ID: 953868922

View in Genome Browser
Species Human (GRCh38)
Location 3:46609453-46609475
Sequence GTTCCTGCCCCCACTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953868922 Original CRISPR GTTCCTGCCCCCACTGGGGG AGG Intronic
900106689 1:984387-984409 GGTCCTGCCCCTCCTGGGGAGGG + Intergenic
900196249 1:1377056-1377078 GTTCCTGCCACTCCTGTGGGCGG - Intergenic
900592133 1:3464851-3464873 GCTCCTGCCCAGACTGGGAGTGG + Intronic
900700678 1:4046999-4047021 CTTCCTGCCCCCACCAGGGCTGG + Intergenic
901536936 1:9888668-9888690 ATGGCTGCCCCCACTGGAGGAGG - Intronic
901638392 1:10680851-10680873 GTTCCCCCTCCCACTGGGGCAGG + Intronic
902037181 1:13466514-13466536 GTGCCTGCCCACATTGGGTGAGG + Intergenic
903575078 1:24334670-24334692 ATTCCTGCCCCCAGTGCTGGAGG - Exonic
904925138 1:34041654-34041676 GTTCCTCACCCCACAGGGTGAGG - Intronic
905872037 1:41409984-41410006 GTTCCTGCCTCCAGTGGGTCAGG + Intergenic
906110990 1:43321819-43321841 GTGACAGCCCCCACTGAGGGAGG - Intronic
908920295 1:69182666-69182688 TTTTCTGCCCTCCCTGGGGGAGG - Intergenic
909453959 1:75829483-75829505 GGTCATGGCCCCACTTGGGGAGG - Intronic
912566087 1:110588344-110588366 GTGCCTGCCCACACTGAGGTCGG + Intergenic
913580706 1:120224391-120224413 CTGTCTGCCCCTACTGGGGGGGG + Intergenic
914610192 1:149294391-149294413 CTGTCTGCCCCTACTGGGGGGGG - Intergenic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915142096 1:153774244-153774266 CTTCCTGCTGCCACTGGAGGTGG + Intergenic
917360893 1:174174820-174174842 GTGCCTGCCCACACTGGGTAAGG + Intronic
918309410 1:183275033-183275055 GTTCCTGCCCCAGGTGGGTGTGG + Intronic
919991374 1:202710224-202710246 GTCCGTGCCCCCACCGGCGGGGG + Intronic
920342597 1:205284822-205284844 GCTCCTGCTCCCTCTGGGGGAGG - Intergenic
920798454 1:209163351-209163373 GTGCCTGCCCACATTGGGTGAGG - Intergenic
922170836 1:223153142-223153164 GTGCCTGGCCACACTGGGTGAGG + Intergenic
923385548 1:233462206-233462228 GTGCCTGCCCACATTGAGGGTGG + Intergenic
1063361761 10:5465174-5465196 GTTGCTGCGTCCTCTGGGGGAGG - Intergenic
1065907623 10:30272221-30272243 GTTCCAGGCGCCACTGGGGTGGG - Intergenic
1067040662 10:42951707-42951729 GTGCCCGGCCCAACTGGGGGAGG - Intergenic
1069754181 10:70763258-70763280 GTTCCCACCCCCACGGGGGTAGG - Intergenic
1069784603 10:70979702-70979724 GATCCTGTCCCCACATGGGGGGG - Intergenic
1069859094 10:71459348-71459370 GCTCATGCCCCCACTTTGGGAGG - Intronic
1070720724 10:78755172-78755194 GTGCCTGCCCCTGCTTGGGGTGG + Intergenic
1073111614 10:101066232-101066254 GATCCTGGCGCCACTGCGGGAGG + Intronic
1073827450 10:107340787-107340809 GTGCCTGCCCACATTGGGTGAGG + Intergenic
1075084796 10:119407381-119407403 TTTCCTTCTCCCACTGGGGATGG + Intronic
1075552196 10:123400864-123400886 GTTGGTGCCCCCTCTGGGGCAGG + Intergenic
1075663751 10:124216384-124216406 GCTCCTGCCCACACTGGCAGTGG - Intergenic
1076718477 10:132381124-132381146 GTGCCTGCCCACACTGTGGTGGG - Intergenic
1076786195 10:132751277-132751299 GTCCTTTCCCCCACTGGGGTCGG + Intronic
1077494913 11:2882262-2882284 GTCCCTGCCCCCGGTGGAGGTGG + Intergenic
