ID: 953868753

View in Genome Browser
Species Human (GRCh38)
Location 3:46607883-46607905
Sequence TCCTCTTTGTGTCCAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953868749_953868753 9 Left 953868749 3:46607851-46607873 CCATGGCTCTGTACGTAATTCGG 0: 1
1: 0
2: 0
3: 2
4: 21
Right 953868753 3:46607883-46607905 TCCTCTTTGTGTCCAGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 222
953868748_953868753 10 Left 953868748 3:46607850-46607872 CCCATGGCTCTGTACGTAATTCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 953868753 3:46607883-46607905 TCCTCTTTGTGTCCAGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 222
953868747_953868753 15 Left 953868747 3:46607845-46607867 CCAGTCCCATGGCTCTGTACGTA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 953868753 3:46607883-46607905 TCCTCTTTGTGTCCAGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 222
953868745_953868753 27 Left 953868745 3:46607833-46607855 CCTTTGCTAGAACCAGTCCCATG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 953868753 3:46607883-46607905 TCCTCTTTGTGTCCAGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953868753 Original CRISPR TCCTCTTTGTGTCCAGAAGA GGG Intronic
900424968 1:2573157-2573179 TCCCCTTTTTCTGCAGAAGAGGG - Intergenic
900483096 1:2908854-2908876 TCCTGGCTTTGTCCAGAAGAGGG + Intergenic
900713412 1:4129117-4129139 TCCTTCTGGTGTCCTGAAGACGG + Intergenic
901679022 1:10902489-10902511 AACTCTTTCTGTCCAGAAGACGG + Intergenic
902253644 1:15172833-15172855 TCGTCTCTTTGTCCAGCAGATGG + Intronic
903134348 1:21299573-21299595 ATCTCTTTGTATCCTGAAGAGGG - Intronic
903543821 1:24111314-24111336 TCCTCTTTCCCTCCTGAAGAAGG - Intronic
904840258 1:33367945-33367967 GCCTCCCTGTGTCCAGCAGAGGG - Intronic
904882052 1:33707791-33707813 TCCTTTTTATGTACAGATGATGG - Intronic
905456605 1:38092434-38092456 TCCTCTTCCTGTCAAGGAGAAGG - Intergenic
905489814 1:38334564-38334586 TGCTGATTGTCTCCAGAAGATGG + Intergenic
906274998 1:44508734-44508756 TCCACATAGTGACCAGAAGAGGG + Intronic
908533546 1:65056375-65056397 TCCTCTTTGGGTAGAGCAGAGGG + Intergenic
908843500 1:68301563-68301585 TCATCTTTGTCTCCAAAAGTAGG - Intergenic
909660462 1:78076297-78076319 TGCCCTTTGGGGCCAGAAGATGG - Intronic
909837168 1:80270686-80270708 CCCTATTTCTGACCAGAAGAAGG + Intergenic
909852588 1:80487229-80487251 TCCTCTTTGTGTCTAAACCAGGG - Intergenic
911368278 1:96966725-96966747 TGCTCATTCTGTCCAGCAGAGGG + Intergenic
914948602 1:152089422-152089444 TCCTCTGTCTGCCCACAAGATGG + Intergenic
915110510 1:153561804-153561826 TCCTCCCTGTGTCCAGGAGGAGG - Intronic
915964095 1:160291493-160291515 TCCTTTTTCTGTCCACCAGATGG - Exonic
917966783 1:180183756-180183778 TCCTCTGTGAGGCCAGAAGACGG - Intronic
920417089 1:205806113-205806135 TCCTCTAGGTGTCCAGGAAAGGG + Intronic
921374080 1:214455358-214455380 TCCTCTTGGTGTCATGGAGAAGG - Intronic
923837600 1:237631095-237631117 TCATATTTTTATCCAGAAGAAGG + Intronic
924202103 1:241671138-241671160 TTTTCTTTGTGTCTAGAAAAAGG + Exonic
