ID: 953861747

View in Genome Browser
Species Human (GRCh38)
Location 3:46550212-46550234
Sequence ACTTCCTCATCTGCAAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2326
Summary {0: 1, 1: 4, 2: 41, 3: 337, 4: 1943}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953861741_953861747 21 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861747 3:46550212-46550234 ACTTCCTCATCTGCAAATTAGGG 0: 1
1: 4
2: 41
3: 337
4: 1943
953861742_953861747 14 Left 953861742 3:46550175-46550197 CCATCTGTGTGAACTTGAGCAAC 0: 1
1: 2
2: 18
3: 142
4: 818
Right 953861747 3:46550212-46550234 ACTTCCTCATCTGCAAATTAGGG 0: 1
1: 4
2: 41
3: 337
4: 1943
953861740_953861747 30 Left 953861740 3:46550159-46550181 CCACATCTTCCACTTACCATCTG 0: 1
1: 0
2: 5
3: 51
4: 664
Right 953861747 3:46550212-46550234 ACTTCCTCATCTGCAAATTAGGG 0: 1
1: 4
2: 41
3: 337
4: 1943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953861747 Original CRISPR ACTTCCTCATCTGCAAATTA GGG Intronic
Too many off-targets to display for this crispr