ID: 953861750

View in Genome Browser
Species Human (GRCh38)
Location 3:46550219-46550241
Sequence CATCTGCAAATTAGGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953861741_953861750 28 Left 953861741 3:46550168-46550190 CCACTTACCATCTGTGTGAACTT 0: 1
1: 4
2: 105
3: 610
4: 2311
Right 953861750 3:46550219-46550241 CATCTGCAAATTAGGGATGGTGG 0: 1
1: 0
2: 2
3: 27
4: 293
953861742_953861750 21 Left 953861742 3:46550175-46550197 CCATCTGTGTGAACTTGAGCAAC 0: 1
1: 2
2: 18
3: 142
4: 818
Right 953861750 3:46550219-46550241 CATCTGCAAATTAGGGATGGTGG 0: 1
1: 0
2: 2
3: 27
4: 293
953861743_953861750 -5 Left 953861743 3:46550201-46550223 CCTAAGTCCCAACTTCCTCATCT 0: 1
1: 1
2: 17
3: 119
4: 759
Right 953861750 3:46550219-46550241 CATCTGCAAATTAGGGATGGTGG 0: 1
1: 0
2: 2
3: 27
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953861750 Original CRISPR CATCTGCAAATTAGGGATGG TGG Intronic
900108390 1:995831-995853 CGCCGGCAAGTTAGGGATGGGGG - Intergenic
901184566 1:7364623-7364645 CAGCTGCAGATATGGGATGGTGG + Intronic
901456696 1:9367148-9367170 CATCTGTAAAATGGGGATGAAGG + Intronic
902723231 1:18318228-18318250 CACCTGCAAATTTGGGACGGGGG - Intronic
902892045 1:19451599-19451621 CATCTGCAGGGTGGGGATGGTGG - Intronic
902995105 1:20218381-20218403 CTTCTGTGAATAAGGGATGGTGG + Intergenic
903424565 1:23244299-23244321 CATCTGGAAATTGGGGGTGAGGG + Intergenic
904658278 1:32065755-32065777 AATATGGAAATTAGGCATGGTGG + Intergenic
904939083 1:34152330-34152352 CATCAGCAAATTGGGGCTGAGGG - Intronic
906078084 1:43066882-43066904 CAACTGCAAGTCTGGGATGGTGG + Intergenic
906475193 1:46164835-46164857 CATCTCAAAAAAAGGGATGGGGG - Intronic
908511482 1:64853179-64853201 CATGTGCAAATTAGAGAAGTGGG - Intronic
908906210 1:69013571-69013593 CATCTGCAAATTAGAGACTCAGG - Intergenic
908954941 1:69613212-69613234 CATCTGCAAATCAGGAAGGAAGG - Intronic
911249035 1:95553914-95553936 GATCTGCAAATCAGGGGTTGAGG + Intergenic
912797789 1:112703383-112703405 CACCTGCAAAATGGGGATGATGG - Intronic
916206225 1:162318745-162318767 CAATTGGAAATAAGGGATGGAGG - Intronic
917791650 1:178502984-178503006 CATCTGCATAGTGTGGATGGAGG - Intergenic
918458934 1:184755541-184755563 CGTCTGCAAAAGGGGGATGGTGG - Intergenic
919301328 1:195770432-195770454 CATCTGCAAATGAAGGAGAGAGG + Intergenic
919551876 1:199000759-199000781 CATCTGCAAAATGGGGATAATGG + Intergenic
919998277 1:202774396-202774418 AATTTGGAAATTAGGCATGGTGG - Intronic
920950458 1:210567388-210567410 CATCTGGAAATTAAGGGAGGTGG + Intronic
921388600 1:214596585-214596607 CATCTGCAAGCTAGGGAGAGAGG + Intergenic
922854998 1:228767506-228767528 CATCTGCAAACCAAGGAGGGAGG + Intergenic
923991437 1:239441493-239441515 CATCTGCAAATTTAGGGTGTAGG + Intronic
1064230189 10:13522869-13522891 CATCTACAAAATGGGGATGACGG + Intronic
1064512333 10:16109143-16109165 CATCTGCTTATTAGGGCCGGTGG + Intergenic
1066335759 10:34476576-34476598 AATTTATAAATTAGGGATGGAGG - Intronic
