ID: 953861741

View in Genome Browser
Species Human (GRCh38)
Location 3:46550168-46550190
Sequence AAGTTCACACAGATGGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3031
Summary {0: 1, 1: 4, 2: 105, 3: 610, 4: 2311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953861741_953861746 20 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861746 3:46550211-46550233 AACTTCCTCATCTGCAAATTAGG 0: 1
1: 10
2: 105
3: 962
4: 4388
953861741_953861747 21 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861747 3:46550212-46550234 ACTTCCTCATCTGCAAATTAGGG 0: 1
1: 4
2: 41
3: 337
4: 1943
953861741_953861750 28 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861750 3:46550219-46550241 CATCTGCAAATTAGGGATGGTGG 0: 1
1: 0
2: 2
3: 27
4: 293
953861741_953861749 25 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG 0: 1
1: 0
2: 16
3: 115
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953861741 Original CRISPR AAGTTCACACAGATGGTAAG TGG (reversed) Intronic
Too many off-targets to display for this crispr