ID: 953867274

View in Genome Browser
Species Human (GRCh38)
Location 3:46595296-46595318
Sequence TGATGAACAAAGTGTCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953867274_953867277 -6 Left 953867274 3:46595296-46595318 CCCTGATGACACTTTGTTCATCA 0: 1
1: 0
2: 1
3: 27
4: 216
Right 953867277 3:46595313-46595335 TCATCAGGAGATAACATAAAAGG 0: 1
1: 0
2: 3
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953867274 Original CRISPR TGATGAACAAAGTGTCATCA GGG (reversed) Intronic
901781621 1:11598245-11598267 TGAAGGCCAAAGTGTCAGCAGGG + Intergenic
903627399 1:24741434-24741456 GGAGGAGGAAAGTGTCATCAAGG + Intergenic
904417216 1:30370666-30370688 TGATAATCAAAGTGTCTGCAAGG + Intergenic
904505281 1:30947843-30947865 TGATTAACCAAGTGTCAGAAGGG + Intronic
905500040 1:38429032-38429054 TAATAAATAAAGTGTGATCAGGG - Intergenic
908053781 1:60260799-60260821 TGATGGAGAAAGTGTCATGATGG + Intergenic
908221531 1:62011757-62011779 TACTGAAAAAAGTGTCATAAGGG + Intronic
909014999 1:70371362-70371384 CGATAAACCAAGTGTGATCAGGG - Intronic
910221104 1:84890160-84890182 TGAGGAACAAAGGATCATCAAGG + Intronic
911071433 1:93834947-93834969 CGATAAACCAAGTGTAATCAGGG - Intronic
911316919 1:96366918-96366940 TGTTGACCAAAATGTCATTATGG - Intergenic
912415856 1:109508048-109508070 TGATGATCAAGGTGTCACCCAGG + Exonic
915069329 1:153253063-153253085 TGCTTAAAAAAGTGACATCATGG - Intergenic
917880607 1:179331974-179331996 TTATGAAGAAATTGTGATCAAGG + Intronic
918174122 1:182028594-182028616 CGATGATCAAAATGTCATTATGG + Intergenic
918216976 1:182400300-182400322 TGAGGAAGCAAGTGCCATCAAGG - Exonic
918749077 1:188248076-188248098 CTATAATCAAAGTGTCATCAGGG + Intergenic
919418966 1:197347390-197347412 TGACCAACAAAGAGGCATCAAGG - Exonic
919649496 1:200132527-200132549 TGATTAATAAAATGTAATCAAGG - Intronic
921795477 1:219338832-219338854 TTATGAATTAAGTGCCATCATGG + Intergenic
923956519 1:239028636-239028658 TTATGAAGACAATGTCATCAAGG - Intergenic
1063990486 10:11556031-11556053 TGATGGACAAACAGTCATGAAGG + Intronic
1064424800 10:15221183-15221205 AGATGGCCAAAGTGTCATCTAGG + Intronic
1065355959 10:24842088-24842110 TGGTGAACACAGTGCCATGAAGG - Intergenic
1067275101 10:44827070-44827092 CCAAGAACAAAGTGTCAGCAGGG - Intergenic
1069015234 10:63421877-63421899 TCAAGATCACAGTGTCATCAGGG - Intronic
1069186897 10:65434862-65434884 TGATGGACATAATGTCATAAAGG - Intergenic
1069936999 10:71924417-71924439 AGATGAACAAGGTGTGAGCAGGG - Intergenic
1070056062 10:72935703-72935725 TGTTGAACACAGTGTCAACCAGG + Exonic
1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG + Intergenic
1071273654 10:84032007-84032029 CCATGATCAAAGTGTCATCAGGG - Intergenic
1072474324 10:95744924-95744946 TGATTACCAAAGATTCATCAGGG - Intronic
1072490889 10:95905270-95905292 TGATGACAAAATAGTCATCAAGG + Intronic
1073698690 10:105899966-105899988 TAATGAAAAAAATTTCATCACGG + Intergenic
1073997587 10:109333449-109333471 TACTGCACAAAGTGTCATCCAGG - Intergenic