1067374662 10:45716725-45716747 CATGTGCAACTTAGGGATCTAGG + Intergenic
1067882471 10:50058363-50058385 CATGTGCAACTTAGGGATCTAGG + Intergenic
1070545994 10:77452969-77452991 CATCTGGAAAACAGGGATGGGGG + Intronic
1071256585 10:83877258-83877280 CATCTGCAGTGGAGGGATGGGGG - Intergenic
1071565666 10:86670175-86670197 CATCTGCAACTGAAGGATGGAGG - Intronic
1072937622 10:99728671-99728693 CAGATTCAAATTAGGGATGAGGG - Intronic
1073131080 10:101189675-101189697 CTTCTGCAGAGCAGGGATGGAGG + Intergenic
1074316819 10:112368768-112368790 CATTTTTAAATTAGGTATGGCGG + Intergenic
1074916019 10:117955702-117955724 TATCAGCAAAGTAGGGAAGGAGG - Intergenic
1075659048 10:124180758-124180780 CATCTGTAAATTGGGGTGGGTGG - Intergenic
1077399069 11:2344292-2344314 CATCTGCAAATCAAGGAGTGAGG + Intergenic
1077768428 11:5188141-5188163 TATCTGTAAATTAAGGATGTTGG + Intergenic
1079191163 11:18277587-18277609 CATCTGTAAAATGGGGATGATGG - Intergenic
1080721890 11:34857629-34857651 CATCTGCAAAATGGGGATAATGG - Intronic
1081644567 11:44780744-44780766 CATCTGTAAAATAGGGATCATGG + Intronic
1081679658 11:44992712-44992734 CATCTGTAAAATAGGGTTGGTGG + Intergenic
1082785594 11:57314560-57314582 CATCTGTACATTAGGGCTGGTGG + Intronic
1084044512 11:66561033-66561055 CATCTGCAAAATGGGGCTGATGG - Intronic
1084311184 11:68317235-68317257 CATCTGCAAAATCGGGACGATGG + Intronic
1084587355 11:70070312-70070334 CCTCTGCAGATAAGGGGTGGCGG + Intergenic
1084677051 11:70641633-70641655 CATCTGCGTATTCAGGATGGAGG + Intronic
1085732686 11:79012908-79012930 CATCTGCAAAAGAGGGATCAAGG - Intronic
1089114979 11:116087502-116087524 CATCTGCAAAATAGGCATTGGGG - Intergenic
1089655919 11:119946943-119946965 CATCTGTAGAATAGGGATAGTGG - Intergenic
1090695623 11:129238588-129238610 CAACTGCAAATTGGGTGTGGTGG + Intronic
1090736395 11:129615198-129615220 TATCTGCAAATTAGGAATGATGG - Intergenic
1095455470 12:42379836-42379858 TATCTGCAAATTAAGTATGCTGG + Intronic
1096017535 12:48291328-48291350 CCTCTGGAAATTAGGAATGAAGG + Intergenic
1096792146 12:54051985-54052007 CATCTGCAATTAAGGGAATGAGG - Intronic
1097346361 12:58497922-58497944 CATCTGCCAATTGGTGATTGTGG - Intergenic
1098056284 12:66509363-66509385 CATCTCTAAAATAGGGATGATGG - Intronic
1098351963 12:69572158-69572180 CATCTCCAAATGAGGGATATCGG - Exonic
1098504958 12:71238721-71238743 CATCTGAACTTTATGGATGGGGG - Intronic
1098772249 12:74567413-74567435 CATCTGATATTTAGGGATGCTGG + Intergenic
1100675452 12:96861687-96861709 CATCTGTAAAATGGGGATGTTGG + Intronic
1101446370 12:104739452-104739474 CATCTGTAAAATGGGGATGACGG - Intronic
1101841576 12:108331246-108331268 CATCTGTGAAATGGGGATGGCGG - Intronic
1102049596 12:109853023-109853045 CATCTGCAAAATGGGGATAATGG + Intronic
1102469250 12:113150297-113150319 CATCTGTAAAATGGGGAGGGGGG + Intronic
1102530692 12:113544375-113544397 CATCTGTAAAGTGGGGATGATGG - Intergenic
1103915809 12:124375072-124375094 CATCTGCACATGAGAGTTGGTGG - Intronic
1104559367 12:129830104-129830126 CAACTGCAAATTAAGGCTGATGG + Intronic