1064420359 10:15185446-15185468 GCCACTCTGTGTCCAGAACATGG - Intergenic
1066997555 10:42578005-42578027 TCCTCTCTGTGACTAGAGGAGGG - Intronic
1070677233 10:78420527-78420549 TCCTCTGGGTGCCCTGAAGAAGG + Intergenic
1072756346 10:98023744-98023766 TCTTCTGTGTGTCCTGAAGCAGG - Intronic
1073702934 10:105950517-105950539 TGCTCTGTGTGGCCAGCAGAGGG + Intergenic
1076470049 10:130712158-130712180 TCCCCTTTCTTTACAGAAGAGGG - Intergenic
1081110052 11:39124163-39124185 TCCTCTTTGTGTTCTGAAAGAGG - Intergenic
1083761844 11:64823005-64823027 TCCTCTTGGGGTTCAGAAGGTGG - Intergenic
1087016316 11:93557710-93557732 ACATCCTTGTGTTCAGAAGATGG + Intergenic
1088095252 11:106092300-106092322 TCCTGCTTGTGTCCAGCAAACGG + Intronic
1088998783 11:115030909-115030931 TCCTTTTTGATTCCTGAAGAGGG + Intergenic
1089023047 11:115238162-115238184 TCTTCCTTGTGTGCAGGAGAAGG - Intronic
1089181464 11:116586068-116586090 TCATCTTTGTGTACGTAAGAGGG - Intergenic
1090337568 11:125983124-125983146 TCCCCTTTGGCTCCAGAATAAGG - Intronic
1091027077 11:132150983-132151005 TAATCTTTTTGTCCAGAATAGGG + Intronic
1091667455 12:2429656-2429678 GCTTCTTTTTGTCCAGGAGATGG + Intronic
1092244438 12:6855740-6855762 TCCTCTTTCTGTAAAGAAGCAGG - Exonic
1092254564 12:6919386-6919408 TCCTCTGTGTTCCTAGAAGATGG + Intronic
1093347524 12:18057193-18057215 CCCTCTTTGTCTCCAGGAGTTGG + Intergenic
1096771217 12:53937195-53937217 TCCTCTTTGTGGGGAGAAGGTGG - Intergenic
1097451851 12:59746100-59746122 ACTTCTTTGTGTCCAGTAAAAGG + Intronic
1097735992 12:63181223-63181245 AGCACTTTGTGTCCAGAAAAGGG + Intergenic
1099325330 12:81208013-81208035 TAATCTTTGTGTTCAGGAGATGG - Intronic
1099380148 12:81942917-81942939 TCTTCCTTGTATCCAGAAAAAGG + Intergenic
1101988855 12:109468241-109468263 TCCTCTCTGTGTCCTGGGGAAGG - Intronic
1102175264 12:110869280-110869302 TCCTGTTTGTGTCGAGATGGTGG - Intronic
1105373825 13:19825229-19825251 TCCTCTTTGTCCTCAGATGATGG - Intronic
1106387181 13:29299241-29299263 TGTTCTTTCTGGCCAGAAGAAGG + Intronic
1106780085 13:33050592-33050614 GACTCTTGGTGTCCAGAGGAGGG + Intronic
1107886767 13:44880209-44880231 TCCTCTTTGTGTCAAGGAATAGG - Intergenic
1108231366 13:48345878-48345900 TCCTCATTCTCTCCAGAATAGGG - Intronic
1108983441 13:56550044-56550066 TCGTCATTGTTTCCAGGAGATGG - Intergenic
1109114617 13:58365770-58365792 CCTTCTTTGTCTTCAGAAGAAGG + Intergenic
1111103579 13:83616452-83616474 TCCCCTTTGTTTCAAGAGGAGGG - Intergenic
1111850499 13:93567238-93567260 TCTTCATTGTTTCCAGAATATGG - Intronic
1112299604 13:98218022-98218044 GGCTCTTAGTGCCCAGAAGATGG - Intronic
1112603052 13:100875855-100875877 GACTCTTTGTGTCATGAAGAGGG + Intergenic
1113764108 13:112870131-112870153 TCCTCATTGTGATCAGAAGTGGG - Intronic
1116171217 14:41405613-41405635 ACCTCTTTCTTTGCAGAAGATGG + Intergenic
1118108251 14:62686016-62686038 TCTTCTTTGTTTCATGAAGATGG + Intergenic
1118833713 14:69460302-69460324 TCCTCACTGTGGCCAGCAGAGGG - Exonic
