ID: 953863776

View in Genome Browser
Species Human (GRCh38)
Location 3:46566171-46566193
Sequence GCTTACCTGCCCCGAGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953863763_953863776 3 Left 953863763 3:46566145-46566167 CCCCCCGGCCACCTCGGACGCCC 0: 1
1: 0
2: 1
3: 22
4: 248
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863769_953863776 -8 Left 953863769 3:46566156-46566178 CCTCGGACGCCCAGCGCTTACCT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863756_953863776 15 Left 953863756 3:46566133-46566155 CCCCCGCTCCCGCCCCCCGGCCA 0: 1
1: 0
2: 7
3: 189
4: 1311
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863759_953863776 12 Left 953863759 3:46566136-46566158 CCGCTCCCGCCCCCCGGCCACCT 0: 1
1: 0
2: 6
3: 122
4: 1108
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863762_953863776 6 Left 953863762 3:46566142-46566164 CCGCCCCCCGGCCACCTCGGACG 0: 1
1: 0
2: 1
3: 10
4: 205
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863765_953863776 1 Left 953863765 3:46566147-46566169 CCCCGGCCACCTCGGACGCCCAG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863768_953863776 -5 Left 953863768 3:46566153-46566175 CCACCTCGGACGCCCAGCGCTTA 0: 1
1: 0
2: 1
3: 6
4: 45
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863766_953863776 0 Left 953863766 3:46566148-46566170 CCCGGCCACCTCGGACGCCCAGC 0: 1
1: 0
2: 0
3: 12
4: 231
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863757_953863776 14 Left 953863757 3:46566134-46566156 CCCCGCTCCCGCCCCCCGGCCAC 0: 1
1: 0
2: 7
3: 135
4: 1208
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863758_953863776 13 Left 953863758 3:46566135-46566157 CCCGCTCCCGCCCCCCGGCCACC 0: 1
1: 2
2: 8
3: 147
4: 1425
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863764_953863776 2 Left 953863764 3:46566146-46566168 CCCCCGGCCACCTCGGACGCCCA 0: 1
1: 0
2: 0
3: 14
4: 244
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863761_953863776 7 Left 953863761 3:46566141-46566163 CCCGCCCCCCGGCCACCTCGGAC 0: 1
1: 0
2: 1
3: 27
4: 322
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863767_953863776 -1 Left 953863767 3:46566149-46566171 CCGGCCACCTCGGACGCCCAGCG 0: 1
1: 0
2: 1
3: 40
4: 1801
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953863776 Original CRISPR GCTTACCTGCCCCGAGGGGC GGG Exonic