1105627712 13:22129332-22129354 TATCTGAAAATTAGGGAGAGAGG + Intergenic
1106531739 13:30599605-30599627 CATCTGCAAGTTAAGGAGAGAGG - Intronic
1106618314 13:31350757-31350779 CATCTGTCAAATAGGGATGACGG - Intergenic
1107285560 13:38786821-38786843 CATCTGTAAAATAGGGATAATGG - Intronic
1107465068 13:40642081-40642103 CATATACAAATTGGGGATAGTGG + Intronic
1108687400 13:52832600-52832622 CATCAGCAAAATGGGAATGGTGG + Intergenic
1112936012 13:104799325-104799347 CATCTGCAATTCAGGGAAAGAGG - Intergenic
1113359113 13:109612065-109612087 CATCTGCAAGTTAAGGAAAGAGG - Intergenic
1115895414 14:38081103-38081125 TACCTGTAAATTAGGAATGGTGG + Intergenic
1118742788 14:68752553-68752575 CATCTGCAAGCTAAGGAGGGAGG + Intergenic
1120435531 14:84476900-84476922 CATCTGCAAAATGGTGATGATGG - Intergenic
1121643637 14:95502646-95502668 CTTCTGCAAAATGGAGATGGTGG - Intergenic
1126048558 15:44666760-44666782 TATCTACAAACTAGGGATGATGG - Intronic
1127625456 15:60775953-60775975 CCTCTGGCACTTAGGGATGGAGG - Intronic
1128553296 15:68612751-68612773 CCTCTGCAAATGAGGGAATGGGG + Intronic
1129674559 15:77625388-77625410 CATCTGCAAAATGGGGATAGTGG - Intronic
1129913060 15:79244119-79244141 CATCTGCAAAGTAGGAAAGTAGG + Intergenic
1130393474 15:83480402-83480424 CATCTGTGAAATTGGGATGGCGG - Intronic
1130956647 15:88631530-88631552 CATCTGTAAAGTGGGGATAGTGG + Exonic
1132653090 16:1030434-1030456 CATCTGTAAAGTGGGGGTGGGGG + Intergenic
1134911990 16:18035811-18035833 AATCTGCAAAATAGGGATAATGG - Intergenic
1135186515 16:20320471-20320493 CATCTGCAAAGCAGAGATGAAGG + Exonic
1135576916 16:23593144-23593166 CATCAAAAAATTAGGGGTGGTGG + Intronic
1136225312 16:28856486-28856508 TATCTACAAATTGGGGGTGGAGG + Intronic
1136227611 16:28869477-28869499 CATCTGGAAAACAGGGATGGGGG - Intronic
1137974790 16:53022214-53022236 CATCACCAGATTAGGGATAGCGG + Intergenic
1139572204 16:67820304-67820326 CGTCTGTAAAATAGGGATGATGG - Intronic
1140679782 16:77373828-77373850 AAACTGCATATGAGGGATGGTGG - Intronic
1141356010 16:83347621-83347643 CATCTGTAAGATAGGGATAGTGG - Intronic
1141933470 16:87220191-87220213 CATCTGTAAAATAGGGATAATGG + Intronic
1142194262 16:88732334-88732356 CTTCTACAAATTCGGGCTGGAGG - Exonic
1143096016 17:4478812-4478834 CATCTGCAAAATCGGGATGATGG - Intronic
1143247720 17:5500368-5500390 CACCTGCAGGTTAGGGGTGGAGG - Intronic
1143487304 17:7261948-7261970 CATCTGCCACTGCGGGATGGCGG + Exonic
1143906060 17:10210114-10210136 CATCTGCAGGACAGGGATGGGGG + Intergenic
1146376305 17:32297005-32297027 AATATGAAAATTAGGCATGGTGG - Intronic
1147429981 17:40364867-40364889 CATCTGGAAATGGGGGAGGGGGG + Intergenic
1147446779 17:40479585-40479607 CAGCTGCAGATCAGGGATGAAGG - Intronic
1147497777 17:40934228-40934250 CATCTTCAAATGAGGGAGGTTGG + Intronic
1148071122 17:44909251-44909273 CATCTGTAAAATAAGGATGATGG + Intronic
1148786500 17:50148582-50148604 CTTCTGCAAAGTTGGGGTGGGGG + Intronic
1148823297 17:50373430-50373452 CATCTGCAAATCAGGGGAGTGGG - Intronic