1079615682 11:22489882-22489904 ATCCCTGCCCCCACTGGGCCAGG - Intergenic
1080936736 11:36871392-36871414 GTGCCTGCCCCCATTGGGGGTGG + Intergenic
1081539255 11:44018135-44018157 GTTCCTTCCCCCACTGGGGCTGG - Intergenic
1081872688 11:46390755-46390777 GTTCCTGCAGCCTCTGGGCGTGG + Intergenic
1082730055 11:56785136-56785158 GTGCCTGCCCCCATTGAGTGAGG + Intergenic
1083332255 11:61904411-61904433 GTTGCTGCCCCCACAGGGCAAGG - Intronic
1083798532 11:65032611-65032633 TATCCAGCCCCCACTGGCGGAGG - Intronic
1084477004 11:69394764-69394786 GCTCCTGTCCCCACGGCGGGGGG - Intergenic
1084530850 11:69726973-69726995 GTTCCTTCCCCCTCTGATGGTGG - Intergenic
1085044204 11:73343822-73343844 ATTACAGCCCCCACTGGGGCCGG - Intronic
1087159684 11:94936511-94936533 GCTCCTGCTCCCACTGGGCGTGG + Intergenic
1087575219 11:99981465-99981487 GTGCCTGCCTACACTGAGGGTGG + Intronic
1088205791 11:107390878-107390900 GTTCCCACCCACACTGAGGGTGG - Intronic
1089290579 11:117435701-117435723 CATCCTGGCCACACTGGGGGTGG - Exonic
1089602386 11:119623865-119623887 CTTCCTGGGCCCACTGGGAGGGG - Intronic
1090634073 11:128678178-128678200 ATTTCTGTCCCCACTGGGGCAGG + Intergenic
1090878634 11:130813970-130813992 ATTCCCGCCCACACTGGGTGGGG - Intergenic
1090907650 11:131091286-131091308 GTGCCTGCCCACATTGGTGGGGG - Intergenic
1091468722 12:708439-708461 GTTCCTGCCCCCACTGGTCAAGG - Intergenic
1091858382 12:3757019-3757041 GTTGCTGCCTCCTCTGGGGTGGG + Intronic
1091997815 12:5008868-5008890 GTTCCTGCCCACATTGGCCGTGG - Intergenic
1097187293 12:57202635-57202657 GCTCCTGCCCCCACCCTGGGAGG - Intronic
1101726944 12:107395704-107395726 GAGCTGGCCCCCACTGGGGGTGG - Intronic
1101745778 12:107540376-107540398 GTGCCTGCCCACACTGGGTGAGG + Intronic
1102207283 12:111099192-111099214 GTTCCTGCCTCTGCTGGGGCAGG - Intronic
1102766618 12:115439219-115439241 GTCCCTCCACCCACTGGGAGAGG + Intergenic
1103228148 12:119305532-119305554 GTGCCTGCCCACACTGAGGATGG - Intergenic
1103261504 12:119593213-119593235 GTTCCCACCCCACCTGGGGGAGG + Intergenic
1103480183 12:121245560-121245582 GTTCCAGACCCCTCTGGGTGGGG - Intronic
1103561074 12:121793580-121793602 CTTCCTGCCCGGACCGGGGGCGG + Exonic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1104563476 12:129859593-129859615 GTGCCCGCCCACACTGAGGGTGG - Intronic
1104715749 12:131015205-131015227 GTTTCTGCCCCACCTGGGAGGGG + Intronic
1104990446 12:132621346-132621368 GTGCCTGCACCTGCTGGGGGTGG + Intronic
1108572483 13:51765118-51765140 GTTCCTGCCTCCACAGGGCCAGG - Exonic
1108754862 13:53487427-53487449 GTGCCTGCCCATACTGGGTGAGG - Intergenic
1109257054 13:60096610-60096632 GTGCCTGCCCATACTGAGGGCGG - Intronic
1109868604 13:68301494-68301516 GGTCCTGCCACCACTGGGCTTGG + Intergenic
1109951360 13:69504755-69504777 GATGCTGCCACCACTGGGGATGG + Intergenic
1110339267 13:74370109-74370131 GTGCCTACCCTCACTGGGTGAGG - Intergenic
1111440752 13:88280604-88280626 GATGTTGCCACCACTGGGGGTGG - Intergenic
1113716890 13:112516373-112516395 CCTCCAGCCCCCACTGGGTGCGG - Intronic
