Intergenic
1142599070 17:1044225-1044247 TGGATGGGGTCCCTGAGTCTGGG + Intronic
1146568855 17:33936219-33936241 GGGCACTGATCCCTGAGACTGGG - Intronic
1148357693 17:46986778-46986800 TGGCCAGGATCACTGTGTCCAGG - Intronic
1148775611 17:50094054-50094076 TGAGAATGATCCCTGAGTCTCGG + Intergenic
1149076034 17:52596859-52596881 TGGCCAGGACCCCACAGTCTGGG - Intergenic
1151508507 17:74544249-74544271 TAGCAAGGACCCCAGAGTCAGGG + Intronic
1152358647 17:79819450-79819472 TGGGAAAGATCCCTGGCTCTTGG - Intergenic
1153501944 18:5758758-5758780 TGTCATGAATCCCTGAATCTAGG - Intergenic
1153587083 18:6633475-6633497 AGCCAAGGATCCCTGAGTTTAGG - Intergenic
1156395811 18:36698901-36698923 GGGAAAGGAACCCTGAGCCTTGG + Intronic
1156783044 18:40875344-40875366 TGGCAAGCTTTCCTGACTCTGGG + Intergenic
1158292146 18:55954512-55954534 TGGCCAGGACCCCACAGTCTGGG - Intergenic
1160417420 18:78721002-78721024 TGGCAGGGATCCCTGGGCCTGGG + Intergenic
1161596109 19:5151680-5151702 TGGCCCTGCTCCCTGAGTCTGGG - Exonic
1163943301 19:20514482-20514504 TGGCCAGGACCCCACAGTCTGGG + Intergenic
1164522109 19:28987578-28987600 TGGCAGGGTTGCTTGAGTCTGGG - Intergenic
1167446978 19:49543456-49543478 GGCCAAGGGTCCCTGGGTCTGGG - Exonic
925399872 2:3564707-3564729 TGCCATGGATGCCTGAGGCTGGG + Intergenic
925624315 2:5826795-5826817 TAGAGAGGATCCCTGACTCTGGG + Intergenic
926197757 2:10774016-10774038 TGTCAAGGATCCCCGGCTCTTGG - Intronic
928043789 2:27906569-27906591 TGGCTAGGCTTCCAGAGTCTGGG + Intronic
934686344 2:96324903-96324925 GGGGAAAGATGCCTGAGTCTGGG + Intergenic
936376786 2:111947810-111947832 TGGCCAGAATCCCTGAGCCCAGG + Intronic
938071738 2:128311958-128311980 TGGCAAGGCTGCCTGAGAGTCGG - Intronic
938669916 2:133577058-133577080 TGGGAAGGTTCCCTGCTTCTGGG - Intergenic
941161279 2:162037304-162037326 TGTCAAGGATCCTGGAGGCTGGG + Intronic
943341128 2:186683484-186683506 TGGCCAGGATCCAGGAGGCTTGG + Intergenic
947890232 2:233611737-233611759 TGTAAAGGATACCTGAGGCTGGG + Intergenic
947891872 2:233630511-233630533 TGTAAAGGATACCTGAGGCTGGG + Intronic
1169915163 20:10675804-10675826 TCCCAAGTATCCCTGAGTTTGGG + Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171771295 20:29325149-29325171 TGTCTAGGATCCCTGAGTCCAGG + Intergenic
1171905215 20:30894314-30894336 TGTCTAGGATCCCTGAGTCCAGG - Intergenic
1173644978 20:44627624-44627646 TGGCAAGGACCCCTCTGTCTTGG + Intronic
1174552150 20:51369828-51369850 TTGCAAGGATCTCGGAGGCTTGG + Intergenic
1175211881 20:57363574-57363596 TGGGAAGAATCCTTGAGTCCAGG + Intronic
1176133261 20:63506334-63506356 TGGGAAGGATGCCTGGCTCTTGG - Intergenic
1178633194 21:34280417-34280439 TGGCTAAGATCCAGGAGTCTCGG - Intergenic
1179580246 21:42338844-42338866 CGGCAAGGATGCCTGAGCCTTGG - Intergenic
1179794555 21:43775432-43775454 TGGCAACCTTCCCTGTGTCTCGG - Intronic