1074174205 10:110979682-110979704 AGATGAAGAAAATGTTATCATGG - Intronic
1080261475 11:30353933-30353955 TGAGGAAGACAGTGTGATCAAGG + Intergenic
1088685807 11:112283750-112283772 TGAATAAGAAAGTGTCCTCAGGG - Intergenic
1089390147 11:118096116-118096138 TCATGAACAAAATGTCATCATGG + Intronic
1089627321 11:119759673-119759695 TGTTGAACAAAGTGGGTTCATGG - Intergenic
1092896624 12:13018053-13018075 TCAAGATCAAAGTGTCAGCAGGG + Intergenic
1093181155 12:15968329-15968351 TGATGAATAAAGTGTTATTCTGG + Intronic
1096968070 12:55644395-55644417 TGATGACCACAGTGGCATCCAGG + Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1098717256 12:73845959-73845981 TGATGTAAAAAGAGTGATCAAGG + Intergenic
1099922441 12:88975977-88975999 TGTTGATCAAAATGTCATTATGG + Intergenic
1099952016 12:89314268-89314290 TGGTAAACAGAGTGTCATAAAGG + Intergenic
1102299970 12:111764264-111764286 TGATGAAAACAGTGTCATACTGG + Intronic
1104424181 12:128661117-128661139 TCATGGACAAACTGTCATGAAGG + Intronic
1106365809 13:29079681-29079703 TGGTGAACTAAATTTCATCAAGG - Intronic
1109661044 13:65461191-65461213 TGCTGAAAAAAAGGTCATCAGGG - Intergenic
1110395870 13:75029110-75029132 TAAGGAACAAAATGTCTTCAGGG + Intergenic
1110630514 13:77700584-77700606 TGATGAAGAAAATATCAACAGGG + Intronic
1112050207 13:95637732-95637754 TGAAGATCAAGGTGTCAACAGGG - Intronic
1116006705 14:39299965-39299987 TGATAAAGAAAGTCACATCAAGG + Exonic
1116964796 14:51002560-51002582 AGATGAACAAATGTTCATCATGG + Intronic
1119108603 14:71948406-71948428 TGATGCAAAAAATGACATCATGG - Intronic
1120224881 14:81779346-81779368 TGATCAAGAAAGCCTCATCAGGG - Intergenic
1122507935 14:102243793-102243815 GGATAAACCAAGTGTGATCAGGG - Intronic
1124484361 15:30102110-30102132 TGGAGAACACAGTGGCATCAGGG + Intergenic
1124519222 15:30395114-30395136 TGGAGAACACAGTGGCATCAGGG - Intergenic
1124539434 15:30571107-30571129 TGGAGAACACAGTGGCATCAGGG + Intergenic
1124582065 15:30965545-30965567 TGATGAAAACAGAGTCCTCATGG + Intronic
1124759216 15:32436465-32436487 TGGAGAACACAGTGGCATCAGGG - Intergenic
1125279463 15:38028195-38028217 TGATGAAGAAAGTGAAAACAGGG - Intergenic
1126952355 15:53894923-53894945 TGTGGAACAAATTGTGATCAAGG - Intergenic
1128185928 15:65643502-65643524 TGAAGAACAAAGTGGTGTCATGG - Intronic
1129186353 15:73909487-73909509 TGAAGGACAGAGTTTCATCAGGG + Intergenic
1130234152 15:82118500-82118522 TGTTGACCAAAATGTCATTATGG - Intergenic
1130745278 15:86646744-86646766 TGATGAAAATAATGTGATCAAGG - Intronic
1131340662 15:91597805-91597827 TGATTAACCAAGTCTCATCCAGG - Intergenic
1131561316 15:93443724-93443746 TCAAGAACAAAATGTCAGCAGGG - Intergenic
1133917728 16:10124467-10124489 GGATAAACAAAGAGTTATCAAGG - Intronic
1134762812 16:16729034-16729056 TGAAGATCAAGGTGTCAGCAGGG - Intergenic
1134983240 16:18630114-18630136 TGAAGATCAAGGTGTCAGCAGGG + Intergenic
1136357727 16:29757112-29757134 TGATGAGCAAAATTACATCAAGG - Intergenic
1136495909 16:30643962-30643984 TGATGAACAATGTGACTTTAAGG - Intergenic