1113891044 13:113735820-113735842 GCCCCTGGCCCCACTGGGGAGGG + Exonic
1113994912 14:16057244-16057266 GTTCCCGCCCCCACAGTGCGGGG - Intergenic
1114793223 14:25682447-25682469 GATGCTGACCCCATTGGGGGAGG + Intergenic
1115029491 14:28777812-28777834 ATTCCTGCACGGACTGGGGGTGG - Intronic
1115665043 14:35535746-35535768 GCTCCTGCCCGCTCTGGCGGGGG + Exonic
1118904732 14:70015597-70015619 GTTTCTGCCGCCCCTGTGGGTGG + Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119709547 14:76812171-76812193 ATTCCTGCCCCCACTCCCGGCGG - Intronic
1120362194 14:83518714-83518736 GTGCCTGCCCACACTGAGGGAGG + Intergenic
1121328269 14:93034275-93034297 CTTCCTGCTCCGACAGGGGGTGG - Intronic
1122159045 14:99769458-99769480 GTCCCTGCCCACTGTGGGGGAGG - Intronic
1122688441 14:103520846-103520868 GCTCCTACCCCCACTGTGGGGGG - Intronic
1124031773 15:26018514-26018536 GTTCCTGCCCCTCCTAGGGAAGG + Intergenic
1124620789 15:31272759-31272781 GGCCCTGCCCCCACAGGTGGAGG + Intergenic
1124644402 15:31426819-31426841 GTGCCTGCCCACAGTGAGGGTGG - Intronic
1125476656 15:40052346-40052368 GTTCCTGACACCACATGGGGGGG - Intergenic
1127577609 15:60307161-60307183 GTTCCTTCCCCCACTTGGAATGG - Intergenic
1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG + Intronic
1128637706 15:69313828-69313850 GTTCCTGCCAACAGTGAGGGTGG + Intronic
1128643129 15:69354794-69354816 GTGTCTGCCCACACTGAGGGTGG - Intronic
1129077359 15:73008377-73008399 GTGCCTGCCCACATTGAGGGTGG + Intergenic
1129518816 15:76172860-76172882 GATCCTGCCCCGAGCGGGGGTGG - Intronic
1130112115 15:80974063-80974085 GTTCTTCTCCCCAGTGGGGGGGG - Intronic
1131563563 15:93464953-93464975 GTGCCTGCCCACATTGGGTGAGG + Intergenic
1132755348 16:1481851-1481873 GTTGCTGCTCCCAGTGGGGTTGG + Intergenic
1132996638 16:2827023-2827045 GTTCCTGCCTCCAGTGAGGCTGG + Intergenic
1134237799 16:12481239-12481261 GGTCCTGCTCCCACTGGTGGGGG + Intronic
1137291034 16:47052074-47052096 GTCCCTGTCCTCACTGGGGAGGG - Intergenic
1137714840 16:50592314-50592336 TGTCCTGGGCCCACTGGGGGTGG + Intronic
1139439737 16:66960179-66960201 AGTCCTGCCCTCCCTGGGGGTGG + Intergenic
1140896623 16:79330559-79330581 GTTCCTCCCCACCCTGTGGGTGG - Intergenic
1141693157 16:85607687-85607709 CTGCCTGCCCCCTCTTGGGGAGG - Intergenic
1142104760 16:88296265-88296287 GCTTCTGTCCCCACTGGGGATGG + Intergenic
1142982198 17:3678788-3678810 TGTCCAGCCCCCACTGGGAGGGG + Intronic
1143294916 17:5863744-5863766 GTTCCTGCCGCAACAGGGGCAGG - Intronic
1143978129 17:10845211-10845233 GCCCCTGCCCCTCCTGGGGGGGG + Intergenic
1144269943 17:13605827-13605849 GTGCCTGCCCACACTGAGGGTGG + Intergenic
1144310968 17:14014030-14014052 GGTTCTGCCCACACTTGGGGGGG - Intergenic
1145784572 17:27585712-27585734 GTTGCTGTCCCCATCGGGGGTGG + Intronic
1146517065 17:33497615-33497637 GATCCTGCCCCCACTAGGGCAGG + Intronic
1148617670 17:49013390-49013412 GTTCCTGGCCTCACAGTGGGAGG + Intronic
1149790299 17:59470837-59470859 GTTCATGTCCCCAGTGGGGTAGG + Intergenic
1151363114 17:73600419-73600441 GCTTCTGCCTCCCCTGGGGGAGG + Intronic