1124959941 15:34386548-34386570 TCCTCTTGGGGCCCTGAAGAAGG - Intronic
1128901733 15:71428850-71428872 TCCTGTATGTGTCAAAAAGAGGG - Intronic
1130906247 15:88242689-88242711 TCCTCTTTGGGTCCCACAGAAGG + Intronic
1133074172 16:3267107-3267129 TTCTCTTTCTGTCCTGTAGAGGG + Intronic
1133416262 16:5609487-5609509 TGCCCTTTGTCTCCACAAGAAGG - Intergenic
1135381059 16:21996494-21996516 TCCTCTTTCTAACCAAAAGAGGG + Intronic
1136083394 16:27867700-27867722 TCCTCCTGGTGGCCAGTAGAGGG - Intronic
1136123273 16:28155969-28155991 TCCTCTTTGATTTCAGAATATGG - Intronic
1137394952 16:48110485-48110507 TCCTCTCTGTGTCCAGCATGGGG + Intronic
1137780183 16:51091391-51091413 TCCTCTTGCTTCCCAGAAGATGG + Intergenic
1138582391 16:57950137-57950159 TTTTCTTTTTGTACAGAAGATGG - Intronic
1140242258 16:73213851-73213873 TCCTCTCAGTTTTCAGAAGATGG + Intergenic
1142290550 16:89192061-89192083 TACTCATTGTGCCCAGAGGACGG + Intronic
1142636177 17:1259263-1259285 TCCACTTTCTGACCAGAAGAGGG + Intergenic
1143740172 17:8946836-8946858 TCCTCCTTGAGAACAGAAGAAGG - Intronic
1147729275 17:42587734-42587756 TACACTGTGTGTCCAGAACATGG + Intronic
1147842250 17:43380007-43380029 TCCTCTTGGTTTCTAGAAGTAGG - Intergenic
1148506980 17:48135291-48135313 TCCTATTTCAGGCCAGAAGATGG + Intronic
1149303503 17:55327125-55327147 TTGTCTTTGTGGTCAGAAGATGG + Intergenic
1150057289 17:62029987-62030009 TCCTCAGTCTGTCCAGAAGTGGG - Exonic
1151410605 17:73925069-73925091 TCTTCTTTATGTCCAGGACAAGG + Intergenic
1153464114 18:5369755-5369777 TCCTCTGTGTGCCCAGAAAATGG + Intergenic
1154134324 18:11762391-11762413 TCATCTTGGTGTCCACAAGATGG - Intronic
1154136499 18:11784387-11784409 TTCTCTGTGTGTGCAGGAGATGG + Intronic
1156852665 18:41746199-41746221 TCCTCTTTCTGACCAGGAGGTGG + Intergenic
1157305578 18:46514763-46514785 TCCTTTTTGTGTCCAGTCTAAGG + Intronic
1157909561 18:51602800-51602822 TCTTCATTGAGTCGAGAAGAAGG - Intergenic
1158178682 18:54687216-54687238 TCCTGTGTGTGTCTAGGAGATGG + Intergenic
1159203397 18:65218703-65218725 TTTTCTCTGTGTCCAGAACATGG + Intergenic
1160401952 18:78618043-78618065 TCATCTTAGTGTCCACCAGAGGG - Intergenic
1160660365 19:295321-295343 TCCTCGGCGTGTCCAGCAGAGGG - Intergenic
1162403115 19:10457866-10457888 TTCTGTTTGTCTGCAGAAGATGG - Exonic
1165136921 19:33675316-33675338 TCCTCATTATGTCCAGTAGAAGG - Intronic
1168331531 19:55572672-55572694 TCCTCTCTGCATCCAGAAAATGG + Intergenic
927497075 2:23558159-23558181 TCCTCCTTGTGCCCAGAAAGAGG + Intronic
927683957 2:25158232-25158254 TCCTCTTCATGACCAGAAAATGG + Exonic
928834275 2:35523738-35523760 TCCTGTTATTGTCCACAAGATGG - Intergenic
929307349 2:40378662-40378684 TCCTCTTTCTCTGCAGATGACGG - Intronic
931457441 2:62423356-62423378 TGCGCTATGTGACCAGAAGAGGG + Intergenic
931697349 2:64881212-64881234 TCTTCTTTGTGTCCAGTGGAAGG - Intergenic
932563730 2:72892869-72892891 TCCTCCTTGTGCTCAGCAGAGGG + Intergenic
932719749 2:74130486-74130508 TCCTTTTGGTGGCCCGAAGAAGG + Intergenic
936510309 2:113139813-113139835 TCCTCATGGAGTCTAGAAGAGGG - Intergenic
