ID: 953863776

View in Genome Browser
Species Human (GRCh38)
Location 3:46566171-46566193
Sequence GCTTACCTGCCCCGAGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953863767_953863776 -1 Left 953863767 3:46566149-46566171 CCGGCCACCTCGGACGCCCAGCG 0: 1
1: 0
2: 1
3: 40
4: 1801
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863759_953863776 12 Left 953863759 3:46566136-46566158 CCGCTCCCGCCCCCCGGCCACCT 0: 1
1: 0
2: 6
3: 122
4: 1108
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863762_953863776 6 Left 953863762 3:46566142-46566164 CCGCCCCCCGGCCACCTCGGACG 0: 1
1: 0
2: 1
3: 10
4: 205
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863757_953863776 14 Left 953863757 3:46566134-46566156 CCCCGCTCCCGCCCCCCGGCCAC 0: 1
1: 0
2: 7
3: 135
4: 1208
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863758_953863776 13 Left 953863758 3:46566135-46566157 CCCGCTCCCGCCCCCCGGCCACC 0: 1
1: 2
2: 8
3: 147
4: 1425
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863763_953863776 3 Left 953863763 3:46566145-46566167 CCCCCCGGCCACCTCGGACGCCC 0: 1
1: 0
2: 1
3: 22
4: 248
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863765_953863776 1 Left 953863765 3:46566147-46566169 CCCCGGCCACCTCGGACGCCCAG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863761_953863776 7 Left 953863761 3:46566141-46566163 CCCGCCCCCCGGCCACCTCGGAC 0: 1
1: 0
2: 1
3: 27
4: 322
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863764_953863776 2 Left 953863764 3:46566146-46566168 CCCCCGGCCACCTCGGACGCCCA 0: 1
1: 0
2: 0
3: 14
4: 244
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863768_953863776 -5 Left 953863768 3:46566153-46566175 CCACCTCGGACGCCCAGCGCTTA 0: 1
1: 0
2: 1
3: 6
4: 45
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863766_953863776 0 Left 953863766 3:46566148-46566170 CCCGGCCACCTCGGACGCCCAGC 0: 1
1: 0
2: 0
3: 12
4: 231
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863756_953863776 15 Left 953863756 3:46566133-46566155 CCCCCGCTCCCGCCCCCCGGCCA 0: 1
1: 0
2: 7
3: 189
4: 1311
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121
953863769_953863776 -8 Left 953863769 3:46566156-46566178 CCTCGGACGCCCAGCGCTTACCT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953863776 Original CRISPR GCTTACCTGCCCCGAGGGGC GGG Exonic
902311461 1:15584754-15584776 GCAGACCTCCCCCGAGGGGCTGG - Exonic
902364878 1:15966267-15966289 ACTTTCCTGTCCCGAGTGGCAGG - Intronic
903071901 1:20730878-20730900 GCTGACCTGCCTCGTGGGTCAGG + Intronic
903673230 1:25048527-25048549 GCTCACCTGCTAGGAGGGGCAGG - Intergenic
903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG + Exonic
904237569 1:29124627-29124649 GCATTCCTGCCTCCAGGGGCGGG - Intergenic
906035216 1:42746607-42746629 GCTCTGCAGCCCCGAGGGGCTGG + Exonic
916934747 1:169616013-169616035 GCTTCCCTGTCCAGAGGGGCCGG - Intronic
