ID: 953861749

View in Genome Browser
Species Human (GRCh38)
Location 3:46550216-46550238
Sequence CCTCATCTGCAAATTAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 16, 3: 115, 4: 513}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953861743_953861749 -8 Left 953861743 3:46550201-46550223 CCTAAGTCCCAACTTCCTCATCT 0: 1
1: 1
2: 17
3: 119
4: 759
Right 953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG 0: 1
1: 0
2: 16
3: 115
4: 513
953861742_953861749 18 Left 953861742 3:46550175-46550197 CCATCTGTGTGAACTTGAGCAAC 0: 1
1: 2
2: 18
3: 142
4: 818
Right 953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG 0: 1
1: 0
2: 16
3: 115
4: 513
953861741_953861749 25 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG 0: 1
1: 0
2: 16
3: 115
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953861749 Original CRISPR CCTCATCTGCAAATTAGGGA TGG Intronic
900555419 1:3278003-3278025 TCTCATCTGAAAAGGAGGGAGGG + Intronic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902723236 1:18318231-18318253 ACCCACCTGCAAATTTGGGACGG - Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903814555 1:26055270-26055292 CCTCAACTACAAAATAGAGATGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
904009561 1:27382134-27382156 CCTCATCTGAAAATTAGTACAGG - Intronic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904449942 1:30604744-30604766 CTTCATCTGTCAAATAGGGATGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904469029 1:30724342-30724364 GCTCATCTGGAAACTAGGGATGG + Intergenic
904713451 1:32448905-32448927 CCTCAGCTACCAAATAGGGAAGG + Intergenic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904917223 1:33978912-33978934 CCTCTTCTGTAAAATAGAGATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905210844 1:36373148-36373170 CCTCATCTGTAAAACAGAGATGG + Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
906475026 1:46163815-46163837 CCTCAGCTGTAAAATAGAGACGG + Intronic
906559790 1:46748082-46748104 CCCCATCTGGAAAATAGAGATGG - Intergenic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
907087333 1:51687796-51687818 CCTTTTCTGTAAATTAGGAAAGG + Intronic
907395129 1:54184419-54184441 CCTCATCTGAAAATTGGGAATGG - Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909378957 1:74974981-74975003 ACTCATCTCCAGATTTGGGATGG - Intergenic
910370109 1:86506398-86506420 CCTTAACTGAAAATTTGGGATGG + Intergenic
910454943 1:87387574-87387596 CATCATCTGCAAAACAGAGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911065157 1:93781562-93781584 CATCATCTGTAAAGTAGGGCTGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911679688 1:100700799-100700821 ACTAATCTGCAAATGAGGCAGGG - Intergenic
911739950 1:101376287-101376309 CCTTATCTGCAAATCAGGGAGGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915545907 1:156597671-156597693 CCACATCTGCAAAGCAGGGATGG + Intronic
915640025 1:157217549-157217571 CCTCAGCTCCACATTAAGGAAGG + Intergenic
916034437 1:160908989-160909011 CCTTAACTGAAAATTTGGGATGG + Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917051314 1:170927302-170927324 TTTCATCTGCAAATTAGGAAAGG + Intergenic
917523028 1:175763584-175763606 CCTCAACTGCCAATGTGGGATGG - Intergenic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
918525255 1:185457765-185457787 CATCGTCTGCAAATTAGCAATGG - Intergenic
918819471 1:189233880-189233902 CCTAATATGAAAACTAGGGAAGG - Intergenic
919604122 1:199659698-199659720 TGTCATCTTCAAATTAGGGGTGG + Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920950457 1:210567385-210567407 CCTCATCTGGAAATTAAGGGAGG + Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924666028 1:246072507-246072529 CTTCATCTGGAAATTAGCTATGG + Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062937503 10:1399347-1399369 TCTCATCTGCAAATCTGGGGTGG - Intronic
1063520477 10:6736405-6736427 CCTCACCTGCAACATAGGGCAGG - Intergenic