937120726 2:119438503-119438525 TCCTTTTTCTGCCCAGAAGTAGG + Exonic
937880733 2:126862688-126862710 TCATCTCAGTGTCCAAAAGAAGG - Intergenic
937920977 2:127130407-127130429 TTCTCTTTATTTCCAGAATACGG + Intergenic
938898446 2:135776534-135776556 TCTGCTTTGTGTGCAGAAGTAGG + Intronic
939210846 2:139173334-139173356 TGCTATTGGTGACCAGAAGAAGG + Intergenic
939699246 2:145369615-145369637 TCCTCTGTCTGTCCAGGAGCAGG + Intergenic
940042180 2:149372081-149372103 TTGTCTTTCTGTCCAGAATAAGG - Intronic
941071442 2:160959336-160959358 TCCTCCCTGTCTCCAGTAGAAGG + Intergenic
942223260 2:173791779-173791801 CACTCTTTGTGCCCAGAAGAAGG - Intergenic
942998676 2:182297404-182297426 TCCTCTTTGTGGCCAGCCCAAGG - Intronic
943764912 2:191650039-191650061 TCTTTCTTGTGTCCAGATGAAGG + Intergenic
945627387 2:212227387-212227409 TCCCCTTTTTGTTCAGAAAAGGG + Intronic
947966815 2:234289085-234289107 TTCCCTCTGTGACCAGAAGAGGG + Intergenic
948080021 2:235198324-235198346 TTCTCTTTGTGAGCAGAAGGAGG + Intergenic
948369841 2:237481750-237481772 TTCTCTATGTGTGCAGATGAGGG + Intergenic
948523841 2:238558568-238558590 CCCTCTTTGTGTCCAGGAACTGG + Intergenic
1169105788 20:2993214-2993236 TCCTCTTTGTTAGCAGGAGAGGG + Intronic
1171189239 20:23147000-23147022 TCCTTTGTGTGTCCAGGAGGAGG + Intergenic
1172181452 20:33006339-33006361 TCCTCTTTGCGTCTAGAATAGGG + Intergenic
1174827054 20:53777958-53777980 TCACCTTTTTGTCCACAAGAGGG - Intergenic
1175069743 20:56323364-56323386 TCCTCTTTGTGTTTGAAAGAGGG - Intergenic
950725309 3:14913418-14913440 TCCCTTTTGCGTCCTGAAGAGGG - Intronic
952558283 3:34558848-34558870 TCCTCTTTAAGTCAAGATGAGGG + Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953648753 3:44779909-44779931 CCCTCTTTTCTTCCAGAAGAAGG + Intronic
953868753 3:46607883-46607905 TCCTCTTTGTGTCCAGAAGAGGG + Intronic
954666828 3:52258666-52258688 TCCTCTTTAGGTTCAGAGGATGG - Exonic
956453964 3:69402284-69402306 TCCTCATTGTGGCAACAAGATGG - Intronic
956809561 3:72851469-72851491 TACTCCTTGTTTCCAGAAGGTGG + Intronic
958866645 3:99508549-99508571 TCCTTCTTGTGTCCAGAACATGG - Intergenic
960373943 3:116875540-116875562 TCCTCTTTGTGGCTTGTAGATGG + Intronic
960503920 3:118470480-118470502 ACCTCAGTGTGTCCAGATGATGG - Intergenic
960790616 3:121426295-121426317 TCCTCTTGGTGTGCAGAATTAGG - Intergenic
962201075 3:133401659-133401681 TCCTCTTTCTCTCCAGATGCTGG + Intronic
963834662 3:150046054-150046076 TCCTCTTTGTGCCAACCAGAGGG - Intronic
964453863 3:156839013-156839035 TCCTTTTTTTTTCCAGAATAGGG - Intronic
966161246 3:176970841-176970863 TCCTCTTTGTTTACAGTATATGG + Intergenic
966892531 3:184417684-184417706 TCCTCTGTGTGGCCTCAAGAAGG + Intronic
967018332 3:185500876-185500898 TCCTCTTTTTGTCCTTAAAAAGG - Intergenic
968201302 3:196757762-196757784 TCATCTTCCTGACCAGAAGACGG - Intronic
969274482 4:6125497-6125519 TCCGTTATGTGTCCAGGAGAGGG + Intronic
971563830 4:28114653-28114675 TCATCTTGGTCTCCAGGAGATGG + Intergenic
971835519 4:31758343-31758365 TCTTCTTTGCTTCCATAAGAAGG - Intergenic