1180338644 22:11600518-11600540 TGTCTAGGATCTCTGAGTCCAGG - Intergenic
1181373523 22:22437748-22437770 TAGCCAGGATTCATGAGTCTAGG - Intergenic
1182023458 22:27099957-27099979 TGCCATGCATCCCTGACTCTGGG - Intergenic
1182324859 22:29504838-29504860 TAACAAGGATCCCTGGGTATAGG - Intergenic
1182631907 22:31692732-31692754 GTGGAAGGATCACTGAGTCTAGG - Intronic
1183256550 22:36765971-36765993 TGCCAAGTATCCATGAGTCCTGG + Intronic
1183271604 22:36865766-36865788 GGGGAAGGGTCCCTGAGGCTTGG - Intronic
951403654 3:22266591-22266613 TGGCAAAGTTCCCTAAGACTAGG - Intronic
951838943 3:27012685-27012707 TGGAAAGGACCCCTCAGGCTTGG + Intergenic
951940805 3:28076762-28076784 TGGCAAGGATGCCTAAGTCTGGG - Intergenic
952216274 3:31280870-31280892 TGGCAAAAATCACTAAGTCTTGG + Intergenic
952330619 3:32361349-32361371 TGACATGTACCCCTGAGTCTGGG + Intronic
953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG + Intronic
953933529 3:47019930-47019952 TAGCAGGGATACCTGATTCTTGG + Intronic
954371266 3:50170732-50170754 AGCCAAGGATCCCTGATCCTGGG + Intronic
956399385 3:68861045-68861067 TGGGAAGGATTGCTGAGTCGTGG - Intronic
960950975 3:122998196-122998218 TGCCAAGGCTCCCTGGGCCTTGG - Intronic
962440550 3:135411248-135411270 TGGCAATGGTGCCTGAGACTGGG - Intergenic
963086253 3:141439162-141439184 TCTCAAGGAGCCCAGAGTCTAGG - Intronic
963422202 3:145074247-145074269 TGACAAAGATACCTGAGACTGGG + Intergenic
968008433 3:195258098-195258120 TGGCCAGGCTCCCTGAGTCCTGG - Intronic
969471324 4:7391097-7391119 TGGCCAGGCTCACTGAGCCTCGG - Intronic
969855379 4:9994938-9994960 TGGCCAGGGTCCCTGAGGCATGG - Intronic
969877803 4:10148857-10148879 TGAGGAGGATTCCTGAGTCTTGG + Intergenic
974039501 4:56845579-56845601 TTTCTAGGACCCCTGAGTCTGGG + Intergenic
979494433 4:121368590-121368612 TGGCAGGGACCCCTGTTTCTAGG - Intronic
979628532 4:122873889-122873911 TGACAACAATCCCTGAGTGTGGG + Intronic
980356212 4:131732585-131732607 GGGGATGGGTCCCTGAGTCTTGG + Intergenic
980960482 4:139470137-139470159 TGGCAAGTTTCCCTAAGCCTTGG + Intronic
987561001 5:19519861-19519883 TGGAAGAGATCCCTGAGCCTCGG + Intronic
990189981 5:53249160-53249182 TGGCAAGTATACCTGTGGCTTGG - Intergenic
997289094 5:132712071-132712093 TGGAAAGGAACACAGAGTCTTGG + Intronic
999186893 5:149717888-149717910 GGCCAAGGCTCCCTGACTCTAGG - Intergenic
1001283500 5:170405528-170405550 CTGCAAGGATGCCTGAGTCCAGG - Intronic
1003912838 6:10758331-10758353 TGACAAGGTTCCCTGAATGTGGG + Intronic
1005875211 6:30006260-30006282 TCTCAATGTTCCCTGAGTCTTGG - Intergenic
1006759189 6:36444152-36444174 TGTGATGGGTCCCTGAGTCTGGG + Intronic
1007452419 6:41950315-41950337 TGGCAAGCATTCCTCATTCTAGG + Intronic
1007796961 6:44356890-44356912 TGCCAGTGATCCCTGACTCTTGG - Intronic
1010694065 6:78948585-78948607 TGGGAAGGTTGCTTGAGTCTGGG - Intronic
1013493346 6:110672326-110672348 TGGCACAGATCCCTGATTCCTGG + Intronic