1151703120 17:75753778-75753800 GTTCGAGCCCCTGCTGGGGGAGG + Exonic
1151853915 17:76708657-76708679 GTTAATGCCACCACTGGGAGTGG + Intronic
1151863138 17:76781135-76781157 GTTCCAGGCTTCACTGGGGGAGG + Intronic
1151948405 17:77331813-77331835 GTTCCTGTCCTAACTGGGCGGGG + Intronic
1152532914 17:80930825-80930847 GTCCCTGCCCCAGCTGTGGGAGG - Intronic
1152710592 17:81868998-81869020 GTTCCTGACCCCCGTGGAGGAGG - Exonic
1152723926 17:81936021-81936043 GCCCCTGCCCTCACTGGGGTGGG + Intronic
1152729429 17:81962193-81962215 GCCCCAGCCGCCACTGGGGGAGG + Intergenic
1152831719 17:82501366-82501388 GTCTTTGCCTCCACTGGGGGTGG - Intergenic
1153893506 18:9539276-9539298 TTTCCTGCCTACACTGGGTGCGG - Intergenic
1153896143 18:9562683-9562705 GTACCTGCACACACTGGGGATGG - Intronic
1157528979 18:48406218-48406240 TTCCCTGCCCCCACCGAGGGTGG - Intronic
1158799757 18:60892389-60892411 GTTCATGCCCCCTTTGGGTGAGG + Intergenic
1160354632 18:78216536-78216558 GATCCTGTCCCCACTGGGCCAGG + Intergenic
1160517806 18:79488070-79488092 GTCCCTGCCCCCCCTGGGTCAGG - Intronic
1160738932 19:677149-677171 GTTCCTGCCCCCAGGGACGGGGG + Intronic
1161397545 19:4052531-4052553 GTTCCTGTCCCCACGGGGTGGGG + Intronic
1161851812 19:6741033-6741055 GGTCCAGCCCCCACTGCGTGTGG - Exonic
1163111019 19:15161054-15161076 GTTCCTGCTGCCACTGGCGCCGG - Exonic
1163440648 19:17320928-17320950 CTTATTGCCCCCACTGGTGGTGG + Exonic
1163606818 19:18280312-18280334 GTTCCTGGGCACACTCGGGGAGG + Exonic
1164473692 19:28556242-28556264 GTTGCTGCCACCACTGAGGAGGG - Intergenic
1164667470 19:30051121-30051143 GTGCCTGCCTTCACTGTGGGGGG + Intergenic
1165069098 19:33245303-33245325 TGTCCTGCCTCCCCTGGGGGAGG + Intergenic
1165134897 19:33661628-33661650 GTTCCTGCCCCCACTGCACGGGG + Intronic
1166140762 19:40803956-40803978 CTTCCTGCCCTCACAGGGGAAGG - Intronic
1166610999 19:44196315-44196337 GTTCATGCACCCACTGGGAATGG - Intergenic
1166915203 19:46190732-46190754 ATTCCTTCCCCCATGGGGGGTGG + Intergenic
1167093222 19:47359001-47359023 GGCACTGCCCCCACTAGGGGAGG - Intronic
1168336926 19:55602280-55602302 GCTCCTGCCCTGACTTGGGGGGG - Exonic
925638992 2:5969435-5969457 GTGCCTGCCCCCAGTGGGCAGGG - Intergenic
925872401 2:8282567-8282589 ATGCCTGCCCACACTGGGGAGGG + Intergenic
927052090 2:19339799-19339821 GTTCCTGCCCACCACGGGGGTGG + Intergenic
927925770 2:27012601-27012623 GTGCATGTCCCCACTGGGGTGGG + Intronic
929609183 2:43257272-43257294 GTGTCTGCTCCCACTGGGAGAGG + Intronic
930617380 2:53607703-53607725 GTTCCAGGGCCCACTGGGTGGGG - Intronic
930785671 2:55269315-55269337 GTTGCTGTCGCCGCTGGGGGTGG + Intronic
931209264 2:60177234-60177256 GTGCCTGCCCACATTGGGTGAGG - Intergenic
933266048 2:80181308-80181330 GATGTTGCCACCACTGGGGGTGG + Intronic
936016277 2:108961384-108961406 CTGCCTGCCTCCACTGGTGGTGG - Intronic
936618246 2:114070344-114070366 TTTCCTGGACCCACTGGAGGAGG - Intergenic
937307126 2:120879143-120879165 GTCCCTGCCCCTCCTGGGGAAGG - Intronic
937957525 2:127429968-127429990 GTGCCTGCCCACACTGAGGGCGG - Intergenic