977032694 4:91906742-91906764 TCATATTTATGTCCTGAAGAGGG - Intergenic
983223717 4:165066949-165066971 TCATGTTTGGGACCAGAAGATGG - Intergenic
984634163 4:182092960-182092982 TCCACTGTGTGCCCAGAAGCTGG + Intergenic
984646571 4:182226597-182226619 TCCTCTTGGTGTCTACAGGATGG + Intronic
985421927 4:189793201-189793223 TCGCCTGTGTGTCCAGCAGAGGG - Intergenic
986040766 5:3992222-3992244 TCATCCTTCTGTCCATAAGAAGG + Intergenic
988786643 5:34571291-34571313 TCTTTTTTGTGTGGAGAAGAAGG - Intergenic
988903639 5:35761616-35761638 TTCTATTTGTGTCAAAAAGAGGG - Intronic
989547887 5:42695670-42695692 TCCACCTTGTGTCCATATGATGG - Intronic
989732081 5:44661319-44661341 TCCTCTTCTTTTCCAGAACAGGG - Intergenic
991646213 5:68803050-68803072 TACTCTCTGTGCCCAGAACAGGG + Intergenic
992554275 5:77888242-77888264 TGCAATTTGTCTCCAGAAGAAGG - Intergenic
992897229 5:81255543-81255565 TCCTGTCTGTGTCCAGAAGATGG + Intronic
995332681 5:110962863-110962885 TCCTCCTTGTGTCTAGAACCAGG - Intergenic
998094814 5:139391174-139391196 CCCTCTGTGTGGCCAGAAGGTGG - Exonic
998709910 5:144812208-144812230 TCCTCATTGTGCCCAGTGGAAGG + Intergenic
999656462 5:153815496-153815518 TCCTCTGTGTGCCCAGGAGAGGG + Intergenic
999887906 5:155943989-155944011 TCCTCCTTCTGTCCTGCAGAGGG + Intronic
1001246226 5:170107392-170107414 GCCTGTTTGTCCCCAGAAGAGGG + Intronic
1003417754 6:5928130-5928152 CCCTCTTTGTGCCCCGGAGATGG + Intergenic
1004031147 6:11870689-11870711 TCCTCTTTGCCTCCAGAGGATGG + Intergenic
1004218858 6:13727760-13727782 TCTTATTTGTGTCCAGTAGTGGG + Intergenic
1005391122 6:25334237-25334259 TACTCTGTGTGTCCAGAATCAGG - Intronic
1005977842 6:30813828-30813850 TTGACTTTTTGTCCAGAAGATGG - Intergenic
1006644124 6:35504508-35504530 TCCTCTTATTGTCCAAATGAGGG - Intronic
1007007597 6:38380523-38380545 TCCTTATTGAGTCTAGAAGAGGG + Intronic
1007161448 6:39794465-39794487 TCCTCTTTTTGTCCTGATGGGGG - Intronic
1008434458 6:51458678-51458700 TCCTCTCTCTGTCAACAAGAAGG - Intergenic
1009682262 6:66911452-66911474 TGCTCATTGTGTGCAGAAGCTGG + Intergenic
1009818942 6:68774644-68774666 TGATCTTTCTGTTCAGAAGAAGG + Intronic
1010905635 6:81484610-81484632 TCCTCTCTTTGTCCAATAGAAGG - Intergenic
1011665585 6:89629860-89629882 TCATCTTTGTGTCAACAACATGG + Intronic
1011837912 6:91456845-91456867 GCCCCATTGTGGCCAGAAGAAGG - Intergenic
1013467882 6:110433488-110433510 TCCTCCTTGTCTCCACAAGCAGG - Intronic
1014320159 6:119917979-119918001 TCCTCTGTGTTTTCAGGAGAAGG + Intergenic
1016672105 6:146721128-146721150 TCCTCTATGAGGACAGAAGAGGG - Intronic
1016683650 6:146857610-146857632 TTCTCTGTGTGTCCAGCAGGGGG + Intergenic
1023118088 7:36882283-36882305 TCTTCTGTGTGTTCAGAACAAGG + Intronic
1023824476 7:43999925-43999947 TCCTAGCAGTGTCCAGAAGAAGG + Intergenic
1024139167 7:46444481-46444503 TCATCTATGTGACCTGAAGATGG + Intergenic
1024154729 7:46609875-46609897 TCCTCTTTGGGCCCAGCAGTGGG - Intergenic
1024199467 7:47091076-47091098 TTCTCTTTGTAACCAGAACAAGG + Intergenic