1149964052 17:61143857-61143879 CACCTACAAATTAGGGGTGCTGG + Intronic
1150802552 17:68292911-68292933 GATCTGTAAAATGGGGATGGAGG + Intronic
1152796614 17:82310745-82310767 CATCTGTAAATGAGGGAGGTGGG - Intergenic
1154146618 18:11871948-11871970 CATTTTCATATTAGGGATGCTGG - Intronic
1156441362 18:37191681-37191703 CAGATGAAAATTAGAGATGGGGG - Intronic
1157462696 18:47914782-47914804 CATCTGAAAAATAAGGAAGGGGG - Intronic
1157753923 18:50201416-50201438 CATCTTCAAATTGGGGTTTGTGG + Intergenic
1159202998 18:65212263-65212285 CATCTGCAAGTTAGGGAATCAGG + Intergenic
1159218054 18:65422837-65422859 CATCTGCAACTCAGAGTTGGAGG + Intergenic
1159563430 18:70020930-70020952 GAACTGCAAATTAGCAATGGAGG + Intronic
1160352459 18:78195318-78195340 CATCTGCAAAGTAGTGATCATGG + Intergenic
1160559978 18:79750065-79750087 GATCTGCAGATGAGGCATGGAGG + Intronic
1162518675 19:11166229-11166251 CAGCTGGTAATTATGGATGGAGG - Intronic
1164709473 19:30345143-30345165 CATCTGCAAAATAGGGATGATGG - Intronic
1165278315 19:34773609-34773631 CATCTGAAAATTACTGATAGGGG - Intergenic
1165885921 19:39078242-39078264 CATATATAAATTAGAGATGGGGG + Intergenic
1166085015 19:40468678-40468700 CATCTGCAAAATAGTAATGATGG - Intronic
1166158335 19:40932510-40932532 CATCTTAGAAGTAGGGATGGTGG + Intergenic
1166167317 19:41000736-41000758 CATCTTAGAATTAGGGATGGTGG + Intronic
1166796675 19:45430377-45430399 CATCTCTAACATAGGGATGGCGG - Intronic
1167240720 19:48341667-48341689 AATCTGCAAAGTAGGGATGATGG - Intronic
1167243945 19:48362826-48362848 CATCTGTAAAATGGGGATGATGG + Intronic
1168475887 19:56674854-56674876 CATCTGCAAACCAGGGAGAGAGG + Intergenic
926303346 2:11619089-11619111 CATCTGCCACTCAGGGCTGGTGG + Intronic
926599865 2:14830738-14830760 CATCCCCAAATCAGGGATGAGGG + Intergenic
927517990 2:23683057-23683079 CATCTGTAAAATGGGGATTGAGG - Intronic
927702285 2:25276124-25276146 CATCTGGAAAATAAGGATGCTGG + Intronic
931080603 2:58765687-58765709 CATCTACATATTAGGGAAAGGGG - Intergenic
933816852 2:86075258-86075280 CACCTGGAAATGAGGAATGGAGG + Exonic
934621040 2:95806917-95806939 AAACTGCACATTGGGGATGGTGG - Intergenic
934812403 2:97291906-97291928 AAACTGCACATTGGGGATGGTGG + Intergenic
934825290 2:97416017-97416039 AAACTGCACATTGGGGATGGTGG - Intergenic
935185546 2:100729049-100729071 TATCTGCAAGTTAGGAATAGAGG + Intergenic
937310473 2:120899687-120899709 CCTCTGCAGAATAGGAATGGCGG + Intronic
937543408 2:122987155-122987177 CATCTGAAAATTGTGGAGGGAGG + Intergenic
937780736 2:125834295-125834317 CATATATAAAATAGGGATGGTGG - Intergenic
937853692 2:126657407-126657429 CATCTGCAAAGTAGGAAAGTAGG + Intronic
938014397 2:127855670-127855692 CATCAACAAAATGGGGATGGGGG + Intronic
938293503 2:130162659-130162681 CATCTGAAAATAAGGGCTAGTGG + Intronic
939845703 2:147243978-147244000 CATCTGCAAATTAGCAGTTGAGG - Intergenic
940325019 2:152416059-152416081 CATCTGCCAAGCATGGATGGAGG + Intronic
941461785 2:165780618-165780640 CATCTGCAAATCAGGTTTGAGGG + Intronic