938288143 2:130135765-130135787 GTCCCTGCCCCCTCTGGGCCAGG - Intergenic
938427442 2:131203127-131203149 GTCCCTGCCCCCTCTGGGCCGGG + Intronic
938468386 2:131537175-131537197 GTCCCTGCCCCCTCTGGGCCGGG + Intergenic
938536559 2:132253512-132253534 GTTCCCGCCCCCACAGAGCGGGG + Intronic
940056133 2:149514334-149514356 GTTCCAGCCCCCAGTGGTGGCGG + Intergenic
940718502 2:157256272-157256294 GTGCCTGCCCACATTGGGTGAGG + Intergenic
941115043 2:161462427-161462449 GTTCCAGGCACCACTGGGGTAGG + Intronic
942987443 2:182160369-182160391 GTGCCTGCCCACATTGAGGGTGG - Intronic
943509131 2:188802692-188802714 GATGCTGCCCCTACTGGGGATGG - Intergenic
946157638 2:217817739-217817761 GGTGCTGCCCCCACTGGGACTGG + Exonic
946790582 2:223297152-223297174 GATGTTGCCACCACTGGGGGTGG - Intergenic
947877062 2:233474512-233474534 GTCCTTGCCCCGACTTGGGGTGG - Intergenic
948424234 2:237877475-237877497 GGTTCTTCCCCCAGTGGGGGGGG + Intronic
948437156 2:237961478-237961500 CCTCCTGCCCTCACTGTGGGTGG - Intergenic
948635074 2:239329533-239329555 ATTCCTGCTCCGGCTGGGGGAGG + Intronic
948635137 2:239329928-239329950 ATTCCTGCTCCGGCTGGGGGAGG - Intronic
948806854 2:240456755-240456777 AATCCTGCCCCCACGGGGGTGGG + Intronic
1169122546 20:3106024-3106046 TCTCCTGCCCCCATGGGGGGGGG + Intergenic
1171166535 20:22976775-22976797 GTTCCCTTCCCCACTGAGGGTGG - Intergenic
1171767333 20:29297459-29297481 GTTCCTGCCCCCACAGCGTGGGG + Intergenic
1171865455 20:30485285-30485307 GTTCCCGCCCCCACAGCGCGGGG + Intergenic
1173727869 20:45309408-45309430 CTTCCTGACCCCACAGGGGCAGG + Intronic
1173733660 20:45345206-45345228 GTTCCTGCCCTCAGTGTGCGGGG + Intronic
1173846673 20:46192917-46192939 CCTCCTGCTCCCACTGGGGGGGG - Intronic
1173893757 20:46534167-46534189 GCTCCTGCCCCAACTTGGAGGGG - Intergenic
1173966017 20:47113458-47113480 CTGCCTGCCCCCACTGCAGGTGG - Intronic
1174588637 20:51627724-51627746 GCTCCTGACCTCACTGGGGAAGG + Intronic
1175680424 20:60984240-60984262 CTTCCTGCTCCCACTTGGTGGGG - Intergenic
1175860817 20:62149158-62149180 ATTCCTGCATCCACTGGGGACGG - Intronic
1175913813 20:62416517-62416539 ATCCCGGCCCCCACTGGGCGCGG - Intronic
1176378578 21:6100350-6100372 GAGCTTGCCCCCACCGGGGGTGG + Intergenic
1176548624 21:8212315-8212337 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1176556518 21:8256523-8256545 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1176567555 21:8395350-8395372 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1176575457 21:8439565-8439587 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1177179957 21:17734313-17734335 GTTCCAACCCATACTGGGGGAGG + Intergenic
1179417195 21:41208357-41208379 GTGCCTGCACCTTCTGGGGGTGG + Intronic
1179417375 21:41209215-41209237 GTGCCTGCGCCTTCTGGGGGTGG + Intronic
1179744897 21:43437887-43437909 GAGCTTGCCCCCACCGGGGGTGG - Intergenic
1179913569 21:44462572-44462594 CTTCCAGCCCACACTGCGGGGGG + Intergenic
1179942809 21:44650729-44650751 GCTCCAGCCCCCAGTGAGGGTGG + Intronic
1180181931 21:46121923-46121945 CGTCCAGCCCCCACTGGAGGTGG + Intronic