1064597801 10:16963011-16963033 CCTCATCTAAAAATGAGGGTAGG + Intronic
1064843854 10:19629021-19629043 CCAGCTCTGCAAATTAGGCAGGG - Intronic
1065182397 10:23139798-23139820 CCCCATCTCCAAACTAGGGATGG - Intergenic
1065293975 10:24257640-24257662 CCTCATCTGCCATTTAGGGAAGG - Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1069941194 10:71956627-71956649 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1070485461 10:76926349-76926371 CCTCATCTGCAAATTGGAAGAGG + Intronic
1070545991 10:77452966-77452988 TCTCATCTGGAAAACAGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070778152 10:79122216-79122238 CCTCATCTGCCAATGAGCGATGG + Intronic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071565667 10:86670178-86670200 CCACATCTGCAACTGAAGGATGG - Intronic
1072075900 10:91973568-91973590 TCTCATCTGCAAAACAGGAATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073541904 10:104321751-104321773 ACCCATCTGCAAAACAGGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075659051 10:124180761-124180783 CCCCATCTGTAAATTGGGGTGGG - Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076443229 10:130494780-130494802 GCTCATCTGAAAAATAGAGACGG + Intergenic
1076641742 10:131921454-131921476 GCTCAGATGCAAATGAGGGATGG + Intronic
1077502104 11:2914043-2914065 CCTTATATGCAAATGAGGGCTGG - Intronic
1077768219 11:5184975-5184997 CTTCATCAGGACATTAGGGATGG + Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078451019 11:11440863-11440885 TCCTATCTGTAAATTAGGGATGG - Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079996961 11:27305080-27305102 CCTTATCTTCAAGTCAGGGACGG + Intergenic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081635229 11:44716856-44716878 CCTCATCTGCAAAGTTGGTTGGG + Intergenic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081679657 11:44992709-44992731 TCTCATCTGTAAAATAGGGTTGG + Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1082785591 11:57314557-57314579 CCCCATCTGTACATTAGGGCTGG + Intronic
1083195503 11:61083437-61083459 CTTCATCTGCAAAGCAGGGGAGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275542 11:61595078-61595100 TCTCATCTGTAAAGTAGGGGCGG + Intergenic
1083502998 11:63128685-63128707 CCTCAGCTGCCAAATTGGGAAGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1085093977 11:73743699-73743721 CCTCATCTGCCAATTACAGAAGG + Intronic
1085567878 11:77531171-77531193 CCTCCTGGGCAAATTAAGGAAGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085638376 11:78175380-78175402 CCTCATCTGCACAACAGGAATGG - Intronic
1086722690 11:90140678-90140700 TCTGATCTGCAAATGAGGGTGGG - Intronic
1086883616 11:92178099-92178121 CCTCATCTCTAAATTAGGAAAGG - Intergenic
1087155313 11:94896086-94896108 CCTCATCTGTAAATGATGGGTGG - Intergenic
1088063834 11:105690964-105690986 CCTCATCTTTAAAATAGGAAGGG + Intronic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1090491873 11:127171053-127171075 TCTCATTGGCAAAGTAGGGATGG - Intergenic
1090588014 11:128235126-128235148 CCTCATGTGGAAAGTAGGGATGG - Intergenic
1090621689 11:128566415-128566437 CTTCATCTGTAAAATAGGCATGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092032095 12:5294671-5294693 TCTCATCTGTAAATTAGAGCTGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1095603178 12:44037551-44037573 CCCCATCTTCAAACCAGGGAGGG + Intronic
1095829203 12:46565827-46565849 CCTCATCTGAAAACTAGACAAGG - Intergenic
1096355534 12:50938036-50938058 CCCCATCTTCAAGTCAGGGATGG - Intergenic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096773621 12:53951254-53951276 CCTCGTATGCAAATTAGGCCGGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097822936 12:64145873-64145895 CTTCATGTGCAATTTGGGGAGGG + Exonic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098890544 12:76006125-76006147 TCTCATCTTCAGAATAGGGATGG - Intergenic
1099754474 12:86826181-86826203 GCTTATGTGCAAATTAGGCAGGG - Intronic