942350961 2:175052559-175052581 CCTCTGCAAATTTGGGAGGCAGG - Intergenic
943990675 2:194687275-194687297 TCTCTGCAAGTTAGAGATGGAGG + Intergenic
944352329 2:198743180-198743202 CTTCTACAAATTTGGCATGGGGG + Intergenic
944464354 2:199985172-199985194 CATCTGTAAAATGGGGATGATGG + Intronic
945487701 2:210417116-210417138 CATCAGCAAATCAGTGAGGGAGG + Intergenic
945509731 2:210686469-210686491 CATCTATAAATTAGGGATGCTGG - Intergenic
945859722 2:215106898-215106920 CATGTGAAAATCAGGGCTGGTGG - Intronic
946525191 2:220510704-220510726 CATCAGGCAATTAGGGAAGGTGG + Intergenic
948423847 2:237876032-237876054 GATCAGCAATTTACGGATGGGGG - Intronic
1169358890 20:4930832-4930854 CATGTTCAAGTTAGGGTTGGTGG + Intronic
1169782769 20:9327038-9327060 CATCTGTAAGGTAGGGATGGTGG + Intronic
1170357661 20:15509778-15509800 CATCTGTAAAATAGGGAGGGTGG + Intronic
1170451784 20:16490657-16490679 CATCTGCAAGCCAAGGATGGGGG + Intronic
1174800617 20:53560394-53560416 CATCTGCAAATGAGGGATAGAGG + Intergenic
1174956080 20:55100197-55100219 CATCTGCAAATTGAGGATCAAGG + Intergenic
1175310809 20:58010595-58010617 CATCTACAAACTGGGGATGCTGG + Intergenic
1175550236 20:59812858-59812880 CATCTGCAGAGCAGGGATGATGG - Intronic
1176076242 20:63249622-63249644 CATCTGTAAAGCAGGGATCGTGG + Intronic
1177328956 21:19631001-19631023 CATCTGCTCATTAGGGTTGTTGG + Intergenic
1180980816 22:19877232-19877254 CACCTGCACATGGGGGATGGGGG + Exonic
1181431536 22:22884691-22884713 CAGCTTGAATTTAGGGATGGTGG + Intronic
1181810459 22:25400811-25400833 CATCTGCAAAATTGGGACGATGG - Intronic
1181918580 22:26301104-26301126 CATCTGCAAAATGGGGATAATGG - Intronic
1181996213 22:26884854-26884876 CAACTGCAAAGTGGGGATCGTGG + Intergenic
1182086033 22:27561779-27561801 CATCTGCAAGCTGGAGATGGAGG - Intergenic
1182282404 22:29225119-29225141 AAGCTGCAACTAAGGGATGGAGG - Exonic
1182958762 22:34452574-34452596 CATCTGTAAATTGGGAATGATGG + Intergenic
1183080521 22:35452945-35452967 CATCTGCAAAGCAGGGATAGCGG - Intergenic
1183346494 22:37311184-37311206 CATCTGTAAAATGGGCATGGAGG - Intronic
1183747010 22:39697860-39697882 CTTCTGCGAATGAGGAATGGAGG + Intergenic
949707287 3:6833863-6833885 CATCTGAAAATTGGAGAAGGTGG - Intronic
950127157 3:10516807-10516829 CATCTGCAAAATGGAGATGATGG + Intronic
950438629 3:12994630-12994652 CATCTGCGAACTGGGGACGGCGG - Intronic
952260847 3:31738658-31738680 CATCTGTCAAGTAGGCATGGTGG - Intronic
952724275 3:36566747-36566769 CAAATGCAAAGTAGGTATGGTGG - Intergenic
953861750 3:46550219-46550241 CATCTGCAAATTAGGGATGGTGG + Intronic
955071424 3:55575501-55575523 CATCTGCAAAATGGGGATGATGG + Intronic
957375145 3:79346224-79346246 CTTCTACAAAATAGGGCTGGTGG + Intronic
958134460 3:89470512-89470534 CATCTGTAAAATGGGGATGATGG - Intronic
958606092 3:96360366-96360388 CATCTGCAACATAGGGATGAAGG - Intergenic
961621602 3:128228760-128228782 CATCTGCAAAATGGGGGTGTTGG + Intronic
961731451 3:128968122-128968144 CATCTCCACATTACAGATGGGGG + Exonic
