ID: 953867737

View in Genome Browser
Species Human (GRCh38)
Location 3:46598895-46598917
Sequence TGGCATAGGCTGACCAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953867737_953867741 1 Left 953867737 3:46598895-46598917 CCTGGTCTGGTCAGCCTATGCCA 0: 1
1: 0
2: 0
3: 4
4: 95
Right 953867741 3:46598919-46598941 AAAAGCAGCCAAGTGAAGGCTGG 0: 1
1: 1
2: 4
3: 38
4: 365
953867737_953867743 14 Left 953867737 3:46598895-46598917 CCTGGTCTGGTCAGCCTATGCCA 0: 1
1: 0
2: 0
3: 4
4: 95
Right 953867743 3:46598932-46598954 TGAAGGCTGGAAACACCGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 121
953867737_953867740 -3 Left 953867737 3:46598895-46598917 CCTGGTCTGGTCAGCCTATGCCA 0: 1
1: 0
2: 0
3: 4
4: 95
Right 953867740 3:46598915-46598937 CCAGAAAAGCAGCCAAGTGAAGG 0: 1
1: 0
2: 3
3: 18
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953867737 Original CRISPR TGGCATAGGCTGACCAGACC AGG (reversed) Intronic
903540705 1:24094677-24094699 TGGCATGATCTGACCACACCTGG + Intronic
905458042 1:38101978-38102000 TGGCATAGACTGATCAAAGCAGG - Intergenic
907112178 1:51936139-51936161 TCGGAGAGGCTGAGCAGACCAGG - Intronic
907345732 1:53778055-53778077 TGGCAAAAGCTGACCTGACTTGG + Intronic
907762415 1:57374641-57374663 GGGCAGAGGCTGAAGAGACCAGG - Intronic
909785937 1:79613374-79613396 TAGCATAGACTGACCATACTGGG + Intergenic
911281364 1:95933352-95933374 GGGCATGGGCAGACAAGACCTGG + Intergenic
912238639 1:107881160-107881182 TGGCATAGGAAGACAAGACAAGG + Intronic
920178413 1:204117521-204117543 TGCCATGGGCTGACCATAGCTGG + Intronic
921924931 1:220703532-220703554 GGCCATAGGCTGACCAGAAGGGG - Intergenic
1073099324 10:100998627-100998649 AGGCATCAGCTGACCTGACCGGG + Intronic
1074134578 10:110615545-110615567 TGTGACAGACTGACCAGACCTGG - Intergenic
1076235585 10:128861544-128861566 TGGGACAGGATGACCAGGCCAGG + Intergenic
1076444183 10:130500618-130500640 GTGCATAGGCTGACCAAACCTGG + Intergenic
1081319501 11:41674051-41674073 TGGCATAGGCTAACCAGAAGTGG - Intergenic
1084720050 11:70899685-70899707 TGGCTCAGCCTGAGCAGACCAGG - Intronic
1090762364 11:129848640-129848662 TGGAATATGCTGTGCAGACCAGG + Intronic
1091239764 11:134044550-134044572 TGGCATAGTCTGAGGAGCCCTGG + Intergenic
1092024966 12:5232647-5232669 TGGCATGGGCTGCGCAGGCCTGG - Intergenic
1096965819 12:55626734-55626756 TGGCATAGCCAGACCAGCCTTGG + Intergenic
1102644789 12:114396819-114396841 AGGCATTGGCTGACCCGCCCTGG - Intronic
1104919853 12:132285109-132285131 TGGGGCAGGCTGACCACACCAGG + Intronic
1106209980 13:27633096-27633118 AGGCAAAGGGTGACCAGAGCAGG + Intronic
1114171566 14:20277966-20277988 TGGCAGATGCCAACCAGACCAGG - Intronic
1114547698 14:23514408-23514430 TGGCATATACAGACCAGACAAGG - Intergenic
1128398569 15:67254298-67254320 TGGCCTGGGCTGAGCAGAGCGGG + Intronic
1128978437 15:72169508-72169530 TGGCACAGACTCACCTGACCTGG + Intronic
1129318617 15:74761534-74761556 AAGCAGAGGCTGACTAGACCAGG + Intergenic
1131345783 15:91646971-91646993 TAGCATAGGCTGAGCACACTTGG - Intergenic
1139601856 16:67992175-67992197 GCACATAGGCTGACCAGAACTGG + Exonic
1145797998 17:27667079-27667101 TGGCATGGACTGAGCAGCCCAGG - Intergenic
1147746127 17:42695716-42695738 GGGCACAGGCCGACCAGGCCGGG - Exonic
1151656807 17:75499961-75499983 GGGCAGAGGCTGAGGAGACCTGG - Exonic
1162743133 19:12784197-12784219 TGGCCCAGGGTGACCAGACAGGG + Intronic
1165994821 19:39836619-39836641 TGGCCCAGCCAGACCAGACCCGG - Exonic
1168578080 19:57530109-57530131 TGGCTTAGGGTGAGCAGACAAGG + Intronic
927856423 2:26530441-26530463 AGGCATGGACTGCCCAGACCCGG - Intronic
934793428 2:97081987-97082009 TGTCACAGGCTGGCCGGACCCGG - Intergenic
938369971 2:130762694-130762716 TGGCACAGGCCGTCCAGCCCCGG - Exonic
1169139341 20:3218295-3218317 TGGCACAGGCTGACGATACAAGG - Intronic
1170392888 20:15894472-15894494 TGTTATAGGATGAGCAGACCAGG + Intronic
1170917277 20:20639454-20639476 AGGAATAGGCAGAGCAGACCAGG - Intronic
1171349017 20:24488658-24488680 TGGCAAAGGCTGAACAAACGAGG - Intronic