1101815068 12:108139983-108140005 CCTCACCTGCAAAAGAGAGAGGG + Intronic
1101963818 12:109268568-109268590 CCTCATCTGCACAACAGGGGTGG - Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102310540 12:111841649-111841671 CCTATTTTGCAAATTAGGGATGG + Intergenic
1102774564 12:115507326-115507348 CCTCATCTGTAAAATAGGATAGG - Intergenic
1102874200 12:116437057-116437079 TCACATCTGCCACTTAGGGAGGG - Intergenic
1103159029 12:118712169-118712191 CCTCACCTGTAAAATAGAGATGG + Intergenic
1103535458 12:121630639-121630661 TCTCATCTGCAGATCAGAGAGGG - Intronic
1103915810 12:124375075-124375097 CCTCATCTGCACATGAGAGTTGG - Intronic
1103931837 12:124454640-124454662 CCTTTTCTGCCAAATAGGGATGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104282014 12:127387122-127387144 CCTTAGCTGCAATTTAGGGTTGG - Intergenic
1104335293 12:127888846-127888868 CCTCATCTCTTAATTAAGGAGGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1105916855 13:24924870-24924892 TCTCATCTGCAAAACAGGGGTGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1109415400 13:62033170-62033192 TCTCATCAGCAATTTAGGGGCGG - Intergenic
1111831458 13:93335416-93335438 CCTCCTCTTCAAACTAAGGATGG - Intronic
1111900784 13:94197221-94197243 CCTCATCTGTAAATTTGCTAGGG + Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112776293 13:102846920-102846942 TCTCATCTGCAAAGTAGAGGTGG + Intronic
1113321156 13:109233730-109233752 CCTCCTCTGCACATTTGGCATGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114600548 14:23952880-23952902 CTTCATCTGTAAATTACTGAGGG - Intergenic
1114604781 14:23988024-23988046 CTTCATCTGTAAATTACTGAGGG - Intronic
1114610231 14:24035590-24035612 CTTCATCTGTAAATTACTGAGGG - Intergenic
1115482132 14:33870917-33870939 TCTCATCTGCCAATTGGGGGTGG - Intergenic
1115497757 14:34023875-34023897 CCTCATCTGTGAAATAGGGTAGG - Intronic
1115895413 14:38081100-38081122 CCTTACCTGTAAATTAGGAATGG + Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116835630 14:49767388-49767410 CCTCACCTGTAAAATAGGGTGGG - Intergenic
1118284502 14:64459268-64459290 CCTCATTTGGACATTAGCGAAGG + Intronic
1118314148 14:64715514-64715536 CCTGACCTGTAAAATAGGGATGG + Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118883871 14:69850809-69850831 CCACATCTGTAAACCAGGGATGG - Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121984666 14:98493138-98493160 CCTCATCTGTAAAGCAGGGATGG - Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122830018 14:104391307-104391329 CCTCATCTGTAAAGCAGGAAAGG - Intergenic
1202891098 14_KI270722v1_random:158832-158854 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125725228 15:41864879-41864901 CCTCATTTGCAAGGTAGGCAGGG + Intronic
1127251285 15:57240954-57240976 CCACATAAGTAAATTAGGGAAGG - Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127625458 15:60775956-60775978 CCTCCTCTGGCACTTAGGGATGG - Intronic
1128163060 15:65437237-65437259 CCTCATCTGAAAGTGAGGGGAGG + Intergenic
1128364347 15:66986797-66986819 CCTCATCTGTAAAATAGTGTTGG - Intergenic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128691966 15:69731455-69731477 CATCAACTGTAAATTGGGGAGGG + Intergenic
1128700452 15:69800222-69800244 CCCCTTCTGCAAAATAGGGGTGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128910427 15:71508615-71508637 CCTCATCTGCAAAGTAAAGGGGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129678698 15:77646001-77646023 CTCCATCTGCAAAGCAGGGATGG + Intronic
1129857815 15:78837543-78837565 CCTCAGCGGCAAATGGGGGAGGG + Intronic
1130126693 15:81099724-81099746 CCTCATCTATAAAAAAGGGATGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131440058 15:92453088-92453110 CCTCATCTGCAATTTACAGAAGG - Intronic