1137009698 16:35310419-35310441 TGATGTCCAAATTGCCATCATGG - Intergenic
1137055049 16:35741395-35741417 TGATAAACTAAGTGTAATCAGGG + Intergenic
1137236065 16:46619432-46619454 AGATGACCAAAGTGTACTCAAGG + Intronic
1140519349 16:75567944-75567966 TGATGAACAGAGTGTGGGCAAGG - Intronic
1141113993 16:81292889-81292911 TGATAAAAAAAGTGACATGAGGG - Intergenic
1146629890 17:34462340-34462362 TGAGGAAAACAGGGTCATCAAGG + Intergenic
1149291259 17:55219653-55219675 TCATGAACACACTGTCATCATGG - Intergenic
1150642529 17:66959149-66959171 TGATGATCAAAGTCACATGAGGG - Intergenic
1151090126 17:71429472-71429494 TGATGAATAAAATCTTATCATGG + Intergenic
1155091870 18:22519884-22519906 TGATGACCAAATTGCCATCATGG - Intergenic
1159237343 18:65693555-65693577 TGCTAAGCAAAGTATCATCAAGG + Intergenic
1159758187 18:72391674-72391696 CGATTAGCATAGTGTCATCAAGG - Intergenic
1162597779 19:11642075-11642097 TGATGAGCCAAGTGTCCCCAAGG - Intergenic
1162850593 19:13428396-13428418 TGTTGACCGATGTGTCATCAGGG + Intronic
1164220321 19:23187429-23187451 TAATAAACAAAATGTGATCAGGG - Intergenic
1164248910 19:23459714-23459736 TGTGGAACAAAATGTCACCACGG + Intergenic
1165644871 19:37426958-37426980 TAAAAAACAAATTGTCATCAGGG - Intronic
926242647 2:11100341-11100363 TGAGGAACAGAGTGACCTCAAGG + Intergenic
929832951 2:45363635-45363657 TTGTGAACAAAGTATAATCATGG - Intergenic
930417170 2:51103546-51103568 CGGGGATCAAAGTGTCATCAGGG - Intergenic
932396123 2:71449620-71449642 TCAAGATCAAAGTGTCATCAGGG + Intergenic
936337441 2:111602539-111602561 CCAGGAACAAAGTGTCAACAGGG + Intergenic
938603121 2:132863597-132863619 TGATGAACAGAGAGTTCTCAGGG - Intronic
939098837 2:137870842-137870864 TGATTAACAAAGTTTCAGGATGG + Intergenic
939707866 2:145478030-145478052 TAATAAACAAAATGTCAACATGG + Intergenic
940086808 2:149868707-149868729 TGTTTAGCAAAATGTCATCAAGG - Intergenic
940159134 2:150692810-150692832 TGAAAAACAAAGTGCCAGCATGG - Intergenic
940183227 2:150957009-150957031 TGATAAACCAAGTGTGATCAGGG - Intergenic
940595836 2:155791570-155791592 TGATGACAGAAGTGTCATTAAGG - Intergenic
940666828 2:156619020-156619042 TAATGAAGAAGGTGTCCTCATGG - Intergenic
940722373 2:157296358-157296380 TGAAAAACAAAGTGTTATCTGGG - Intronic
941724601 2:168847681-168847703 ATATGAACAAAGTGTGGTCAAGG - Intronic
943028271 2:182655152-182655174 TAGTGAATGAAGTGTCATCAGGG + Intergenic
943728550 2:191277355-191277377 AGATTAACAAAGTCTAATCAGGG + Intronic
944251348 2:197582445-197582467 CGATAAACCAAGTGTGATCAGGG - Intronic
948036212 2:234860199-234860221 TGATAAACAAAATGTCATATTGG + Intergenic
948369463 2:237478981-237479003 TGGTGAAGAAAGTGTCCTCTGGG + Intergenic
1170806306 20:19635416-19635438 TGATGAAGAAGGAGTAATCAGGG + Intronic
1172153351 20:32806185-32806207 TGGAGAACAAAATGACATCATGG - Intronic
1173313702 20:41924323-41924345 TATTGAACAAAGTGCCTTCACGG - Intergenic
1176685911 21:9848368-9848390 TGATAAACCAAGTGTGATCAGGG - Intergenic