962075823 3:132080797-132080819 CATCTGCAAGTTAAGGAGGAAGG - Intronic
962392873 3:134987824-134987846 CATCTGCAAACCAAGGACGGAGG + Intronic
962844997 3:139266409-139266431 CATTTGCAAACTAGGGATCCTGG - Intronic
969393742 4:6907699-6907721 TATCTGCACATCAGAGATGGGGG + Intergenic
969492777 4:7509568-7509590 CATCTGGAAAATGGGGATGATGG - Intronic
969991700 4:11271166-11271188 CATCTGCAAATTGAGGAGGAAGG + Intergenic
971157920 4:24103126-24103148 CATCTGCAAAATGGGAATGATGG - Intergenic
972001568 4:34042240-34042262 CATCTGTAAAAGAGGGAAGGAGG - Intergenic
972742306 4:41899062-41899084 CATCTGCAAACTAGGAAGAGAGG + Intergenic
972848952 4:43024662-43024684 ACTCTGCAAATTAAGGATGCCGG + Intronic
973117773 4:46482831-46482853 AATCTGCAAACTAGGCAAGGGGG - Intergenic
973229642 4:47826579-47826601 CATGTGACAATTAGTGATGGTGG - Intronic
973242931 4:47977340-47977362 CATCTGCAAGCTAAGGAGGGAGG + Intronic
974594345 4:63997131-63997153 CATTTGAAAATTTGAGATGGTGG + Intergenic
976612501 4:87044550-87044572 AAGCTGAAAATTAAGGATGGGGG + Intronic
976766163 4:88600022-88600044 CATCTGTAAATTAGAGATAATGG + Intronic
981532020 4:145762317-145762339 CATCTGCTAATGAGGAAGGGAGG + Intronic
981545954 4:145893302-145893324 CCTCTGCAATTTAGGGATACAGG + Intronic
984999545 4:185470714-185470736 TATCTGCAAAATGGGGATCGTGG + Intronic
985006399 4:185539001-185539023 CATCTGCAAATGAGGGAGAGGGG - Intergenic
990539123 5:56754795-56754817 CATCTGTAAAATAGGTATGATGG - Intergenic
991065087 5:62416073-62416095 CATCTGCAAGCCAAGGATGGAGG - Intronic
991485661 5:67133728-67133750 CATCTTCACATTAGTGCTGGTGG + Intronic
991989707 5:72325457-72325479 CATGTGTAAATTAAGGATCGTGG - Intronic
993602534 5:89946372-89946394 CATATTCAAATTTGGGAGGGGGG + Intergenic
994671928 5:102772303-102772325 CCTCTGTAAAATAGGGATGAAGG - Intronic
995190594 5:109315700-109315722 CATCTGCTCATCAGGAATGGAGG + Intergenic
995348622 5:111149464-111149486 CATATACAAAATAGGTATGGTGG - Intergenic
995476715 5:112555444-112555466 CATCTGCAAAGGAAGGAGGGTGG + Intergenic
996023672 5:118619574-118619596 CATCTGAGAATTTGGGATGCAGG + Intergenic
996332221 5:122342596-122342618 CATCTGTAAATTGGGGATAATGG - Intronic
996460440 5:123734422-123734444 CATCTGCAAGCTAGGGAAGAAGG - Intergenic
996496251 5:124160606-124160628 TATCTGTAAAATAGGGATGCTGG + Intergenic
996538742 5:124607055-124607077 CATCATCAAATTAGGTGTGGAGG + Intergenic
997435006 5:133867675-133867697 CATCTGCAAAGTAGGGCATGCGG - Intergenic
997525172 5:134548382-134548404 CAACTGTAAAATAGGGATGATGG + Intronic
999095847 5:148977587-148977609 CATCTGTAAAATGGGGTTGGGGG - Intronic
999377722 5:151098318-151098340 CATCTGCAAGTGAGGGAGGGAGG + Intergenic
999657437 5:153824687-153824709 CATCTGTAAAATGGGGATGTTGG - Intergenic
999926163 5:156380705-156380727 CATCTGTAAAATGGGGATAGTGG + Intronic
1000151963 5:158511620-158511642 CACCTGCAACTTAAGGATGTGGG - Intergenic
1000227799 5:159284164-159284186 CATTTGCAATTTAAAGATGGGGG - Intronic
