ID: 953861746

View in Genome Browser
Species Human (GRCh38)
Location 3:46550211-46550233
Sequence AACTTCCTCATCTGCAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5466
Summary {0: 1, 1: 10, 2: 105, 3: 962, 4: 4388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953861741_953861746 20 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861746 3:46550211-46550233 AACTTCCTCATCTGCAAATTAGG 0: 1
1: 10
2: 105
3: 962
4: 4388
953861740_953861746 29 Left 953861740 3:46550159-46550181 CCACATCTTCCACTTACCATCTG 0: 1
1: 0
2: 5
3: 51
4: 664
Right 953861746 3:46550211-46550233 AACTTCCTCATCTGCAAATTAGG 0: 1
1: 10
2: 105
3: 962
4: 4388
953861742_953861746 13 Left 953861742 3:46550175-46550197 CCATCTGTGTGAACTTGAGCAAC 0: 1
1: 2
2: 18
3: 142
4: 818
Right 953861746 3:46550211-46550233 AACTTCCTCATCTGCAAATTAGG 0: 1
1: 10
2: 105
3: 962
4: 4388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953861746 Original CRISPR AACTTCCTCATCTGCAAATT AGG Intronic
Too many off-targets to display for this crispr