1131504902 15:93008868-93008890 CCTCATCTGCAAGAGAGGCATGG - Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131803087 15:96092353-96092375 CCTTATCTGCAAGTAAGTGAGGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1133135743 16:3710291-3710313 CCACATCTGCAAACTAGGAAAGG + Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133560650 16:6947044-6947066 CCTCATCTGTAATTGAGAGAAGG + Intronic
1134014363 16:10878330-10878352 CCTCATCTGGAATTGAGGGAGGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134106790 16:11491417-11491439 CCTCATCTGTAAAATAGGATGGG - Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134794052 16:17018464-17018486 CCTCAGCTGTCACTTAGGGAAGG - Intergenic
1135343050 16:21665057-21665079 CCTCCTCTGCATAGTAGGCATGG - Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136624834 16:31456000-31456022 CTTCATCTGTAAAACAGGGATGG - Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137282726 16:46992288-46992310 CCCCATCTTCAGACTAGGGAGGG - Intergenic
1137456416 16:48621347-48621369 CCTCTTCTGTAAATTAAAGAAGG - Intergenic
1137849863 16:51731033-51731055 CATCATATGCAAATTATGCATGG - Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1140976683 16:80066609-80066631 TCTCATCTGCAAATGAAAGATGG - Intergenic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141278811 16:82612323-82612345 CATCATCAGTAAATTAGAGAGGG - Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141428740 16:83960040-83960062 CCTCATCTCCAACTCAGGGGCGG - Intronic
1141475514 16:84270526-84270548 CCCCATCTGAAAAGTAGGGAAGG - Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142675547 17:1511221-1511243 CCTCAACTACAAAACAGGGACGG - Intronic
1143510220 17:7391308-7391330 TCTAATCTGCAAAGTAGGGGAGG + Intronic
1143867495 17:9934644-9934666 CCTCATCAGCAAACCAGGGAGGG - Intronic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145973421 17:28970285-28970307 TCTCATCTGTAAAGTAGGGATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146958585 17:36952869-36952891 CCTCATCTACAAAGAAGAGAGGG - Exonic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147021349 17:37536406-37536428 CCTCATCTGTGAAGTTGGGATGG + Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147817637 17:43221520-43221542 GCTCATCTGCATTTTGGGGATGG + Intergenic
1147836235 17:43333962-43333984 CCTCAGCTACCAAATAGGGAAGG - Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148859865 17:50599191-50599213 CCTCATCTGTAAACTAGATATGG - Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG + Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152288703 17:79426635-79426657 CCTCATTTCCAAATTTTGGAGGG + Intronic
1152290978 17:79440170-79440192 CTTCAGCTGCAAATTAGACACGG - Intronic
1152498629 17:80693478-80693500 CCTCTTCTGCAAATTAAGGAAGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1158062599 18:53364230-53364252 CCACACCGTCAAATTAGGGATGG + Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1162236344 19:9312640-9312662 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162448954 19:10742807-10742829 CCCCATCTGCAAAACAGGGTTGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162728557 19:12703950-12703972 CCACATCTGCAAATGGGAGATGG + Intronic
1163522445 19:17799570-17799592 CCTCCTCTGCAAAGCTGGGATGG - Intronic
1163768042 19:19174241-19174263 CCCCATCTGCAGATCAGGGTTGG + Intronic
1163834925 19:19567456-19567478 CTCCAACTGCAAAGTAGGGAGGG + Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165306581 19:35006395-35006417 CCTCCTCTGTAAAGCAGGGATGG + Intronic
1166065125 19:40353504-40353526 CCTCATCTGAAAAACAGAGATGG + Intronic
1166158334 19:40932507-40932529 CCTCATCTTAGAAGTAGGGATGG + Intergenic
1166167316 19:41000733-41000755 CCTCATCTTAGAATTAGGGATGG + Intronic
1166282044 19:41800698-41800720 CCTCATCTGCCAGGCAGGGAAGG + Intronic
1166914994 19:46189213-46189235 CCTCAGCTGCCAAACAGGGAAGG - Intergenic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168406197 19:56111871-56111893 CCTCCTCTGCAAAGCAGGGACGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1202666517 1_KI270708v1_random:125670-125692 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295143 2:2771442-2771464 CGTCATCTGGAAATAAGGGGCGG - Intergenic