1180312180 22:11250165-11250187 GTTCCCGCCCCCACAGTGCGGGG + Intergenic
1181173175 22:21021678-21021700 GGTCCTGCCCCAACTGAGGATGG - Intronic
1181472749 22:23150965-23150987 GCTCCTGCCACCACTGGCAGAGG + Intronic
1182101394 22:27659963-27659985 GTTCCTGTCCACACCTGGGGTGG - Intergenic
1183333547 22:37234163-37234185 GATCCTGCCCCCACAGCTGGCGG + Intronic
1183456135 22:37924389-37924411 TTTTCTGCCCACACTGGCGGGGG + Intronic
1183786135 22:40030185-40030207 AATTCTGCCCCCACTGCGGGAGG - Exonic
1184113446 22:42408782-42408804 GCTCCTGCTCACACTGTGGGTGG - Intronic
1184269952 22:43374378-43374400 GTGCCTGCCCACATTGGGGAGGG + Intergenic
1184300991 22:43560868-43560890 GTCCCCGCCCTCACTTGGGGAGG + Intronic
1184380602 22:44142942-44142964 GCTGCTGCCCCCACAGGGGCGGG - Intronic
1203253507 22_KI270733v1_random:128620-128642 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1203261562 22_KI270733v1_random:173698-173720 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
950040655 3:9917249-9917271 GTGTCTGCCCCCCTTGGGGGGGG + Exonic
950615394 3:14153899-14153921 ACTCATGCTCCCACTGGGGGCGG + Intronic
952099338 3:29993542-29993564 ATTCCACCCCCCACTGTGGGAGG + Intronic
952490357 3:33865318-33865340 GTCCCAGCCCCCACTGGAGATGG - Exonic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
954430427 3:50467944-50467966 GCTCCTGCCGCCCCTGGGGCCGG + Intronic
954678941 3:52331096-52331118 CTTCCTGCCCCCATGGCGGGGGG + Intronic
957634103 3:82759533-82759555 GATGTTGCCCCCACTGTGGGTGG - Intergenic
958414951 3:93862492-93862514 GTGCCTGCTCACACTGGGTGAGG + Intergenic
958954923 3:100457019-100457041 GTGCCTGCCCACAATGGGTGAGG + Intergenic
959564343 3:107819056-107819078 GTATCTGCCCCCAATGAGGGCGG + Intergenic
960557159 3:119042592-119042614 CTTGCTGCCACCACTGTGGGGGG - Intronic
962942979 3:140142385-140142407 GTTCAGGCCCACACTGGGGCAGG + Intronic
965991578 3:174825479-174825501 ATTCCTGCCCCCACTGGTGAGGG + Intronic
967793984 3:193578634-193578656 GTGCATGCCCACACTGGGTGAGG - Intronic
968480045 4:829221-829243 GTCCCTGGCCTCACTGGGGCTGG - Intergenic
968625767 4:1626027-1626049 TTTCCTGCCCCGACTCGGTGTGG + Intronic
969129431 4:4980748-4980770 GTTCCAGCCCCCACAAGGGATGG + Intergenic
969326701 4:6448435-6448457 CTTCCTGCCCCCACCAGGGCCGG + Intronic
970520529 4:16879447-16879469 GTGCCCACCCCCACTGGGGAGGG - Intronic
974410747 4:61538830-61538852 GCCCCTGCCCTGACTGGGGGTGG + Intronic
974975770 4:68889095-68889117 GTGCCTGCCCACATTGAGGGTGG + Intergenic
976002261 4:80386981-80387003 GAACCTGCCCCCACTGCGGTGGG + Intronic
977371949 4:96148687-96148709 GTGCCTGCCACCACTGGGCCCGG - Intergenic
977554075 4:98471039-98471061 GCTCCTGCCCCCACTTTAGGTGG - Exonic
979043649 4:115834371-115834393 GTTCCAGGCACCACTGGGGTAGG - Intergenic
979171966 4:117611261-117611283 GTTCCTGCCTGCAATGGTGGTGG - Intergenic
984717784 4:182942037-182942059 GTGCCTGCTCACACTGAGGGTGG - Intergenic
985994958 5:3592656-3592678 TTTCCTGCCTCCAAAGGGGGTGG - Intergenic
986377485 5:7147377-7147399 GTGCCTGACTCCATTGGGGGAGG - Intergenic