1000399027 5:160805906-160805928 CATCTGCAAGCTGGAGATGGGGG + Intronic
1000669388 5:164041600-164041622 CCTCTGCAGCTTAGTGATGGAGG - Intergenic
1001836693 5:174838393-174838415 CAGCTGCAAAATAGGAAGGGAGG + Intergenic
1003061104 6:2863411-2863433 CATCTGCAAGTTAAGGAGGGAGG - Intergenic
1003585061 6:7381348-7381370 CATCTGCAAGCCAGGGAGGGAGG + Intronic
1004110401 6:12712741-12712763 CATCTGGAAATAGGGGAAGGGGG - Intergenic
1004271000 6:14195274-14195296 CATCTGCAAATGAGAAATTGAGG + Intergenic
1004324519 6:14662674-14662696 CTTCTGCACATTAGGCATAGGGG + Intergenic
1004742140 6:18472458-18472480 CATCTGTACATTGGGGGTGGGGG - Intergenic
1007962381 6:45971668-45971690 CATCTGCCAATTATTGAAGGAGG + Intronic
1008078471 6:47170288-47170310 CATCTGCAAAATAGGGAGGCTGG + Intergenic
1008337959 6:50329014-50329036 GATATGCATATTGGGGATGGTGG - Intergenic
1008897168 6:56569356-56569378 CATCCACAAATTTGGAATGGGGG + Intronic
1010369808 6:75094720-75094742 CATTAGCAAGCTAGGGATGGAGG + Intronic
1012217299 6:96602998-96603020 CATCAGCACATTTGGGATGGTGG + Intronic
1013270615 6:108542441-108542463 CATCTGCAAAATAGGGGTTCTGG + Intergenic
1014918226 6:127180280-127180302 CAAAGGCAAATTAGGGAAGGAGG + Intronic
1018963871 6:168468387-168468409 CATCTGCACATTCTGAATGGGGG - Intronic
1019318155 7:401051-401073 CGTCTGCAAAGAAGGGGTGGAGG + Intergenic
1019773084 7:2896016-2896038 CATCTGTAAAGTAGGAATGATGG + Intergenic
1020098613 7:5382116-5382138 CATCTGGAAGATAGGGATGAGGG - Intronic
1020520668 7:9182328-9182350 TATCTGTAAATTAGGGATAGTGG - Intergenic
1022987914 7:35677799-35677821 CAGCAGCTAATAAGGGATGGGGG + Intronic
1023040261 7:36167020-36167042 CATCTGCAAACCAGGGAAAGGGG - Intronic
1023338387 7:39193595-39193617 CATCTGCAAAATGGGAATGATGG + Intronic
1024985647 7:55191360-55191382 TATCTGCAAAGTGGGGGTGGGGG - Intronic
1026052919 7:66961854-66961876 CATCTGTAAAACAAGGATGGTGG + Intergenic
1026552662 7:71381333-71381355 CATGTGGAAATTAGGGCTGATGG + Intronic
1028457418 7:91053654-91053676 CATCTGCAAATGAGGAAAGTGGG - Intronic
1028634797 7:92975864-92975886 CATCTGCAATTTAGGAAGAGAGG + Intergenic
1029706642 7:102279928-102279950 CATCTGCAAAAAAGGGAAGTGGG - Intronic
1030651994 7:112126326-112126348 CATCTCCACATTAGAGATGAAGG + Intronic
1030935220 7:115577657-115577679 CATCTGGAAATCAGGGAGGCTGG - Intergenic
1031257120 7:119467335-119467357 CCTCTACCAATAAGGGATGGAGG - Intergenic
1031410639 7:121436919-121436941 CATTTGCATATTAGGGTGGGAGG - Intergenic
1034122440 7:148639921-148639943 CATCTGCAAGCCAAGGATGGAGG - Intergenic
1035114521 7:156513076-156513098 GATCTACGAATTATGGATGGAGG - Intergenic
1037128577 8:15380652-15380674 CATCTGCAAGCTAAGGATAGAGG + Intergenic
1038308910 8:26430428-26430450 TACCTGCAAATTAGGGCAGGGGG - Intronic
1038493398 8:27985601-27985623 CATCTGCCAAATGGGGATGCAGG - Intronic
1039242325 8:35570491-35570513 CACCTGCAAATGAAAGATGGTGG - Intronic
1039474759 8:37833874-37833896 CTTGAGCAAATGAGGGATGGGGG - Intronic