1015555714 6:134459443-134459465 TGGGAAGGATCCCTGAGCCCAGG - Intergenic
1018869443 6:167770026-167770048 TGGCTAGGAACCCTGACTCCGGG + Intergenic
1019464990 7:1182982-1183004 TTCCAGGGCTCCCTGAGTCTGGG - Intergenic
1023835979 7:44067438-44067460 TGGCAAGGATCCCCCAGACCTGG + Intronic
1023905625 7:44519896-44519918 CGGGAAGAATGCCTGAGTCTGGG - Intronic
1024087082 7:45902514-45902536 TGGCAAAAATCTCTGAGTCAGGG - Intergenic
1024466569 7:49717455-49717477 ACGCAAGGATCCCTGCCTCTTGG - Intergenic
1024595333 7:50929022-50929044 TGGCAGGGCTCCCTCTGTCTTGG - Intergenic
1025811211 7:64876832-64876854 TGGCAGGAATCCCTCAGTGTGGG + Intronic
1027016545 7:74783129-74783151 GGGCAAGGCTGCCTGAGCCTTGG - Intronic
1028317516 7:89421832-89421854 TGTAAAGGATCCCTGAGTAAGGG + Intergenic
1028564848 7:92218471-92218493 TGGGAAGGTTGCTTGAGTCTGGG - Intronic
1031098504 7:117449034-117449056 AAGCAGGGATCCCTGAGTCCAGG + Intergenic
1032154819 7:129459154-129459176 TGGGAAGGATTCATGAGGCTGGG - Intronic
1034068590 7:148160678-148160700 TCGGAAGGATCCCTGGGGCTGGG + Intronic
1036590765 8:10165974-10165996 TGGCAGTGATTCCAGAGTCTGGG + Intronic
1041863234 8:62537999-62538021 TGGCATGGACCCCAGACTCTGGG - Intronic
1044081884 8:87895669-87895691 TAGCAAGTATACCAGAGTCTAGG - Intergenic
1045313996 8:101027564-101027586 TTTCAAAGATCCCTGAGTCGTGG - Intergenic
1046171152 8:110508188-110508210 TGGGGAGGATCCCTGACCCTTGG + Intergenic
1047290029 8:123521788-123521810 TGGCAAGGCTGCTTGAGGCTGGG - Intronic
1047512367 8:125525410-125525432 TGGCATGGGATCCTGAGTCTTGG + Intergenic
1051518902 9:17961868-17961890 TGAAAAGGAACCCTGATTCTTGG - Intergenic
1051750205 9:20333667-20333689 TGGCCAGTATTCCTGAGGCTGGG - Intergenic
1051913026 9:22176608-22176630 TGGCAAGGATACTGGAGACTGGG + Intergenic
1052541686 9:29818428-29818450 TGTAAAGAATCCTTGAGTCTGGG + Intergenic
1054871315 9:70049439-70049461 TGGCAAGGATCCCAGGTTCCTGG + Intronic
1057824065 9:98358856-98358878 TGGAAAGGGTCCCTGAGGCAGGG - Intronic
1058953705 9:109926546-109926568 TGGCAGGCTTCCCTGAGTCTGGG + Intronic
1060863885 9:126979599-126979621 TGGCAAGGATCCCAGTCTCCTGG - Intronic
1061291862 9:129654985-129655007 TGGGAAGGATGCCTGAGGCGAGG - Intergenic
1061494391 9:130963445-130963467 TGGCAAGGGAGCCTGAGGCTTGG + Intergenic
1189171469 X:38913716-38913738 TGGGAAGGCTCCTGGAGTCTTGG + Intergenic
1192046311 X:67677700-67677722 TGGGCAGGATACCTGAGTTTTGG + Intronic
1192419870 X:71020189-71020211 TGTCAAGGATCCATGAGGTTTGG - Intergenic
1200219033 X:154381562-154381584 TGGCAAGGGCCTCTGCGTCTTGG + Intergenic
1200521461 Y:4213448-4213470 TAGCAAGGATTCGTGAGTCCAGG + Intergenic
1200737372 Y:6814199-6814221 TAGCAAGGCTCCCTGGGTGTGGG - Intergenic
1201073735 Y:10171466-10171488 TGTCTAGGATCCCTGAGTCCAGG - Intergenic
1202109101 Y:21403521-21403543 GGTCAAGGATCCCTGAATCCTGG + Intergenic