920251476 1:204624991-204625013 GCTTACCTCCCAGGAGGAGCTGG - Intronic
920715354 1:208335493-208335515 GCTTAGCTGCCCCGAAAGGCAGG + Intergenic
922017691 1:221668094-221668116 TCTTACCTGCCCTGAAGGGAGGG - Intergenic
922660343 1:227424557-227424579 GCCTACCTGGCCGGAAGGGCTGG - Intergenic
1065140635 10:22715017-22715039 GCTTCCCAGCACCGAGGGGAAGG + Intergenic
1066005667 10:31144217-31144239 GCTCAGCTACCCCAAGGGGCTGG + Intergenic
1066204871 10:33179172-33179194 CCTTGCCTGCCCGGAGGGGCTGG + Exonic
1066331917 10:34432764-34432786 GCTTACCTGCAAGGATGGGCTGG - Intronic
1067044433 10:42976334-42976356 TCTTACCTGCCAGGAGGAGCGGG - Intergenic
1067082629 10:43220108-43220130 GGTTACCAGCCCCCAGGGCCAGG - Intronic
1076822216 10:132945199-132945221 GCTTGCCTGTCCCCAGGAGCTGG - Intergenic
1077054962 11:587029-587051 GGTGCCCTGCACCGAGGGGCGGG - Intronic
1077247963 11:1548300-1548322 GCCTCCCTGCCGCGAGGGTCGGG - Intergenic
1077296969 11:1830935-1830957 CCTGACCAGCCCCGTGGGGCCGG + Intronic
1078771706 11:14358410-14358432 GCTTTACTGCTCCGAGGGTCCGG - Intronic
1079407096 11:20156780-20156802 GCCACCCTGCCCCGAAGGGCGGG + Intronic
1083155180 11:60818462-60818484 GCTGACCTGCCAGGAGGAGCAGG + Intergenic
1083225512 11:61282029-61282051 CCATGCCTGCCCCGAGGTGCGGG + Intronic
1083572802 11:63769100-63769122 GCTGAGATGCCCCGAGGGGGCGG - Intergenic
1089745743 11:120615676-120615698 ACTTACCAGGCCCTAGGGGCAGG - Intronic
1090036907 11:123257057-123257079 GCTGGCCTGCCCAGAGGTGCTGG + Intergenic
1094844335 12:34354873-34354895 GCTTCCCTGCCGCCATGGGCTGG + Intergenic
1094844849 12:34356957-34356979 GCTTTCCTGCCGCCACGGGCTGG + Intergenic
1098973389 12:76878664-76878686 ATTTACCTGCCCCGCGGGCCTGG + Intronic
1103691041 12:122774586-122774608 GCGCGCCTGCCCCGAGCGGCGGG - Exonic
1104760412 12:131294874-131294896 GCTCACCTGCGAAGAGGGGCGGG + Intergenic
1104909900 12:132235656-132235678 CCTGCCCTGTCCCGAGGGGCTGG - Intronic
1105015798 12:132786282-132786304 CCTTCCCTGCACTGAGGGGCTGG + Intronic
1108701461 13:52947807-52947829 GCTTCCCTGACTCCAGGGGCAGG - Intergenic
1115645971 14:35368769-35368791 GCTTTCCTGGACAGAGGGGCTGG + Intergenic
1118740726 14:68737544-68737566 GCTCCCCTGCCCAGAGGGGAGGG + Intergenic
1122427515 14:101620487-101620509 GGTCACCTGCCCCGAGACGCGGG + Intergenic
1124441870 15:29691337-29691359 GCTTTACTGCCCTGTGGGGCTGG + Intergenic
1124600155 15:31127327-31127349 GCCTACCAGTCCCCAGGGGCAGG + Intronic
1128218148 15:65948433-65948455 GCATACCGACCCCGAAGGGCTGG + Intronic
1131054461 15:89367508-89367530 GCTTCCCCGCCCCGAGGGCAAGG - Intergenic
1133609937 16:7423688-7423710 GCTGACCTGCCCAGAGGAGGAGG + Intronic
1134695624 16:16221883-16221905 GCTCACCTGCCCAGGGGGCCAGG + Intronic
1134976204 16:18572803-18572825 GCTCACCTGCCCGGGGGGCCAGG - Intergenic
1136574032 16:31112665-31112687 TCTTACCTGCCCTGAGAGCCTGG + Intronic
1137780303 16:51092543-51092565 GCTTAACTGACAGGAGGGGCCGG + Intergenic
1138471872 16:57244690-57244712 GCTTTCCTTCCACGAGGGGTAGG + Intergenic