1177453843 21:21308591-21308613 TGATGAAGAAAGCTTCACCAAGG - Intronic
1178136327 21:29631471-29631493 CCATGATCAAAGTGCCATCATGG - Intronic
1178771893 21:35512826-35512848 TGATGTACAAAATGCCATTATGG + Intronic
1178853802 21:36234265-36234287 TGATTAAGCAAGTGTCATCTTGG + Intronic
1183636511 22:39066650-39066672 TGATAAACCAAGTGTGATCAGGG + Intronic
1184941078 22:47765691-47765713 TGAAGACCAAGGTGTGATCAGGG - Intergenic
949103989 3:181415-181437 TGAAGAAAGAAGTGTCATAAAGG - Intergenic
949749195 3:7331295-7331317 TGATCAAAAGAGTGTCATGATGG + Intronic
951807188 3:26658680-26658702 TGATGAAAAAATTGCAATCAGGG + Intronic
952164788 3:30735681-30735703 TGATGAACACTGTGTCATGGCGG + Intronic
953036769 3:39218735-39218757 TGAAGTACAAAGTGTGATCCTGG - Intergenic
953867274 3:46595296-46595318 TGATGAACAAAGTGTCATCAGGG - Intronic
954154688 3:48678946-48678968 TGCTGACCAGAATGTCATCATGG - Exonic
955137448 3:56233692-56233714 TTATAAGCAAAGTGTCAACAGGG + Intronic
956090756 3:65664143-65664165 TGCTGAACAAATTGTCACCTAGG + Intronic
957310843 3:78516706-78516728 CTAAGATCAAAGTGTCATCAGGG + Intergenic
957850035 3:85796117-85796139 TGATCATCAAAATGTCATCTGGG + Intronic
958422253 3:93942088-93942110 CGATAAACCAAGTGTGATCAGGG - Intronic
960309864 3:116107068-116107090 TGATAAATCAAGTGTGATCAGGG + Intronic
960976524 3:123180621-123180643 TTATGAGCTAAGTGTCATAAGGG + Intronic
962046829 3:131769167-131769189 TGATGAATGAAGTGTATTCAAGG - Intronic
963520732 3:146357729-146357751 CAATAAACAAAGTGTGATCAGGG - Intergenic
964257322 3:154790702-154790724 TGAAGGACAGAGTGTCCTCATGG - Intergenic
967551770 3:190803605-190803627 TCATGACTAAAATGTCATCAAGG + Intergenic
967615088 3:191555304-191555326 TGCTGAAAAAACTGTCATTAAGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
973699661 4:53524212-53524234 TAATGACCATAGTGCCATCAAGG - Intronic
974206547 4:58709973-58709995 TGATCAACAAAGTTGCTTCATGG + Intergenic
974755044 4:66193969-66193991 TGTTGAACAAAAGGTCATTATGG - Intergenic
976494980 4:85717741-85717763 TTAAGAACAGAGTGTCATAAGGG - Intronic
977051931 4:92139111-92139133 TCATGAAGAAAATGTCAACAGGG + Intergenic
977770448 4:100851519-100851541 TATTGCACAAAGTGCCATCAAGG - Intronic
978017003 4:103756828-103756850 TGAACATCAAAGTGTCACCAGGG + Intergenic
978646650 4:110940797-110940819 TTATGAAAACAGTGTTATCATGG + Intergenic
979920340 4:126489264-126489286 TAATGAACAAAGTGGCAATAAGG - Intergenic
982405047 4:155010092-155010114 TTATGAACTAAAGGTCATCAAGG - Intergenic
983653932 4:170061524-170061546 TGAAGAAAAAAGTATCAGCAAGG - Intronic
985627390 5:996439-996461 TGAAAAACAAAGTCTCATGATGG - Intergenic
986070046 5:4273726-4273748 TAAAGAACAAAGTCTTATCAAGG - Intergenic
986457551 5:7934306-7934328 TCATGAACAAAGCCTCAACAGGG + Intergenic
986792668 5:11178566-11178588 TGATTAACAATGCGTCATAATGG + Intronic
987905119 5:24066890-24066912 TGATGATCAAAGTGTTTTTATGG + Intronic
990101134 5:52188762-52188784 TGATAGACAAAGTGTCAGCAGGG - Intergenic