925695252 2:6570008-6570030 CCTCATCTGCACAGTAAGGTAGG - Intergenic
925712051 2:6750609-6750631 CCTTATCTGCAGAATAGGCAAGG - Intergenic
925901842 2:8514379-8514401 CCTCATCTCCAGATTACAGATGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926389836 2:12378148-12378170 TTTCATCTGCAAAATAGAGATGG + Intergenic
927009289 2:18885788-18885810 CCTCATCATCAAATTAGGATTGG + Intergenic
927187808 2:20494776-20494798 CCTCATCTCCAAATGATGGTAGG - Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927852486 2:26508953-26508975 TCTCATGTGCTAATTAGAGATGG + Intronic
929273551 2:40000545-40000567 CCTCATCTGTAAAGCAGGGATGG - Intergenic
929455294 2:42060868-42060890 CCTCATCTGCAAATTTCAGATGG + Intergenic
930904045 2:56544345-56544367 ACTCAAATGGAAATTAGGGATGG + Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
932760313 2:74435297-74435319 CCCCATCTGTAAATCAGGAATGG + Intronic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
933820528 2:86107016-86107038 CCTCATCTGCAGACTAGAGTTGG + Intronic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935254894 2:101300986-101301008 TCTCATGTGCCAATTAAGGAAGG - Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
940711205 2:157165288-157165310 CCCCACCTTCAAATCAGGGATGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941215939 2:162709117-162709139 TATCATCTGCAAAATAGAGACGG + Intronic
942184373 2:173410653-173410675 CCTCATCTGGAAATGGGAGATGG - Intergenic
942364938 2:175215524-175215546 CCTCATCTGCCAATGAGAAAGGG - Intergenic
943037484 2:182765283-182765305 CCTTAACTGAAAATTTGGGATGG - Intronic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
944514394 2:200497201-200497223 CCTCATCTATAAAATAGGAATGG + Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946080830 2:217116938-217116960 CCTGCTCAGCAAATTAGGAAAGG - Intergenic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946525190 2:220510701-220510723 CTTCATCAGGCAATTAGGGAAGG + Intergenic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948562395 2:238863359-238863381 CCTCTTCTGAAAATGATGGACGG - Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169541874 20:6608241-6608263 CCACATCTACAAATTAAGAATGG - Intergenic
1169782768 20:9327035-9327057 TCTCATCTGTAAGGTAGGGATGG + Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170683440 20:18547267-18547289 CCTCACCTGTAAACTAGGGATGG + Intronic
1170831134 20:19841619-19841641 CCACAGCTGAAAATCAGGGAAGG + Intergenic
1171902356 20:30869341-30869363 CCTCCTCTACAAAATAAGGATGG + Intergenic
1171988617 20:31678340-31678362 ACTCACCTGCAAATCAGCGATGG - Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172596330 20:36153673-36153695 CCTCATTTGCAAATGACGAAAGG - Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1173818788 20:46007721-46007743 CTTCAACTGCAAATTGGGGCAGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174262892 20:49309930-49309952 TCTCTTCTGCAAGTCAGGGAGGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174993896 20:55544104-55544126 CCTCAACTGCAAGGTGGGGAAGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175335369 20:58192723-58192745 CCTCACCTGCAACCCAGGGATGG + Intergenic
1175640826 20:60628925-60628947 CCTGATCTGCTCATTAGGGCTGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1175969647 20:62677960-62677982 CCACACCTGCAGATTTGGGAAGG + Intronic
1177357845 21:20031736-20031758 CCTCACCTTCAAGCTAGGGAAGG - Intergenic
1177922337 21:27167926-27167948 CCTCACCTGTAAAATAGGAATGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1181727723 22:24823128-24823150 CCTCATCTGTAAAGTAAAGAGGG + Intronic
1181762148 22:25066072-25066094 TCTCATGTGGAAATGAGGGAGGG + Intronic
1181876104 22:25942115-25942137 CCTCCTCTATAAAATAGGGATGG - Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182996244 22:34815478-34815500 CCTCATCTACAACATAAGGATGG - Intergenic