1139505074 16:67394593-67394615 GCTTAGCTGGGCCGAGAGGCCGG - Exonic
1142058891 16:88017267-88017289 GAATACCTCCCACGAGGGGCCGG - Intronic
1143530551 17:7500713-7500735 GCTTGCCTGTCCACAGGGGCCGG - Exonic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1149048905 17:52281209-52281231 GCCTCCCTGCCCTGAGTGGCTGG + Intergenic
1150638672 17:66934405-66934427 TCTTACCTGCCCAGAAGTGCAGG - Intergenic
1151871305 17:76838717-76838739 ATTTTCCTGCGCCGAGGGGCTGG + Intergenic
1152139420 17:78527641-78527663 GCTTAGCGGTCCCCAGGGGCAGG - Intronic
1152551914 17:81034510-81034532 TCCTCTCTGCCCCGAGGGGCCGG + Intergenic
1159940959 18:74408131-74408153 ACTTACCTGCCCCTATGGGCAGG + Intergenic
1163594555 19:18213484-18213506 CCTTGCCTGCCCCCAGGTGCTGG - Exonic
1164941828 19:32256761-32256783 GCTCACCTTCCCCGAGGAGAGGG - Intergenic
1165062968 19:33213874-33213896 GCTTTCCTGCACCCAGGGGTGGG + Intronic
1166871634 19:45874368-45874390 GCTTACTTGCCCTGGGTGGCTGG + Intergenic
1167294032 19:48639123-48639145 GCCCACCTGCTCCCAGGGGCGGG - Intronic
927694846 2:25232642-25232664 GCCCACCTGGCCCGAGGGGTGGG + Exonic
928086840 2:28351207-28351229 GCTTACCTGCCCCCTCTGGCAGG + Intergenic
931839145 2:66130258-66130280 GCTCTCCTGCACCGTGGGGCAGG + Intergenic
932567164 2:72917460-72917482 GCTCACCTGCCCCAAGGTGGGGG - Exonic
933707002 2:85298817-85298839 CCTCAGCTGCCCCCAGGGGCAGG - Intronic
934933369 2:98445950-98445972 GTTTAAATGCCCTGAGGGGCAGG - Intronic
937128361 2:119488713-119488735 GCTTGGCTGCACCGAAGGGCTGG + Intronic
938145888 2:128834725-128834747 GCCTGCCTGCCCTGAGAGGCAGG - Intergenic
946268307 2:218568172-218568194 CCTTACCTGCGCCGAGGGTCCGG + Exonic
947589722 2:231378752-231378774 GCTTATAGGCCCTGAGGGGCAGG + Intergenic
948206132 2:236163762-236163784 GGGTACCTGCCCCGAGCAGCAGG + Intergenic
1169068028 20:2705499-2705521 GCCTGCCTGGCCCGAGGCGCTGG + Intronic
1170137167 20:13087367-13087389 CCTTTCCTGCCCAGAGGGTCAGG - Intronic
1170150472 20:13221625-13221647 GCTTCCCGGGCCCGCGGGGCTGG - Intergenic
1170938159 20:20827491-20827513 CCTTTCCTGCCCCGAAGGACAGG - Intergenic
1171011938 20:21513729-21513751 GCTCCCCTGCCCCGGCGGGCGGG + Exonic
1171212538 20:23327857-23327879 ACTTTCCTGCCCCGTGGCGCTGG - Intergenic
1171294395 20:24004875-24004897 GCTTATCTGTCCCGAGGGGAGGG - Intergenic
1173777430 20:45722268-45722290 GCTCACCTACCCCAAGGGCCAGG - Intergenic
1175811565 20:61861169-61861191 GCTTCTCTGCACCCAGGGGCAGG + Intronic
1175895241 20:62333129-62333151 GCTGAGCTGCTCCGTGGGGCAGG + Exonic
1176080974 20:63272904-63272926 GCTTACCTGGAGGGAGGGGCGGG - Exonic
1177011157 21:15730868-15730890 AATTACCTGCCTCGCGGGGCAGG + Intronic
1180832676 22:18913885-18913907 GCTTCTCTGCCCTGTGGGGCAGG - Intronic
1181067186 22:20312509-20312531 GCTTCTCTGCCCTGTGGGGCAGG + Intergenic
1183161718 22:36118095-36118117 TTTTACCTGCCACGAGGGCCAGG + Intergenic
1183408645 22:37642452-37642474 CCTCCCCTGCCCCAAGGGGCTGG + Intronic