986782918 5:11083840-11083862 GTGCCTGCCCCCATGGGGGAAGG - Intronic
987738062 5:21870351-21870373 GTCCCTGCCCTCATTGAGGGTGG - Intronic
988688730 5:33550428-33550450 GTTACTGCCCACACTGAGGTGGG + Intronic
990063440 5:51681429-51681451 CTTCCTGCCATCACTGGGGAAGG - Intergenic
990282915 5:54270892-54270914 GTGCCTGCCCACATTGAGGGTGG - Intronic
993386631 5:87268874-87268896 TTACCTGCCCCCTTTGGGGGCGG + Exonic
994450090 5:99930090-99930112 GTTCCTGCCCCAATTGGGAAGGG + Intergenic
996976500 5:129440693-129440715 GTGCCTGCCCACATTGAGGGCGG + Intergenic
997105111 5:131009202-131009224 GTTCTTGCTCCCTCCGGGGGAGG - Intergenic
997338545 5:133124544-133124566 GTGCCTGCCCACATTGGGTGAGG + Intergenic
998374235 5:141680780-141680802 GTTCCTGCCCACCCTGGGTCTGG + Intronic
998514399 5:142739672-142739694 GTTCCTGCCCACATTGGGGAGGG - Intergenic
998634513 5:143938378-143938400 GTTTCTGCTGGCACTGGGGGTGG - Intergenic
999351045 5:150872280-150872302 GATGTTGCCCCCACTGGGGATGG - Intronic
1000225529 5:159257631-159257653 GTGCCTGCCCACATTGCGGGTGG - Intergenic
1000276989 5:159746738-159746760 GCTCCTGGCCCCTCTGGGAGTGG + Intergenic
1001452432 5:171836866-171836888 GTTCCTGGGCCGACTGGGGTGGG - Intergenic
1003233712 6:4277365-4277387 GTGCCCGCCCACACTGGGTGAGG - Intergenic
1003309987 6:4962292-4962314 GTTCCAGCCCTTACTGGGGGGGG - Intergenic
1003765319 6:9229917-9229939 CTTCCTGCCCCAGCTGGGAGCGG + Intergenic
1006313877 6:33279160-33279182 GCCCCTTCCCCAACTGGGGGTGG - Exonic
1006396519 6:33790939-33790961 TTGCGTGCCACCACTGGGGGTGG - Intergenic
1009775869 6:68205724-68205746 GTTCCAGGCACCACTGGGGTAGG - Intergenic
1010938499 6:81888307-81888329 GATGCTGCCACCACTGAGGGTGG + Intergenic
1013299139 6:108786799-108786821 TTTCCTGCCACCACTGTGGCTGG - Intergenic
1014272197 6:119348519-119348541 CTTCGTGCCCCCAATCGGGGTGG - Exonic
1016319111 6:142822821-142822843 GTTCCTTCCCTCACTTGGAGAGG - Intronic
1017234807 6:152108303-152108325 GTTGCTGACCAAACTGGGGGAGG + Intronic
1017653217 6:156601812-156601834 GGTCCTGCGCCAACTGGGTGCGG + Intergenic
1018459683 6:163986028-163986050 GTTCCTGCCCACACTGAGAATGG - Intergenic
1019040455 6:169099834-169099856 GATGTTGCCACCACTGGGGGTGG - Intergenic
1019462017 7:1164889-1164911 GTGCCCACCCCCACTGAGGGTGG + Intergenic
1019544591 7:1567597-1567619 GTTCCTCCCTCCACCGGGGAGGG + Exonic
1022452374 7:30526479-30526501 GTCCCTGCCCACTCTGGGAGAGG + Intronic
1024563824 7:50665620-50665642 GTTGCTACCCCCACGTGGGGTGG - Intronic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1026977276 7:74506452-74506474 GTTTCTGCACCCAATGGGGTAGG - Intronic
1027205479 7:76094448-76094470 GATCCAGCCCCCACTTGGAGAGG + Intergenic
1027942511 7:84702212-84702234 GTGCCTGCCCAGACTGAGGGTGG + Intergenic
1028175875 7:87657663-87657685 GTTCCTGGCCATACTGGGGTGGG + Intronic
1029089239 7:98035234-98035256 GTTCCTGCCCAGATTGGGAGAGG + Intergenic
1029327500 7:99822956-99822978 GCTCCTGCCCCAACTTGGGCAGG - Intergenic
1029891389 7:103933720-103933742 GTTGCAAGCCCCACTGGGGGAGG - Intronic