1173328126 20:42052140-42052162 TGGCACAGACAGACCAGGCCTGG + Intergenic
1173800237 20:45890666-45890688 TGGCCCAGGTTGACCAGATCGGG + Exonic
1173983332 20:47241675-47241697 GGGCATAGGCTCACCTTACCGGG - Intronic
1174050335 20:47763220-47763242 TGGCAAAGGCTCGCCAGCCCAGG + Intronic
1176106955 20:63393965-63393987 TGGCAAATTCTGACCACACCTGG - Intergenic
1176151049 20:63590843-63590865 TGGCATCAGGTGAGCAGACCTGG - Intronic
1176309080 21:5140302-5140324 TGGCAGAGTCTGTCCACACCCGG + Intronic
1176327696 21:5516107-5516129 TGGCATGGACGGACCTGACCTGG + Intergenic
1176400061 21:6304844-6304866 TGGCATGGACGGACCTGACCTGG - Intergenic
1176437096 21:6684260-6684282 TGGCATGGACGGACCTGACCTGG + Intergenic
1176461358 21:7011330-7011352 TGGCATGGACGGACCTGACCTGG + Intergenic
1176484919 21:7393108-7393130 TGGCATGGACGGACCTGACCTGG + Intergenic
1179847981 21:44121731-44121753 TGGCAGAGTCTGTCCACACCCGG - Intronic
1180944009 22:19679747-19679769 TGGCCGAGCCTGACCAGAACCGG - Intergenic
1182573500 22:31256882-31256904 TGGCATGGGCTCAGCAGGCCAGG + Intronic
1182780214 22:32861572-32861594 TGAGAGAGGCTGACCACACCAGG - Exonic
1183695575 22:39420030-39420052 TGGCATGGGATGGACAGACCAGG + Intronic
952954754 3:38550084-38550106 GGGCATTGCCTGACCAGACCAGG + Exonic
953867737 3:46598895-46598917 TGGCATAGGCTGACCAGACCAGG - Intronic
954447372 3:50553917-50553939 TGGCATGAACTGACCAAACCAGG - Intergenic
962745561 3:138395325-138395347 TGGCATAGTCTGGCCAGGCGCGG - Intronic
967870704 3:194226699-194226721 TTGCATATTCTGACCAGAACAGG - Intergenic
969877187 4:10144499-10144521 GGCCATAACCTGACCAGACCAGG - Intergenic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
985520427 5:371634-371656 TGTCCTGGGCTGACCAGTCCTGG + Intronic
989608396 5:43268392-43268414 GGGATTGGGCTGACCAGACCAGG + Intronic
990696971 5:58429216-58429238 TGGCATTGGCTGAACATAACTGG + Intergenic
991570715 5:68050554-68050576 TGGTATAGGTTGACCAGAGAAGG - Intergenic
995718578 5:115105285-115105307 TACCATAGGCTAATCAGACCTGG + Intergenic
997392077 5:133525307-133525329 AGGCACAGGCTAACCAGACATGG - Intronic
998114106 5:139523578-139523600 TTGCCTAGGTCGACCAGACCTGG + Intergenic
998384870 5:141751199-141751221 TGGTCTAGGCTGACCAGAGGTGG - Intergenic
1002433663 5:179218779-179218801 TGGCTGAGGCTGAGCAGGCCTGG - Intronic
1010762125 6:79735431-79735453 TTGCATAGGCTGACCCCTCCCGG + Intergenic
1013280466 6:108631700-108631722 GGGCATATGCTTACCTGACCAGG + Intronic
1016212632 6:141558461-141558483 TGTCATATGCTGAACACACCTGG - Intergenic
1017129248 6:151093918-151093940 TGTCTTAGGCAGCCCAGACCTGG + Intronic
1019855807 7:3606255-3606277 TGGCAATGGTTGATCAGACCTGG - Intronic
1019983486 7:4638816-4638838 TGGAATAGAAAGACCAGACCAGG - Intergenic
1026322967 7:69283563-69283585 TGGCATGGGCTCACCAGTGCAGG - Intergenic
1027197049 7:76037810-76037832 TGGCTCAAGCTGACCAGCCCAGG + Intronic
1027979033 7:85193618-85193640 TGGGATAGGATGACCAGAAAGGG - Intergenic
1028671712 7:93408109-93408131 TGGCATGGGCTTACCTCACCCGG + Intergenic
1032047436 7:128621522-128621544 GGGCAGAGGCAGACCAGACAAGG + Intergenic
1034136935 7:148779557-148779579 CAGCATGGGCTGGCCAGACCAGG + Intronic
1049233057 8:141494217-141494239 TGGCTTAGACTGACTAGGCCAGG - Intergenic
1049523139 8:143105114-143105136 TGACATAAGCTGCCCAGGCCAGG + Intergenic
1052560472 9:30078000-30078022 TGACATAGCCTGATCAGACCAGG + Intergenic
1056128908 9:83564880-83564902 TGGCATAGGCTGACCAACTTGGG + Intergenic
1057335378 9:94151025-94151047 TGGGGAAGGCTGACAAGACCTGG - Intergenic
1057805442 9:98216541-98216563 TGCCATGGGCTGAACACACCTGG - Intronic
1062453561 9:136625482-136625504 GGGCAGAGACTGTCCAGACCAGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062534681 9:137016243-137016265 GGGCATCTGCTGACCAGAGCAGG - Intronic
1203434418 Un_GL000195v1:124403-124425 TGGCATGGACGGACCTGACCTGG - Intergenic
1189849945 X:45168226-45168248 TGGCTTAGGCTGATCAGTTCAGG + Intronic
1197750321 X:129959510-129959532 TGGCAAGGGCTGCCCAGCCCAGG - Intergenic