1024750513 7:52459783-52459805 GCCTCTGTGAGCCCAGAAGAGGG - Intergenic
1026088025 7:67278689-67278711 TCCTAGCAGTGTCCAGAAGAAGG + Intergenic
1026726217 7:72871584-72871606 TCCTAGCAGTGTCCAGAAGAAGG - Intergenic
1027274175 7:76541462-76541484 TCCTAGCAGTGTCCAGAAGAAGG - Intergenic
1027327619 7:77060515-77060537 TCCTAGCAGTGTCCAGAAGAAGG - Intergenic
1029212740 7:98922164-98922186 TCCTCTTGGTCACCAGGAGAGGG - Intronic
1029570859 7:101368102-101368124 TCCTCTTTATTTCCAGATAATGG + Intronic
1029719873 7:102356026-102356048 TCCTAGAAGTGTCCAGAAGAAGG - Intergenic
1029752740 7:102553231-102553253 TCCTAGAAGTGTCCAGAAGAAGG + Exonic
1029770691 7:102652324-102652346 TCCTAGAAGTGTCCAGAAGAAGG + Exonic
1030605152 7:111632777-111632799 TCCTCGTGGGGTCCTGAAGATGG - Intergenic
1032097580 7:128947259-128947281 TCCTCTTTGAGTAAAGAATAGGG - Exonic
1032154241 7:129455155-129455177 TCCTGTGTGTGTCCAGAATCAGG + Intronic
1033369270 7:140694454-140694476 TCCTTAGTGTGTCCAGTAGATGG + Intronic
1036587417 8:10137086-10137108 TCCTTGTTGTGTTCTGAAGAGGG + Intronic
1039262598 8:35788288-35788310 TCGTCTTTGTGACCATAAGCTGG + Intronic
1040877266 8:52166601-52166623 TCCTCACAGTGTCCAGAGGAAGG - Intronic
1044152976 8:88804445-88804467 TCCTCCTCATGTTCAGAAGAAGG + Intergenic
1044608630 8:94070189-94070211 TCCTCTCTCTGTCCATGAGATGG - Intergenic
1044745431 8:95366293-95366315 ATCTCTTTGTGTGCAGAGGAGGG + Intergenic
1046553863 8:115751917-115751939 TTCTCTTTCTGTCGAGGAGATGG - Intronic
1048550150 8:135426574-135426596 TCCTGCTTGTTTCCACAAGATGG - Intergenic
1050094561 9:2050583-2050605 TCCTCTTTGTGTCAGGAAGCAGG + Intronic
1050610018 9:7342393-7342415 GGCTTTTTGGGTCCAGAAGAGGG + Intergenic
1052734319 9:32324722-32324744 TACTCTTTGTGTCCAAGGGAGGG + Intergenic
1053524446 9:38814491-38814513 TCCTCTTTTTTACCAGAAAAGGG - Intergenic
1054196681 9:62038900-62038922 TCCTCTTTTTTACCAGAAAAGGG - Intergenic
1054641724 9:67549785-67549807 TCCTCTTTTTTACCAGAAAAGGG + Intergenic
1055054153 9:72008219-72008241 TCCTCTTTGTCTAACGAAGAGGG - Intergenic
1059365995 9:113786766-113786788 CCCTTTTTATGTCCAGAGGAAGG - Intergenic
1060820271 9:126657910-126657932 TCCTTTGTCTGGCCAGAAGAAGG + Intronic
1189056244 X:37702062-37702084 ACATCTTTGTGTCCAGGACATGG - Intronic
1189191645 X:39113599-39113621 TCATCTTAATGTCAAGAAGATGG - Intergenic
1189967919 X:46393185-46393207 TCCTCTTTCTATCTAGAAGCAGG - Intergenic
1190282364 X:48939431-48939453 GTCTCTGTGTGTCCAGAAAAAGG - Intronic
1190713606 X:53086716-53086738 TGCTCTCTGAGTCCAGAAAAGGG + Intronic
1191682429 X:63854941-63854963 TTCTCTTTGCTTCCAGAGGATGG - Intergenic
1195292494 X:103442449-103442471 ACCTCAGTGTGTCCAGGAGATGG + Intergenic
1195751658 X:108165517-108165539 GGCTCTGTGTGCCCAGAAGATGG + Intronic
1197295271 X:124711535-124711557 TCATTTTTGTACCCAGAAGAAGG + Intronic
1197819213 X:130529118-130529140 TCTTCTATGTTTGCAGAAGATGG - Intergenic
1202579055 Y:26359920-26359942 TTTTTTTTGTCTCCAGAAGAAGG + Intergenic