1183228662 22:36567138-36567160 CCTCATCTGTAAAGCAGGGATGG + Intronic
1183302832 22:37066678-37066700 CCTCTTCTGTAAAGTAGGGGTGG + Intronic
1183444671 22:37845442-37845464 CCTCACCTATAAAATAGGGATGG - Intronic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183633719 22:39048301-39048323 CCTCGTCTGTAAAATAGTGATGG + Intronic
1183654218 22:39175663-39175685 CCTCCCCTGCTCATTAGGGAGGG + Intergenic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1185284449 22:49994074-49994096 CCTGATCTCCAGGTTAGGGAAGG + Intergenic
1185284469 22:49994134-49994156 CCTGATCTCCAGGTTAGGGAGGG + Intergenic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952140765 3:30476477-30476499 CCTCATTTGCAGATAAGGAATGG - Intergenic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953475552 3:43202968-43202990 CCTCCTCTGTAAATGAGGGCTGG - Intergenic
953680158 3:45033142-45033164 CCTCATCTGTAAGGTAGGCAGGG + Intronic
953800548 3:46019497-46019519 TCTAATTTGCAGATTAGGGAGGG + Exonic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953972213 3:47356263-47356285 CCTCATCTGGAAAGTAGGAGCGG - Intergenic
955210994 3:56940874-56940896 TCTTATCTGCAAAATAGGTATGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956596238 3:70970700-70970722 CCTCTGCTGCATATTCGGGACGG + Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956886521 3:73565479-73565501 CCTCATCTGAAAAGGAGAGAAGG + Intronic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957089379 3:75713938-75713960 CCTCAGCTGCCAAACAGGGAAGG - Intronic
957569180 3:81924488-81924510 TCTTATCTACAAATTGGGGAGGG - Intergenic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
959286885 3:104426126-104426148 CCTCATTTGCAAATTAGGCCAGG - Intergenic
960174800 3:114504346-114504368 ACTCATATCCAAATTTGGGAAGG - Intronic
961219975 3:125192064-125192086 CCTCATCTCGAAATTCAGGATGG + Intronic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
962299366 3:134224311-134224333 CCTCAGCTACCAAATAGGGAAGG - Intronic
962492983 3:135911530-135911552 CCAGCTCTGCAAATGAGGGAGGG + Intergenic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963234921 3:142947183-142947205 CCTCATCTGTAAAATAGAGCGGG - Intergenic
965309901 3:167115655-167115677 CCTCATCTTCAGACCAGGGAGGG - Intergenic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
966153326 3:176890076-176890098 CCTAATATGAAAATCAGGGAAGG + Intergenic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967027039 3:185573732-185573754 CCTTAACTGAAAATTTGGGATGG + Intergenic
967634147 3:191780910-191780932 CCTCATCTGTAAATTTTGAAAGG + Intergenic
967939088 3:194752909-194752931 CCTCATTTGTAAATGAGGTATGG - Intergenic
968576888 4:1370855-1370877 CCTCCTCTGCAACTCAGGGACGG + Intronic
968999654 4:3970009-3970031 CCTCGTCTGTAACTTGGGGACGG + Intergenic
969192160 4:5531067-5531089 GCTCCTCTGCAAAGTTGGGAGGG - Intergenic
969388509 4:6873168-6873190 CCTCATCTGAAAACTAGCGGGGG - Intronic
969501721 4:7557354-7557376 CTTCATCTGTAAATTGGGGTTGG + Intronic
969887744 4:10231134-10231156 CATCATCAGCACATTAAGGATGG - Intergenic
970445281 4:16118714-16118736 CATCCTCTGCAAAACAGGGATGG + Intergenic
972041017 4:34599556-34599578 TATCATATGCAAATTAGTGAAGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
974644204 4:64671627-64671649 CCTCAACTTCAAGTTGGGGAGGG - Intergenic
975377793 4:73665729-73665751 CCTCAGCTGCCAAACAGGGAAGG - Intergenic
975378430 4:73671138-73671160 CCTCAGCTGCCAAACAGGGAAGG - Intergenic
975583630 4:75929091-75929113 CCTCATCTCGAAAGCAGGGATGG - Intronic
976010682 4:80484919-80484941 CCTCAGCTGTAAAGTATGGAAGG + Intronic
976049826 4:80998446-80998468 CTTCATCTGGAAATTAAGTATGG - Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
978308086 4:107354094-107354116 CCTCAGCTGCCAAATAGGGAAGG - Intergenic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