1039554463 8:38466784-38466806 CATCTGGAAATTGGGGGTGGGGG + Intronic
1040384997 8:46909082-46909104 CATCTGCACTTTATGGATGAGGG - Intergenic
1040525930 8:48225356-48225378 CATCTGAAAAATGGGGAAGGTGG - Intergenic
1042947158 8:74166690-74166712 CATCTGTAAAATGGGGATGACGG - Intergenic
1043106605 8:76121225-76121247 AAGCTGCAGATTAGTGATGGTGG - Intergenic
1043411345 8:80000045-80000067 CATATGCAAATGGGGGAAGGAGG - Intronic
1045394641 8:101748670-101748692 CATCTGTAAAATAAGGATGATGG - Intronic
1045569914 8:103358245-103358267 CTACTGCCAATTTGGGATGGAGG + Intergenic
1046647820 8:116805093-116805115 CATCTGCAAAATGGGAATGACGG + Intronic
1046783124 8:118237037-118237059 CATCTGTAAGTTGAGGATGGTGG + Intronic
1052522943 9:29572918-29572940 CATCTGCAAATCAGGGAACATGG - Intergenic
1055538096 9:77269994-77270016 CATCTGCAAGTTAACGATAGAGG + Intronic
1056192274 9:84196016-84196038 CATCTGCAAACTAGGGAACCAGG - Intergenic
1056559719 9:87719400-87719422 CATCTGTAAAATGGGGATGAGGG + Intergenic
1056566399 9:87776674-87776696 CATCTGTAAAATGGGGATGAGGG - Intergenic
1057083398 9:92189019-92189041 GATCTGCAAAGTAGGCATGCAGG - Intergenic
1057281550 9:93716045-93716067 CTTCAGCAAATTAGGAATAGAGG - Intergenic
1057510427 9:95674939-95674961 CATCTGTGACTTAGGGAAGGAGG + Intergenic
1059018854 9:110551939-110551961 CATCTGGATATCTGGGATGGTGG + Intronic
1060141257 9:121212340-121212362 CATCTGTAAAATAGGTATGGTGG + Intronic
1060290860 9:122301230-122301252 CATCAGCATATGAGGGACGGCGG - Intronic
1060552880 9:124493914-124493936 CAGCTGAAAAATAGGGATTGGGG - Intronic
1060568924 9:124619705-124619727 TATCTGTAAAATAGGGAGGGGGG + Intronic
1060623753 9:125091767-125091789 CAGCTGAAAAGTGGGGATGGCGG - Intronic
1061004867 9:127923076-127923098 CATCTGCAAACTGGGGTTGCTGG - Intronic
1061209476 9:129182526-129182548 CATCTGGAAATTGAGGCTGGGGG - Intergenic
1188151677 X:26684091-26684113 CATGTGCAACTTAGTGATTGGGG + Intergenic
1188695779 X:33188914-33188936 CCTCTGCAAACTAAGGAGGGAGG + Intronic
1189409949 X:40761175-40761197 CATCTGCCACTGCGGGATGGCGG + Intergenic
1190397305 X:49998159-49998181 CATCTGTAAAATGGGGAGGGCGG - Intronic
1192267749 X:69551400-69551422 TAGTTGCAAGTTAGGGATGGTGG + Intergenic
1192568157 X:72180498-72180520 CATATACAAATTATTGATGGTGG + Intergenic
1194674974 X:96783460-96783482 CAGATGCAAACTAGAGATGGTGG + Intronic
1194832739 X:98644902-98644924 CTTTTGCAAAATAGGGATGATGG - Intergenic
1196194801 X:112828353-112828375 CATCTGCAAAATAGGGATAATGG + Intronic
1198198432 X:134389050-134389072 CAGCTTCAAATTAGGGATACTGG - Intronic
1198441850 X:136671153-136671175 CATCTGTAAAATAAGGATGACGG - Intronic
1198610730 X:138396759-138396781 CATCTTCACATTAGGAAAGGCGG - Intergenic
1199661345 X:150053745-150053767 CCTCTGAAAATGCGGGATGGTGG - Intergenic
1200266907 X:154651431-154651453 CATTTAAAAATTAGGGGTGGAGG - Intergenic
1200300888 X:154974410-154974432 CATATGCAAATTAAGAATGAAGG - Intronic
1201723532 Y:17130527-17130549 CATCTGCATATTAAGGACGTTGG + Intergenic