1030157286 7:106467987-106468009 GTGCCTGCCCACATTGGGTGAGG + Intergenic
1032019095 7:128396683-128396705 GCTGCTGTCACCACTGGGGGTGG + Exonic
1035722445 8:1802286-1802308 GTTCCTGACCCCAAAGGGAGAGG - Intergenic
1038421910 8:27438972-27438994 GTTCCTGCTCCCATGGGGGTGGG + Intronic
1039469154 8:37802890-37802912 GATCTTGGACCCACTGGGGGCGG - Intronic
1041327623 8:56685754-56685776 GTTCTTGGCCCCAGTAGGGGAGG + Intergenic
1041502470 8:58553546-58553568 GTTCCTGCCCGGGCTGGGGCTGG + Intronic
1042815443 8:72873485-72873507 GTTCCTTACCCCACTGGGGTGGG + Intronic
1045406426 8:101871241-101871263 GTTCCTGCCCCCTTTTGGAGAGG + Intronic
1045497036 8:102717624-102717646 GTGCCTGCCCACACTGGTGAGGG - Intergenic
1045720817 8:105108864-105108886 GTGCCTGCCCACACTGGGTGAGG - Intronic
1046272206 8:111911610-111911632 GTCCCTGCCCACACTGAAGGTGG - Intergenic
1046894774 8:119461597-119461619 CGTTCTGCCCCTACTGGGGGGGG + Intergenic
1047857918 8:128932786-128932808 GTTCCTGCCACCACTGAGCAAGG - Intergenic
1048590510 8:135816853-135816875 GTGCCCGCCCACACTGGGGAGGG - Intergenic
1049044672 8:140140021-140140043 GGTCCTGCCTTCACTGGGTGTGG - Intronic
1049283886 8:141764241-141764263 GGTCCCGCCCACACTGGGAGGGG + Intergenic
1051206268 9:14692952-14692974 GCTCCTCCCTCAACTGGGGGTGG - Intronic
1052997659 9:34559744-34559766 GCTCCTGCCACCGCTGGGGGTGG + Intronic
1055321592 9:75088202-75088224 GTTCCAGCCCCCGTTGGGGCGGG + Exonic
1057819260 9:98318640-98318662 ATTCCTGCCACCACTGTGGGTGG + Intronic
1058259781 9:102814478-102814500 GTTCCAGGCGCCACTGGGGGTGG - Intergenic
1060968546 9:127724906-127724928 GCTCCCGCCCCCACGGTGGGCGG + Intronic
1061727619 9:132590108-132590130 CTTCCTGCCCCGCCTGGGAGTGG - Exonic
1061783334 9:133008375-133008397 GTTTCTGCCCCCACTTGAAGAGG - Intergenic
1061937475 9:133866142-133866164 GTTCCAGGCCCCCCAGGGGGTGG + Intronic
1061971890 9:134049576-134049598 GAAACAGCCCCCACTGGGGGAGG + Intronic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1203469908 Un_GL000220v1:111767-111789 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1203477729 Un_GL000220v1:155739-155761 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1185940717 X:4315843-4315865 TTTCCTGCCCCCACTTTGAGTGG - Intergenic
1186498480 X:10031829-10031851 TTTGCTGTCCCCACTTGGGGGGG + Intronic
1186544573 X:10435552-10435574 GGGCCTGCCCACACTCGGGGTGG + Intergenic
1187493940 X:19778001-19778023 ATCCCTGCCCCCACACGGGGTGG - Intronic
1191802678 X:65098845-65098867 GTTCCAGGCACCACTGGGGTAGG - Intergenic
1191886861 X:65897808-65897830 GTGCCTGCCCACACTAGGCGAGG - Intergenic
1193978907 X:88157603-88157625 GTTGTTGACACCACTGGGGGTGG - Intergenic
1194131563 X:90088433-90088455 GTCCCAGCCCCCACAGGGAGGGG + Intergenic
1194803604 X:98300884-98300906 GTGCCTGCCCCCAGAGGTGGAGG - Intergenic
1196181467 X:112695582-112695604 GTTTCTTCCCCCACTTGAGGGGG + Intergenic
1196602987 X:117623114-117623136 GTTCCAGACCCCACTGGGGGGGG + Intergenic
1197497817 X:127207581-127207603 GATCTTGCCACCACTGGGGGTGG + Intergenic