992210089 5:74470524-74470546 TGATGAAAAAAATGTCAAGAAGG + Intergenic
992301757 5:75389212-75389234 AGAGAAACAAAGTGTCATCTAGG + Intronic
992795235 5:80249929-80249951 TGTTCAAAAAAGTATCATCATGG + Intronic
993628211 5:90251692-90251714 CGATGAACAAAGAGCCATTATGG - Intergenic
993981107 5:94544769-94544791 TGATGTACAGAGTGTCAGGAAGG + Intronic
994733997 5:103529474-103529496 TGATGAACCAGGTGTCAAAAAGG + Intergenic
995296929 5:110533795-110533817 TAATAAACTAAGTGTGATCAGGG - Intronic
996725621 5:126671492-126671514 CGATAAACCAAGTGTGATCAGGG + Intergenic
997263244 5:132479530-132479552 TGATGAGATAACTGTCATCAAGG - Intergenic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
998652537 5:144137105-144137127 TGATGAACAAAATATCAAAAAGG + Intergenic
1001034215 5:168285588-168285610 TGTTGAACATACTGTCTTCAGGG + Intergenic
1001272527 5:170325787-170325809 TGTTGAACAAGATGTCAACATGG + Intergenic
1003168328 6:3700657-3700679 GGATGAACAAAGTTGCATGAAGG + Intergenic
1004656161 6:17663552-17663574 TTTTGAACATAGTGTGATCATGG - Intronic
1005815833 6:29552110-29552132 TGTTGAACCAAGTGTCTTAATGG - Intergenic
1008153560 6:47987107-47987129 TAATGAACAAATTGTCACCTAGG + Intronic
1009464637 6:63954216-63954238 TGATAAACCAAATGTGATCAGGG - Intronic
1009537208 6:64903371-64903393 TGAGGAACAAAGAGTCATTCAGG + Intronic
1009955149 6:70444772-70444794 TGATGAACAAATGGTATTCAGGG + Intronic
1011338749 6:86288485-86288507 TGATGAAAAAAATGTCATGTTGG + Intergenic
1011452529 6:87510099-87510121 AGATGAAGAAAGTGTCACCCAGG - Intronic
1013759856 6:113505348-113505370 TGATGACCAAAATGTCATTATGG + Intergenic
1014641611 6:123917667-123917689 TGATGAACAGAGTGACAGTATGG - Intronic
1016204816 6:141456987-141457009 CAATAAACAAAGTGTGATCAGGG - Intergenic
1016305648 6:142681005-142681027 TGATGAACAAACTGTGACCCTGG + Intergenic
1016315064 6:142775995-142776017 TGATTAATAAAATGACATCAAGG + Intronic
1018077855 6:160232280-160232302 TGATAAACCAAGTGTGATCAGGG - Intronic
1018136016 6:160779050-160779072 TGATAAACCAAGTGTGATCAGGG - Intergenic
1021237218 7:18156650-18156672 TGAAGAACATAGTCTCATCATGG + Intronic
1022196108 7:28068960-28068982 TGTTGTACAAAATGTGATCAAGG + Intronic
1022334033 7:29406052-29406074 TGATGAGCACAGAGTCACCACGG - Intronic
1028579627 7:92394693-92394715 TGATGACTTAAGTGTCGTCAAGG - Intronic
1028897977 7:96063491-96063513 TCAAGATCAAGGTGTCATCAGGG + Intronic
1032952965 7:136937878-136937900 TCATGCAAAAAATGTCATCATGG - Intronic
1034328349 7:150258622-150258644 TGAGAAAAAAACTGTCATCATGG + Intronic
1034764865 7:153710842-153710864 TGAGAAAAAAACTGTCATCATGG - Intergenic
1035012723 7:155733851-155733873 TTAAGAACAAAGTCTCAGCATGG - Intronic
1035117655 7:156537908-156537930 TGAGGAACAGAGTCACATCAGGG + Intergenic
1037578937 8:20233342-20233364 TGAAAATCAAAGTGTCAGCAAGG - Intergenic
1038269751 8:26065585-26065607 TCATGAACAGAGTGTCCTCTGGG + Intergenic
1038915080 8:32012375-32012397 TTAGGAACACAGTGACATCAAGG + Intronic