978894009 4:113864139-113864161 TTTCATTTGCAAATAAGGGAAGG - Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
982128136 4:152202075-152202097 CATCATATGCAAACAAGGGAAGG - Intergenic
987002711 5:13676425-13676447 CCTCATCTATAAAATAGGCATGG + Intergenic
989497617 5:42127085-42127107 CCTCATCTGCAAAGTAGAGGTGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991503973 5:67305389-67305411 GCTCATCTGCAAATTGCAGAAGG - Intergenic
992300142 5:75369569-75369591 CCTCATCTGTAAAACAGGGGTGG + Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993038062 5:82779314-82779336 CCTCATCTGCTGATTAGCCAAGG - Intergenic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997612553 5:135225286-135225308 CCTCATCTGTAAAGTAGGACAGG + Intronic
997792271 5:136771610-136771632 CCACATCTGCTAATGAGGGGCGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998607406 5:143649194-143649216 CCTCATTTATAAACTAGGGATGG - Intergenic
998633763 5:143929802-143929824 CCTTCTCTGCAAAATAGGAATGG + Intergenic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999300858 5:150489524-150489546 CCTCATCTGAAAATGGGGCAGGG - Intronic
999377721 5:151098315-151098337 TTTCATCTGCAAGTGAGGGAGGG + Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000460846 5:161516353-161516375 CCTCATCTGCAAAGCAGGGGTGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001131614 5:169069148-169069170 CCTCAACTGTAAATTGGGGGTGG - Intronic
1001403649 5:171461167-171461189 CCTCTGCTGCAAATTTGGGAAGG - Intergenic
1001443392 5:171763484-171763506 ACTCATATGAAAATTAGGGATGG + Intergenic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001811955 5:174635672-174635694 CATCATCTGAAAAATAGAGAAGG + Intergenic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002987250 6:2202534-2202556 CCTCCTCTGCAACTGAGGCACGG - Intronic
1003460147 6:6321137-6321159 CCTCCTGTGCAAATAAGGCATGG + Intergenic
1003480358 6:6525526-6525548 CATCATCTGTAAAACAGGGAAGG + Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007811463 6:44489157-44489179 GCTCATCTGTGAAATAGGGATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007962380 6:45971665-45971687 CTTCATCTGCCAATTATTGAAGG + Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008642600 6:53480028-53480050 CTTCGTATGCAAAGTAGGGATGG - Intergenic
1010189630 6:73181852-73181874 CTTTATCTGCAAAACAGGGATGG + Intronic
1011635066 6:89364123-89364145 CCTCATCTGAAAAATAGAAATGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013005439 6:106068809-106068831 TCTCTTCAACAAATTAGGGAGGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013691427 6:112649264-112649286 CCTCATCTGGAAAATAAAGAAGG + Intergenic
1014807225 6:125843726-125843748 TCTCATCTATAAATTAAGGAAGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019885274 7:3899174-3899196 CCTCAACAGCAGATCAGGGAGGG - Intronic
1019972428 7:4551795-4551817 CCTCTTCTGCAAATTGAAGATGG + Intergenic
1020258541 7:6516829-6516851 CCTCAGCTACCAAATAGGGAAGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021139710 7:17009012-17009034 CCTCTTCTGCAAAATAGCAAAGG + Intergenic
1021675646 7:23077863-23077885 CCTCATCTGTAAAACAGGGGTGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022497347 7:30861408-30861430 CCTCCTCTGAAAAACAGGGATGG - Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023170864 7:37389139-37389161 CCACAGCAGCAAATTAGAGAGGG + Intronic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026867382 7:73832052-73832074 CCTCCTCTGGATATTGGGGAGGG + Exonic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1028852003 7:95548599-95548621 CCTCATAGTCAAAATAGGGATGG - Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029707981 7:102285657-102285679 CCTTGTCTGTAAATTAGAGATGG + Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031410640 7:121436922-121436944 CTTCATTTGCATATTAGGGTGGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032825794 7:135566626-135566648 ACTAATCTGAAGATTAGGGAAGG - Intronic