1184797973 22:46742711-46742733 GCTTACCAGCACCCAGGGGAGGG + Intergenic
1184980230 22:48090434-48090456 GCTTAGCAGCCCCAAGGGGGAGG - Intergenic
1185368057 22:50445973-50445995 GGTGACCTGGCCAGAGGGGCTGG - Exonic
1203282761 22_KI270734v1_random:139190-139212 GCTTCTCTGCCCTGTGGGGCAGG - Intergenic
952241041 3:31532240-31532262 GCTGAGCTGGGCCGAGGGGCGGG - Intergenic
953198219 3:40753903-40753925 GCTTTCATGCCCCTAGAGGCTGG - Intergenic
953694361 3:45146200-45146222 ACTCACCTGCCCCGCGCGGCAGG + Exonic
953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG + Exonic
968912621 4:3483850-3483872 CCTTGCCTGCCCCCAGGGCCTGG + Intronic
969615076 4:8247474-8247496 GCTATCCTCCCCAGAGGGGCTGG - Intergenic
972982595 4:44724152-44724174 GGTTACCTGCCCCCAGACGCAGG + Intronic
974576377 4:63728900-63728922 GCTTGCCTGGCTCAAGGGGCAGG + Intergenic
996948138 5:129094602-129094624 TCTTACCCGCCCCGGAGGGCGGG - Intergenic
997432524 5:133850607-133850629 GCTTACCTACCCCCGGGGGAAGG - Intergenic
997778295 5:136630928-136630950 GGTTACCTGCCCTTATGGGCTGG - Intergenic
1001517386 5:172365489-172365511 GCTCTCCTTCCCCGAGGGCCTGG + Intronic
1002065210 5:176648238-176648260 GCTGACCTGCCAGGAGGGGCAGG + Intronic
1019600458 7:1880718-1880740 GCTTGCCTGCCCTCAGGGGCCGG - Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1024624368 7:51192029-51192051 GCTCACCTGCCCTGAGAAGCAGG + Intronic
1026596793 7:71739652-71739674 CCTCACCTGCCCCCAGGGGCCGG + Intergenic
1034347685 7:150397285-150397307 GGTCTCCGGCCCCGAGGGGCCGG + Exonic
1034440043 7:151081705-151081727 GATTTCCAGCCCGGAGGGGCCGG + Exonic
1034574889 7:151988173-151988195 TCATACCTGCCCCCAGGGGAGGG - Intronic
1035349817 7:158238105-158238127 ACTTAGCCGCCCCGAGAGGCAGG - Intronic
1035535244 8:386126-386148 CCTGAGCTGCCCCCAGGGGCAGG + Intergenic
1035980111 8:4360788-4360810 GATTACGAACCCCGAGGGGCCGG - Intronic
1047376463 8:124301687-124301709 CCTTACCCGCGCCGAGGTGCCGG + Intergenic
1049574881 8:143385369-143385391 GCACAGCTGCCCCGAGGGGCCGG + Intergenic
1050598971 9:7231625-7231647 GCTTACCTGCACAGAGTGGTGGG - Intergenic
1050598991 9:7231718-7231740 GCTTACCTGCACAGAGTGGCGGG - Intergenic
1050599001 9:7231749-7231771 GCTTACCCGCACAGAGCGGCGGG - Intergenic
1053411604 9:37919502-37919524 GCAGACCAGCTCCGAGGGGCGGG - Exonic
1056355055 9:85792175-85792197 ACTTGCCTGCCTTGAGGGGCTGG + Intergenic
1060044084 9:120326233-120326255 GCGTCCCTGCCCCAAGAGGCTGG + Intergenic
1060685191 9:125603842-125603864 GATAACCTGCCCCGAGAGGTGGG + Intronic
1061208317 9:129176946-129176968 GCTCACCAGCCCCGAGAAGCCGG + Exonic
1185548675 X:966512-966534 GCTCACCTGCCTGGTGGGGCTGG + Intergenic
1185987641 X:4853568-4853590 GCTTACTTAATCCGAGGGGCTGG + Intergenic
1191870055 X:65738236-65738258 GCATACTTGCCAAGAGGGGCAGG + Intronic
1192118618 X:68434014-68434036 GCGCACCTGCCCCTTGGGGCCGG - Intergenic
1192795258 X:74420776-74420798 GATTGACTGCCCGGAGGGGCGGG + Intergenic