1040729776 8:50429862-50429884 AAATGAACAAAGTGCCATCAGGG + Intronic
1041625552 8:60022140-60022162 TGGTGAAAGCAGTGTCATCAAGG - Intergenic
1041943834 8:63419882-63419904 TGGAGAACAAAGTCTCATCAAGG - Intergenic
1043638165 8:82412771-82412793 TGATGATTAAAATGTCATCATGG - Intergenic
1044031099 8:87238473-87238495 TGATACACAAAATGTCATCATGG - Intronic
1045267136 8:100628861-100628883 TGTTGACCAAAATGTCATTAAGG - Intronic
1045321746 8:101086956-101086978 TCATGATCAAGGTGTCAGCAGGG + Intergenic
1045440829 8:102208728-102208750 TAATCAACAAATTGTCATTAAGG + Intronic
1045541562 8:103091329-103091351 TGATGATTAAAGTGTAATCATGG - Intergenic
1047858193 8:128935723-128935745 TGAAGAACAAAATGTTACCAAGG - Intergenic
1048559613 8:135519519-135519541 TAGTGACCAAAGTTTCATCAAGG + Intronic
1050059987 9:1698107-1698129 TGGTTAACATAGTGTCATCAAGG - Intergenic
1051106063 9:13581622-13581644 TGATGAACAACAGGTCACCATGG + Intergenic
1051497575 9:17741903-17741925 TGATGGAGAAGGTGTCATCTGGG + Intronic
1051708944 9:19910359-19910381 TGATGAACAAAAGGTGATTAAGG - Intergenic
1051860041 9:21614348-21614370 TCCTGGACAAAGTGTCATCTTGG + Intergenic
1052460896 9:28761583-28761605 TGAAGAAGATAATGTCATCATGG + Intergenic
1052473548 9:28930082-28930104 TGAAGAACAAAGTGTGAAAAGGG - Intergenic
1053512274 9:38698153-38698175 TGATGGACAAAATGTTAACATGG + Intergenic
1053783405 9:41633230-41633252 TGATAAACCAAGTGTGATCAGGG + Intergenic
1054171359 9:61843372-61843394 TGATAAACCAAGTGTGATCAGGG + Intergenic
1054666175 9:67737440-67737462 TGATAAACCAAGTGTGATCAGGG - Intergenic
1056082423 9:83109717-83109739 TGATTAACAAATTGTCAGCATGG - Intergenic
1057004833 9:91547979-91548001 TCATGAACAAAGTGTCATGGTGG - Intergenic
1058612683 9:106792517-106792539 CAATAAACTAAGTGTCATCAGGG - Intergenic
1059670584 9:116487660-116487682 ATATGAACAAAGAGTCATCAAGG - Intronic
1060275093 9:122176457-122176479 TGTTGAAATAAGTGTCATGAAGG - Intronic
1062058140 9:134479574-134479596 TGATGAAGACAGTGCCATGAGGG - Intergenic
1186515353 X:10162816-10162838 TGATCTTCAAAGTGTCATCTGGG - Intronic
1187983229 X:24782104-24782126 AGATGAACAAATTGGCATTAGGG - Intronic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1188632744 X:32387857-32387879 TGATGAAGAAAGTTCCCTCAAGG + Intronic
1189202171 X:39205719-39205741 TGATTAACAAAGTGGGATGAGGG + Intergenic
1190393807 X:49959530-49959552 TGGAGAAAACAGTGTCATCAAGG - Intronic
1194630876 X:96281744-96281766 TCATCAACAAACTGTCACCATGG - Intergenic
1195587812 X:106585899-106585921 TGGTGAAGAAAGTGTCATTTGGG - Intergenic
1195811758 X:108841270-108841292 TGTTTAACAAAGTGTCCTCCAGG + Intergenic
1195998758 X:110759018-110759040 ACATGAACAAAGTGTCATTGAGG + Intronic
1197023520 X:121718387-121718409 TGATGGACAAAATGTCTCCAGGG - Intergenic
1200799073 Y:7369251-7369273 TGATCAACTAAGGGTAATCAGGG + Intergenic
1201233994 Y:11892664-11892686 TAATAAACCAAGTGTGATCAGGG + Intergenic
1201958863 Y:19656646-19656668 AGCTGAACATAGTGTCACCATGG + Intergenic