1033420624 7:141201579-141201601 CATCATCTGCAAAATACTGATGG - Intronic
1033516094 7:142108102-142108124 TCTCATGTGCAAATTTGGGAGGG - Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036377583 8:8213949-8213971 CCTCGTCTGTAACTTGGGGATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036851980 8:12209199-12209221 CCTCGTCTGTAACTTGGGGATGG + Intergenic
1036873346 8:12451721-12451743 CCTCGTCTGTAACTTGGGGATGG + Intergenic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038308913 8:26430431-26430453 ACTTACCTGCAAATTAGGGCAGG - Intronic
1038331223 8:26611048-26611070 CCCCATCTGCAAAATAGAAATGG - Intronic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1038640204 8:29318151-29318173 CCTTAACTGAAAATTTGGGATGG + Intergenic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1041482396 8:58336442-58336464 GCTCATCTGTAAGTTGGGGATGG - Intergenic
1041786576 8:61640536-61640558 CCTCATCCACAAACTAGGTAAGG + Intronic
1042470317 8:69179847-69179869 TCCCATCTGCAAAGCAGGGAAGG + Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1043696434 8:83224691-83224713 CTTCAGCTGTAAATTTGGGATGG + Intergenic
1043804003 8:84647927-84647949 TCTCATCTGTAATTTGGGGAAGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044159838 8:88899379-88899401 CCTCAGCTACCAAATAGGGAAGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045334029 8:101182258-101182280 CATCATCTGTAAAGTAGGGGTGG - Intronic
1045362520 8:101446050-101446072 CTTCATCTGAAAAACAGGGATGG - Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047765926 8:127989888-127989910 CCTCATTAGTAAAATAGGGATGG + Intergenic
1048058563 8:130893274-130893296 CTTCATCTCGAGATTAGGGATGG + Intronic
1048421229 8:134280166-134280188 CCTCATCTGCAACCCAGGAATGG + Intergenic
1048609845 8:136010249-136010271 TCTCATCTCCAAAATAAGGACGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051712424 9:19945664-19945686 CTTCATCTGTAAATTAGGGGTGG - Intergenic
1052842779 9:33307504-33307526 CCTCATCTGTAAAGCAGAGATGG - Intronic
1053381260 9:37651083-37651105 CCTCCTCTGCAGGTAAGGGAGGG + Intronic
1054146196 9:61562792-61562814 CATCTTCTGCAGATAAGGGAGGG + Intergenic
1054822503 9:69537541-69537563 CCTCTTCTGGAAAGGAGGGAAGG + Intronic
1056520188 9:87393893-87393915 CCCCATCTGAACAGTAGGGAGGG + Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057344243 9:94234230-94234252 ACTCATCTGGAAATTAGAAATGG - Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058741637 9:107948598-107948620 CCTTATCTGTACATTAAGGATGG + Intergenic
1059155034 9:111982101-111982123 CCTGCTCTGAAAATTAGGGTTGG + Intergenic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061079174 9:128360100-128360122 TCCCATCTGCAAAGTAGGGGTGG + Intronic
1061195749 9:129106318-129106340 CCTCATCTGTAGATCAGTGAAGG + Intronic
1061245658 9:129400258-129400280 CCTCACCCGCAAACTAGGGGTGG - Intergenic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062369735 9:136231790-136231812 CCTCATCTGCCAAGTAGGGGCGG - Intronic
1203488221 Un_GL000224v1:78056-78078 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1203500842 Un_KI270741v1:19952-19974 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1185632299 X:1524128-1524150 TCTCATCTGCAATGTAGCGATGG + Intronic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187026575 X:15441606-15441628 CCTCATGGGGATATTAGGGAGGG - Intronic
1188875012 X:35418744-35418766 CCTCATCTGCAAATGAGGTCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190777137 X:53561990-53562012 CCACATGTGCACATGAGGGAGGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1191881049 X:65843988-65844010 GCCCATCTGTAACTTAGGGAGGG + Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195645957 X:107230760-107230782 CCTTATCTTAAAAGTAGGGAAGG + Intronic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic