ID: 953870127

View in Genome Browser
Species Human (GRCh38)
Location 3:46619112-46619134
Sequence ATGGGAGTGCAGAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 847}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953870127_953870134 0 Left 953870127 3:46619112-46619134 CCCTCCCTCTTCTGCACTCCCAT 0: 1
1: 0
2: 6
3: 77
4: 847
Right 953870134 3:46619135-46619157 TTAACAATCCAGGATCTAATAGG 0: 1
1: 0
2: 0
3: 8
4: 101
953870127_953870135 1 Left 953870127 3:46619112-46619134 CCCTCCCTCTTCTGCACTCCCAT 0: 1
1: 0
2: 6
3: 77
4: 847
Right 953870135 3:46619136-46619158 TAACAATCCAGGATCTAATAGGG 0: 1
1: 0
2: 0
3: 9
4: 103
953870127_953870131 -10 Left 953870127 3:46619112-46619134 CCCTCCCTCTTCTGCACTCCCAT 0: 1
1: 0
2: 6
3: 77
4: 847
Right 953870131 3:46619125-46619147 GCACTCCCATTTAACAATCCAGG 0: 1
1: 0
2: 1
3: 5
4: 83
953870127_953870137 21 Left 953870127 3:46619112-46619134 CCCTCCCTCTTCTGCACTCCCAT 0: 1
1: 0
2: 6
3: 77
4: 847
Right 953870137 3:46619156-46619178 GGGCAGCAGCAATACGCCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953870127 Original CRISPR ATGGGAGTGCAGAAGAGGGA GGG (reversed) Intronic
900826991 1:4934957-4934979 AGGGGATTGCAGAACAGCGAAGG - Intergenic
901017261 1:6239037-6239059 ATGGGGCTGATGAAGAGGGAGGG - Intergenic
901118708 1:6872162-6872184 TTGGGAGTAGAGAAGAGGTATGG - Intronic
901127720 1:6941084-6941106 CTGGAAGTGCAGAGCAGGGATGG + Intronic
901602595 1:10433391-10433413 AGGGGCTTGCAGCAGAGGGATGG + Intronic
901769070 1:11521400-11521422 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901769145 1:11521628-11521650 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901905996 1:12411531-12411553 ATGAGAGGGAAGAGGAGGGAGGG + Intronic
902036913 1:13464575-13464597 GTGTGAGAGCAGGAGAGGGAGGG - Intergenic
902530582 1:17088136-17088158 TGGGGAGGGCAGAAGAGGCACGG + Intronic
902536274 1:17120684-17120706 ATGTGAGTGGGGAAGAGGGAAGG + Intergenic
902654286 1:17856861-17856883 TGGGGAGTGCAGAGGAGGGCAGG + Intergenic
902712556 1:18250125-18250147 AAGAGAGAGCAGGAGAGGGAGGG - Intronic
902853280 1:19178913-19178935 TGGGGAGGGTAGAAGAGGGATGG - Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903194133 1:21672365-21672387 ATGAGACTGCAGGTGAGGGAGGG + Intergenic
903654315 1:24939796-24939818 GTGGGAGGGGAGAAGTGGGAGGG + Intronic
903674249 1:25054414-25054436 AGGGGAGGGGAGAAAAGGGAAGG - Intergenic
904771011 1:32881466-32881488 GTGGGAGTGAGGAAGAGGGAGGG + Intergenic
904877492 1:33667733-33667755 AGAGGAGTGCAGAAGAAGGGAGG + Intronic
905213427 1:36390210-36390232 ATGAGAGTGGAGAAATGGGAGGG - Intergenic
905773609 1:40654113-40654135 ATGGGAGGGCAGGCGGGGGAGGG - Intronic
906245022 1:44267397-44267419 AAGGGAGGGAAGAAGAAGGAGGG - Intronic
906524832 1:46488057-46488079 AGGGGAGTGGAGAGGAGGGGAGG - Intergenic
906526421 1:46495891-46495913 GTGGGAGTGTACAGGAGGGAAGG + Intergenic
906986242 1:50686558-50686580 AGGGGAGGGAAGAGGAGGGAAGG + Intronic
907179325 1:52555272-52555294 AGTGGAGTGCAGAGGAGGGGTGG - Intergenic
907211389 1:52826043-52826065 ATTAGAGGGCAGGAGAGGGATGG - Exonic
907222793 1:52919779-52919801 ATGACAGTGCAGAGGAGGCATGG - Intronic
907255144 1:53173439-53173461 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255151 1:53173458-53173480 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255158 1:53173477-53173499 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255165 1:53173496-53173518 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907332134 1:53678309-53678331 CTGGGAGTGCAGGAGGGTGAGGG + Intronic
907383807 1:54112577-54112599 ATGGGAGTGCAGAGGAGGCAGGG - Intergenic
907594063 1:55703665-55703687 AAGGAAGAGAAGAAGAGGGAAGG + Intergenic
907857655 1:58319505-58319527 AGAGGAGTGGAGAAGAGAGAAGG - Intronic
907938149 1:59061149-59061171 ATGCAAGTGCAGAAGAGAGGGGG - Intergenic
908082822 1:60598667-60598689 AGGGGAGGGGAGAAGAGGGGAGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
909108039 1:71437664-71437686 ATGTGAGTGCGGAAGAGGTCAGG + Intronic
909286552 1:73827000-73827022 AGGGGAGGGGAGGAGAGGGAAGG + Intergenic
910581240 1:88827638-88827660 AGGGGAGGGGAGAAGAGGGGAGG - Intronic
910707416 1:90144608-90144630 ACTGGAGTGCAGAAGTGAGATGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911300191 1:96163393-96163415 AGAGGGTTGCAGAAGAGGGATGG + Intergenic
911612797 1:99975484-99975506 ATGAGAGTGTAGTAGAGTGAAGG + Intronic
911767059 1:101690237-101690259 CTGGGAGAGCAGAACAGAGAAGG + Intergenic
912180491 1:107213417-107213439 ATGGGAGTAGACAAGAGGGGTGG + Intronic
912275727 1:108256557-108256579 AGGGGAGGGGAGGAGAGGGAGGG - Intergenic
912292499 1:108437797-108437819 AGGGGAGGGGAGGAGAGGGAGGG + Intronic
912365951 1:109134033-109134055 ATGGGTGGGCGGAAGTGGGAGGG + Intronic
912732829 1:112124925-112124947 ATATCAGTGGAGAAGAGGGAGGG + Intergenic
913386494 1:118263426-118263448 ATGGAAGTTGAGAAGAGGAATGG + Intergenic
913611018 1:120509861-120509883 CTGGCAGGGGAGAAGAGGGAAGG - Intergenic
913673197 1:121117163-121117185 AAAAGAGTGCAGAAGAAGGACGG - Intergenic
914024974 1:143904524-143904546 ACGAAAGTGCAGAAGAAGGACGG - Intergenic
914214356 1:145611328-145611350 AGGGGAGGGGAGAAGGGGGAAGG - Intronic
914466294 1:147931721-147931743 AGGGGAGGGGAGAAGGGGGAAGG - Intronic
914580172 1:149012378-149012400 CTGGCAGGGGAGAAGAGGGAAGG + Intronic
914663404 1:149812244-149812266 ACGAAAGTGCAGAAGAAGGACGG - Exonic
914918595 1:151832881-151832903 ACGAGACGGCAGAAGAGGGAAGG - Intergenic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916187358 1:162146089-162146111 CTGGGAGTGCAGCAGAGGCAGGG + Intronic
916524761 1:165598877-165598899 AAGGGAGAGGAGAAGAGGGGAGG + Intergenic
916828051 1:168462645-168462667 GAGGGAGTGCAGTAGAGAGATGG + Intergenic
917517661 1:175721651-175721673 AGGGGTGTGCAGAAGTGAGAGGG - Intronic
917605691 1:176626686-176626708 AAGGGAGTGCATTTGAGGGATGG + Intronic
917992942 1:180401810-180401832 AGGGGAGGGGAGAGGAGGGAAGG + Intronic
918345669 1:183605084-183605106 ATAGGTGTGCGGAAGTGGGAAGG + Intergenic
918364700 1:183795446-183795468 GTGGGAGAGGAGAACAGGGAAGG + Intronic
918813280 1:189149595-189149617 ACGGAAGTGCAGAACAGGGGAGG + Intergenic
918819910 1:189239768-189239790 GTGGGAGTGAAAAAGAAGGAGGG + Intergenic
919853915 1:201692972-201692994 ATGGCAGGGCAGGAGAGAGAAGG + Intronic
920032072 1:203043628-203043650 ATGGGAGACAGGAAGAGGGAAGG - Intronic
920565013 1:206966075-206966097 AGAGGGGTGGAGAAGAGGGAAGG + Intronic
920657337 1:207886767-207886789 ATGGGGGTGCAGAGCAAGGAAGG + Exonic
920922407 1:210309226-210309248 AAGGGAGGGGAGAAGAGGGGAGG - Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921885071 1:220297229-220297251 AAGGGAGTGAGGAGGAGGGAAGG - Intergenic
922427696 1:225514784-225514806 ATGGGAGTGGAGGAGGTGGAGGG + Exonic
922476944 1:225912857-225912879 GTGGGATTGTAGAAGGGGGAGGG + Intronic
922803976 1:228376356-228376378 ATGGGAGTGTAGGTGAGTGAAGG - Intronic
922895478 1:229096889-229096911 AGGGGAGGGAAGAAAAGGGATGG + Intergenic
923198460 1:231689988-231690010 AAGGGAGAACATAAGAGGGAGGG + Intronic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
923498421 1:234544529-234544551 AGGAGGGTGCAGGAGAGGGAGGG + Intergenic
923902048 1:238336582-238336604 ATGGCATTGGAGAAGGGGGATGG + Intergenic
924623228 1:245680179-245680201 AAGGGAGGGCAGGGGAGGGAAGG - Intronic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
1062764248 10:48982-49004 ATGGGGGTGCGGATGAGGGTGGG - Intronic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1062812690 10:478125-478147 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
1064082402 10:12319348-12319370 AGGGGAGGGGAGGAGAGGGAAGG - Intergenic
1064082430 10:12319403-12319425 AGGGGAGGGGAGGAGAGGGAAGG - Intergenic
1064082442 10:12319428-12319450 AAGGGAGGGGAGGAGAGGGAAGG - Intergenic
1064136587 10:12755953-12755975 AGGGGAGTGGAGAAGAGACAGGG - Intronic
1064154701 10:12894339-12894361 AGGGGAGGGGAGAAGAGGGGAGG - Intergenic
1064478298 10:15715337-15715359 AGGGGAATGGAGGAGAGGGAGGG + Intronic
1064480519 10:15736031-15736053 ATGAGAGTAAAGAAGAGGAAAGG - Intergenic
1064778836 10:18810723-18810745 ATGGGAGCGGAGAGGAAGGATGG - Intergenic
1065327307 10:24560386-24560408 ATGGGAGCAGAAAAGAGGGAGGG - Intergenic
1065656719 10:27959180-27959202 AGGGGAGTGGAGAGGAGGGGAGG + Intronic
1067295489 10:44973150-44973172 GTGGGATGGCAGGAGAGGGAGGG - Intronic
1067440819 10:46308419-46308441 AGGGGAGTGGAGAGGAGGGGAGG - Intronic
1068669144 10:59707246-59707268 AGGGGAGGGCAGAGGAGGGGAGG + Intronic
1068669150 10:59707261-59707283 AGGGGAGGGGAGAGGAGGGAAGG + Intronic
1068687007 10:59881011-59881033 AAGGGAGTGCAGCAGGGGGTCGG - Intronic
1069245516 10:66200241-66200263 AGGGGAGGGGAGGAGAGGGAAGG + Intronic
1069449069 10:68501571-68501593 AGGGGAGGGAAGAGGAGGGAAGG + Intronic
1069684617 10:70309720-70309742 ACGGGAGTCCAGAGTAGGGAGGG - Intronic
1069755306 10:70771131-70771153 ATGGGAGTGGGGAGTAGGGATGG + Intergenic
1069864627 10:71494352-71494374 ATGTGACTCCAGCAGAGGGAAGG + Intronic
1069945036 10:71979611-71979633 GTGGAAATGCAGAAAAGGGAAGG - Intronic
1070089394 10:73269969-73269991 ATGGGACCGCTGTAGAGGGAAGG - Intronic
1070373826 10:75810045-75810067 ATGTGAGGGGAGAAGAGGGTAGG + Intronic
1070422790 10:76253499-76253521 AAGGGAGTGGAGAAGAGAGGGGG + Intronic
1070540613 10:77412672-77412694 AAGGGAGGGCAGAGGAGGCAGGG + Intronic
1070754618 10:78984351-78984373 CTGGGGGTGCATATGAGGGATGG + Intergenic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070855999 10:79608455-79608477 CTGGGAGTGGTGAAGAGAGATGG + Intergenic
1071994849 10:91137387-91137409 AGGGGAGGGGAGGAGAGGGAAGG + Intergenic
1072305492 10:94102715-94102737 ATGGGAGTGCAGCCCAGGGCTGG - Intronic
1072596637 10:96878782-96878804 AGGGGAGGGGAGAAGAGAGAAGG - Intronic
1073008480 10:100342165-100342187 ATGGGCCTCCAGAGGAGGGAGGG + Intergenic
1073080799 10:100859458-100859480 AGGGGTGAGCAGAGGAGGGAAGG - Intergenic
1073351797 10:102825200-102825222 AGCTGAGTGCTGAAGAGGGATGG + Intergenic
1073571060 10:104581519-104581541 GTGTGGGTGCAGTAGAGGGAGGG + Intergenic
1073592143 10:104767660-104767682 AAGGGAGTGGAGAAGGGGAAGGG - Intronic
1074318600 10:112380579-112380601 ATGGAAGTGGAGAAGGGGAATGG - Intronic
1074431785 10:113400802-113400824 AGGCCAGGGCAGAAGAGGGAGGG + Intergenic
1074659651 10:115638946-115638968 ACAGGAGTGGAGAAGAGGGTGGG + Intronic
1074772049 10:116741247-116741269 CTTGGAGTGCAGCAGAGGGTGGG + Intronic
1074928133 10:118094314-118094336 ATGGGAGGTCAGGAGAGGAAGGG + Intergenic
1074930920 10:118125117-118125139 ATGGGAGAGCAGCTGAGGGGTGG - Intergenic
1075500890 10:122973150-122973172 TTGGGGGTGAAGAAGAGGGAAGG + Intronic
1076134606 10:128036724-128036746 ATGGGAATGGAAAGGAGGGAGGG - Intronic
1076135659 10:128044316-128044338 GTGGGAGAGGAAAAGAGGGATGG + Intronic
1076369838 10:129945142-129945164 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
1076546808 10:131250927-131250949 ATGAGAGAGCTGCAGAGGGAAGG - Intronic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1077280470 11:1742733-1742755 ATGGGAGAGCAGGGCAGGGAGGG + Intronic
1077537529 11:3131647-3131669 ATGGGAGGACAGTAGATGGATGG - Intronic
1077743608 11:4875993-4876015 ATACGAGTGCCAAAGAGGGAAGG + Intronic
1077750141 11:4958188-4958210 ATTGAAATGCAGAAGAGGAAGGG - Intronic
1077769928 11:5206189-5206211 CTGAGAGTGTAGAGGAGGGATGG - Intergenic
1077782590 11:5347788-5347810 AGGAGGGAGCAGAAGAGGGAGGG + Intronic
1078736354 11:14024425-14024447 ATGGGGGGCCAGAAGAGGGATGG + Intronic
1079847361 11:25488544-25488566 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1082628359 11:55511797-55511819 AGGGGAGGGGAGAAGAGGGGAGG - Intergenic
1083249416 11:61455916-61455938 ATGGGTGTGCAGATGTGGGAAGG - Intronic
1083272399 11:61579068-61579090 ATGGGAGGAAAGAGGAGGGAGGG + Intronic
1084209683 11:67615243-67615265 CTGGGGGTGGAGCAGAGGGATGG - Intergenic
1084465690 11:69321622-69321644 ATGAGGGTGCAGCAGATGGAAGG + Intronic
1084517697 11:69645427-69645449 AAGGGTGTGCAGTAGTGGGAAGG - Intronic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1084572888 11:69970155-69970177 AGGGGAGGGCAAAGGAGGGAAGG + Intergenic
1084776856 11:71382772-71382794 AGTGGAGGGCAGAGGAGGGAAGG + Intergenic
1085198485 11:74686873-74686895 AGGGGTGTGGAGAAGTGGGAAGG + Intergenic
1085265449 11:75235481-75235503 AGGGGAGTGGAGGGGAGGGAAGG + Intergenic
1085401867 11:76240320-76240342 TCAGGAGTGGAGAAGAGGGAAGG - Intergenic
1085715323 11:78867488-78867510 ATGGGAGAGGGGGAGAGGGAAGG + Intronic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1087167145 11:95016372-95016394 ATGACAGAGCAGAATAGGGAGGG + Intergenic
1087685483 11:101258284-101258306 ATGGGGGGGCGGAAAAGGGAGGG - Intergenic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1089213283 11:116820573-116820595 ATGAGACTGCAGGAGAGGTAAGG - Intergenic
1089752159 11:120659684-120659706 ATGGGTGAGCAGAAGAGGAAGGG - Intronic
1089831132 11:121329179-121329201 CTGAGACTGAAGAAGAGGGAAGG - Intergenic
1090336906 11:125975022-125975044 ATGGCAGTGCACAGGAGGGAAGG - Intronic
1090443787 11:126746344-126746366 ATGGAAGTGCAGAGGAGAGTGGG + Intronic
1090893114 11:130945107-130945129 ATGGGAGCCCAGAGGAGAGAGGG - Intergenic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092092150 12:5812192-5812214 AAGGGAGGGAAGAAAAGGGAAGG + Intronic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092229505 12:6768799-6768821 ATAGGAATGGAGAAGAGGGAGGG - Intronic
1092953072 12:13525914-13525936 ATGGGAATACAGCAGAGAGAGGG + Intergenic
1094203581 12:27817386-27817408 AAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1094608826 12:31973652-31973674 ATGCCAGTGAAGGAGAGGGATGG + Intronic
1095345189 12:41141816-41141838 TTGGGGATGCAGGAGAGGGAAGG + Intergenic
1095516090 12:43007115-43007137 CTGAGAGTGAAGATGAGGGAGGG - Intergenic
1095787464 12:46125451-46125473 AGGGGAGGGGAGAAGAGGGGAGG + Intergenic
1095955058 12:47801151-47801173 ATTGGAGTCCAAAAGAGGGAGGG - Intronic
1096576247 12:52554605-52554627 ATGGGAGGGATGAGGAGGGATGG - Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097275014 12:57807240-57807262 ATTGGAGAGCAGAGGAGGGGTGG - Intronic
1097592650 12:61591043-61591065 ATGGTAGTGCAGGATATGGAAGG - Intergenic
1098027069 12:66214925-66214947 ATAGGAGTGGGGAAGAAGGAGGG + Intronic
1098073818 12:66704886-66704908 ATGGCAGTGTACAAGAGAGATGG - Intronic
1098116594 12:67184881-67184903 AGGGGAGGGGAGGAGAGGGAAGG + Intergenic
1098176575 12:67798384-67798406 AGAGGAGGGCAGAGGAGGGAGGG - Intergenic
1098908412 12:76185185-76185207 AGGGGAGGGGAGGAGAGGGAAGG - Intergenic
1099883758 12:88501506-88501528 ATAGGTGTGTAGTAGAGGGAAGG - Intronic
1100262897 12:92949556-92949578 AGGGGAGGGCAGGGGAGGGAAGG + Intergenic
1100263073 12:92950698-92950720 ATGGGAGGGGAGGGGAGGGAAGG + Intergenic
1100940628 12:99719670-99719692 ATGGTGGTGCAGAATATGGAAGG - Intronic
1101030282 12:100651490-100651512 GTGGAATTTCAGAAGAGGGAGGG - Intergenic
1101073395 12:101100317-101100339 ATAGGAGTGGAAATGAGGGAAGG + Intronic
1101157368 12:101940538-101940560 AAGGGAGGGGAGAGGAGGGAAGG + Intronic
1101262362 12:103045988-103046010 ATGGAAGTGAGGCAGAGGGATGG - Intergenic
1101509824 12:105382964-105382986 ATAGGAGTGCAGGAGAGGGAGGG - Intronic
1101605451 12:106245244-106245266 GTGAAAGTTCAGAAGAGGGAGGG - Intronic
1101812012 12:108115512-108115534 AGGGAAGTGAAAAAGAGGGAGGG - Intergenic
1101909496 12:108850732-108850754 AGGGGAGTGGGGAAGAGAGATGG + Intronic
1101952618 12:109188365-109188387 AGGGGAGGGCAGAAGAGGGGAGG - Intronic
1101965395 12:109278963-109278985 ATGGGTTTGCAGAAGTGGGGTGG + Exonic
1102299369 12:111759754-111759776 ATGGGAGTTCAGAGGAAGGCTGG + Intronic
1102393390 12:112567750-112567772 ATGGGTGGGCAGAGGAGGAAGGG - Intergenic
1102476782 12:113193884-113193906 ATGGGAAGGCAAAAGAGAGATGG - Intergenic
1102797112 12:115698252-115698274 AGGGGAGTGGAGAGGAGGGAAGG + Intergenic
1102920758 12:116789671-116789693 ATGGGAGGAGAGTAGAGGGATGG + Intronic
1102924580 12:116816916-116816938 AAGGGAGGGAAGAAGATGGATGG - Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103016701 12:117500232-117500254 ACCGGAATGCAGAAGGGGGATGG + Intronic
1104031693 12:125069430-125069452 ATGGCAGTGGAAAAGAGGGTGGG - Intronic
1104555769 12:129798682-129798704 ATGAATGTGCAGAAGAGAGAAGG + Intronic
1105032613 12:132894571-132894593 ATGGTGGTGCAGAATATGGAAGG - Intronic
1105934684 13:25088178-25088200 ATGGGTGTCCTGGAGAGGGATGG - Intergenic
1105934690 13:25088197-25088219 ATGGGTGTCCTGGAGAGGGATGG - Intergenic
1106112335 13:26787774-26787796 ATGGGTGTGCATTAGATGGAAGG - Intergenic
1107283085 13:38758432-38758454 GTGGGAGTTCACAAGAGTGAGGG - Intronic
1108790254 13:53961483-53961505 AAGGGAGGGCAGGGGAGGGAAGG - Intergenic
1108803585 13:54129216-54129238 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1110143986 13:72167336-72167358 CTGGGAGTGCAGCAGCGGGAGGG + Intergenic
1111462653 13:88566940-88566962 AGGGGAGGGAAGAGGAGGGAAGG + Intergenic
1111462661 13:88566960-88566982 AGGGGAGGGAAGAGGAGGGAAGG + Intergenic
1111634335 13:90884129-90884151 TTAGGAGTTCAGAAGAGGTAAGG + Intergenic
1112015212 13:95325897-95325919 AGGGGAGGGGAGGAGAGGGAGGG - Intergenic
1112900585 13:104352626-104352648 ATGGGAGGGGAGGGGAGGGATGG - Intergenic
1112970276 13:105253218-105253240 CTGGGAGAGCAGAGGAGTGAGGG + Intergenic
1113258000 13:108528648-108528670 AGGGGAGGGAAGAGGAGGGAAGG - Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114559939 14:23582329-23582351 GTGGGAGTAGAGAATAGGGATGG + Intergenic
1114993701 14:28319477-28319499 ATGGGGGTGGAAAAGAGGGAGGG + Intergenic
1115106104 14:29763445-29763467 AGGGGAGTGGAAAGGAGGGAAGG + Intronic
1115366214 14:32560004-32560026 ATAGGAGAGTAGAAGAGGAAAGG + Intronic
1116658072 14:47675372-47675394 ACGGGGGTGGGGAAGAGGGAAGG + Intergenic
1117046235 14:51816366-51816388 ATGGGAAGCCGGAAGAGGGATGG + Intergenic
1118073422 14:62271220-62271242 AGGGGAGTGGAGAGGAGGGGAGG - Intergenic
1118092474 14:62497631-62497653 AGGGCAGTGCAGAAGAGAAATGG - Intergenic
1119764385 14:77179271-77179293 AGGGGAGGGCAGGAGAGGGAAGG - Intronic
1119886565 14:78148490-78148512 CTGGGAGAGCAGAAGCGAGAAGG + Intergenic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120689205 14:87574058-87574080 ATGAGAATTCAGGAGAGGGAGGG - Intergenic
1120734991 14:88042682-88042704 ATGGGTTGGCAGAAGAGGAATGG - Intergenic
1121165375 14:91791194-91791216 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
1121664359 14:95660661-95660683 ATGGGAGGGGAGGAGGGGGAAGG - Intergenic
1121744606 14:96278420-96278442 ATGGGAGGGCAGGAGAGTGGGGG + Intergenic
1122100738 14:99407726-99407748 GTGGGAGTGCACAGGAGGGCAGG - Intronic
1122293173 14:100690381-100690403 ACGGGAGAGCGGATGAGGGAAGG + Intergenic
1122359441 14:101150861-101150883 AGGGGAGGGGAGAAGAGGGGAGG - Intergenic
1122487989 14:102094535-102094557 AAGGGCATGCAGGAGAGGGAGGG + Intronic
1122765654 14:104067806-104067828 ATGGTGGAGCAGAAGAGAGAGGG + Intergenic
1124199096 15:27661199-27661221 ATATGAGTCCATAAGAGGGAGGG - Intergenic
1125104133 15:35950773-35950795 ATGGTAATGCAGAAGGGGGCAGG - Intergenic
1125765004 15:42128829-42128851 ATAGGAGGGGAGAAGAGGGGAGG + Intergenic
1126117786 15:45224729-45224751 ATGGTTGGGCAGAAGAGGGTGGG - Intergenic
1126167665 15:45667124-45667146 AGGGGAGGGGAGAGGAGGGAAGG - Intronic
1126423231 15:48498051-48498073 GTGAGGGTACAGAAGAGGGAGGG - Intronic
1127044160 15:55008540-55008562 AGGGGAGAGCAGAGGAGGGAAGG - Intergenic
1127130405 15:55856280-55856302 ATGACAGGGCAGAAGAGAGAAGG + Intronic
1127603872 15:60566758-60566780 ATGGGAGTGAAGAAAAGCCAAGG + Intronic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1127983153 15:64048729-64048751 ATGTGCATGCAGAGGAGGGAAGG - Intronic
1128264339 15:66253827-66253849 CTGGGAGGGAAGGAGAGGGAGGG - Intergenic
1128478021 15:68013871-68013893 ATGGCAGTGCAGGAGAGGCGGGG + Intergenic
1128636742 15:69307461-69307483 AGGGGAGGGGAGAGGAGGGAAGG + Intronic
1128647138 15:69386436-69386458 ATGGGTTTGCAGAAGAGAGTGGG + Intronic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1129204462 15:74027822-74027844 ATGGCAGTGCTGCTGAGGGAAGG + Intronic
1129278525 15:74464429-74464451 ATGGCAGAGCAGGAGAGAGAGGG - Intergenic
1129326917 15:74805047-74805069 GTGAGAGTGGAGGAGAGGGAAGG + Intergenic
1129707853 15:77804923-77804945 ATGGGAGTGCTGAGAAGGGCTGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130681824 15:86003637-86003659 ATGGGAGAGGAGAAGATGCAGGG + Intergenic
1130730980 15:86491892-86491914 ATGGGAGTACAGAAAATAGAAGG + Intronic
1131111049 15:89765688-89765710 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1132070424 15:98771885-98771907 ATGTCAGTGGAGAAGAAGGAAGG - Intronic
1132325355 15:100964245-100964267 GGGGGTGTGCAGAGGAGGGAGGG - Intronic
1132374710 15:101321332-101321354 CTAGGAGTCCAGGAGAGGGAAGG - Intronic
1132774019 16:1581807-1581829 ATGGGAGTGGAGGGGAGGGGAGG + Intronic
1133061134 16:3175206-3175228 GTGGGGGTGGGGAAGAGGGAGGG - Intergenic
1133964359 16:10519703-10519725 AGGGGAGGGCAGGAGAAGGAAGG - Intergenic
1134690959 16:16190870-16190892 ATGGAGCTGGAGAAGAGGGAGGG + Intronic
1135143772 16:19943928-19943950 AGGTGAGTGCACAAGAAGGAAGG + Intergenic
1135776196 16:25258716-25258738 ATGGAATTGGAGAAGTGGGAGGG + Intergenic
1135916044 16:26606466-26606488 AGAGGAGAGCAGAAGAAGGATGG + Intergenic
1135953320 16:26935552-26935574 AGTCAAGTGCAGAAGAGGGAGGG + Intergenic
1136107415 16:28040103-28040125 ATGGGTGTGGAGAAGGGTGACGG - Intronic
1136470208 16:30474503-30474525 ATGGAAGTGCAGAACAGGGAAGG + Intronic
1137781845 16:51103973-51103995 AAGGGAGAACAGAAAAGGGAAGG - Intergenic
1137836136 16:51594370-51594392 AGGGGAGAGCAGGAGAGGCAAGG - Intergenic
1137914887 16:52419181-52419203 ATGGGACTGGACAAGAGTGAAGG - Intergenic
1138026067 16:53523446-53523468 AAGGGAGTGGGGAGGAGGGATGG - Intergenic
1138495597 16:57407226-57407248 ATGGCAGTGCAACTGAGGGAAGG + Intronic
1138739761 16:59294447-59294469 ATGGGAGCTCATAAGAGGCAAGG - Intergenic
1139355488 16:66364986-66365008 ATGGGAGCAGAGAAGTGGGAGGG - Intergenic
1139450832 16:67027289-67027311 GTGGGAGTGCAGAGCAGGGCAGG - Intergenic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140479870 16:75256782-75256804 AGGAGGGTGCAGAAGAGGAAGGG - Intronic
1140625599 16:76790265-76790287 AAGGCATTGGAGAAGAGGGAAGG - Intergenic
1140627210 16:76808509-76808531 ATGAGAGTTCTGAAGATGGATGG - Intergenic
1141844527 16:86598310-86598332 ATGGGAAGGAAGAGGAGGGAAGG - Intergenic
1141998397 16:87649055-87649077 GTGGCAGTGGAGACGAGGGAGGG + Intronic
1142027996 16:87824668-87824690 AGGGGGATGCAGAAGAGGGTGGG - Intergenic
1142322492 16:89393095-89393117 ATGCAGGTGAAGAAGAGGGAGGG - Intronic
1143262041 17:5606727-5606749 ATGGCAGTGAAGGAGGGGGAGGG + Intronic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1143704539 17:8687548-8687570 AAGGGAGTGGAGAAGAGGGGAGG - Intergenic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1144055070 17:11533402-11533424 GTAGGAGTGCAGATGAGAGACGG - Intronic
1144631047 17:16872670-16872692 AGGGGAGGGCACGAGAGGGAGGG - Intergenic
1144845782 17:18218128-18218150 ATGAGAGTGCAGGAGAAGGTGGG - Intergenic
1144877842 17:18411622-18411644 TTGGGAGAGGAGAAGAGGGTGGG - Intergenic
1145154387 17:20532800-20532822 TTGGGAGAGGAGAAGAGGGTGGG + Intergenic
1145868330 17:28254992-28255014 AAGGGAGTCCAGAAGAGTGAGGG - Intergenic
1146688392 17:34856815-34856837 ATGGGGGTGCGGAGGATGGAGGG + Intergenic
1146718137 17:35103453-35103475 CTGGGAGGTCAGCAGAGGGAAGG - Exonic
1146952839 17:36918754-36918776 ATGGGGGTGCACAGGAAGGAAGG - Intergenic
1147135290 17:38430467-38430489 ATGGGAGTGGGGGTGAGGGAGGG + Intronic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147566767 17:41541238-41541260 ATGGTGGGGCAGCAGAGGGAAGG - Intergenic
1147575143 17:41594650-41594672 AAGGGAATGTAGAAGAGGGATGG + Intergenic
1147862324 17:43530823-43530845 GTGGGAGTGCAGTGGGGGGAGGG - Intronic
1147923562 17:43933192-43933214 ATGGGAGTGGAAGGGAGGGAGGG - Intergenic
1147995894 17:44360152-44360174 AAGGGAGTGAGGACGAGGGAGGG + Intronic
1148382579 17:47210386-47210408 AGGGGTGGGCTGAAGAGGGAGGG + Intronic
1149526695 17:57361724-57361746 ATGAGAAGGAAGAAGAGGGATGG + Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150864160 17:68832031-68832053 TTAGGAGTGTAGAGGAGGGATGG - Intergenic
1150947610 17:69765399-69765421 AGGGGAGGGAAGAAGGGGGAGGG - Intergenic
1150947659 17:69765528-69765550 AGGGGAGGGAAGAAGGGGGAAGG - Intergenic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151294684 17:73176151-73176173 CTGGGAGGGCAGAAGAAGCATGG - Intergenic
1151463348 17:74268828-74268850 ATGGGAAGGCTGGAGAGGGATGG - Intergenic
1151524198 17:74652720-74652742 AGGGAACTGAAGAAGAGGGATGG - Intergenic
1151534405 17:74730550-74730572 CTGGTAGTGCTGAATAGGGAAGG + Intronic
1151573376 17:74938410-74938432 GTGGGAATGCTGACGAGGGAAGG + Intronic
1151953008 17:77365631-77365653 GAGCGGGTGCAGAAGAGGGAGGG + Intronic
1152255868 17:79239161-79239183 CTGGGAGTGCAGAAGAGGAGGGG - Intronic
1152369578 17:79878051-79878073 CTGTGAGGGCATAAGAGGGAAGG + Intergenic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1152793814 17:82296912-82296934 AGGGGGGTGGAGAGGAGGGAGGG - Intergenic
1152856654 17:82668503-82668525 ATGGGAGGGAAGCTGAGGGAGGG - Intronic
1152968136 18:135553-135575 ATGGGAGTGCAGAAAATACAGGG + Intergenic
1153829886 18:8912729-8912751 ATGGGAGGGCACCAGATGGAAGG + Intergenic
1154025312 18:10702050-10702072 ATAGGAGTGGAAAAGAAGGAAGG - Exonic
1155068929 18:22295876-22295898 AAGGGAAAGCAGAAGAGGAAAGG - Intergenic
1155217172 18:23653613-23653635 AGGGGAGGGGAGAAGAGGGAAGG - Intronic
1155257933 18:24014716-24014738 ACGGGAGGGAAGAGGAGGGAAGG - Exonic
1156491351 18:37498325-37498347 AGGGAAGGGAAGAAGAGGGAAGG - Intronic
1156530247 18:37808063-37808085 ATGGCAGAGCAGGAGAGAGAGGG - Intergenic
1156727012 18:40140680-40140702 ATGGGAGAGCGGAAGAGGGGAGG - Intergenic
1156843772 18:41639208-41639230 ATGGGAGGGGAGGGGAGGGAAGG + Intergenic
1157256608 18:46145186-46145208 TTTGGAATGCAGAAGAGGAAGGG + Intergenic
1157464228 18:47930581-47930603 AGGGGAGGGGAGGAGAGGGAAGG + Intronic
1158032071 18:52978046-52978068 AGGGGAGTGCAGAGAAGGGTGGG + Intronic
1158058681 18:53312888-53312910 AAGGGAGGGGAGAGGAGGGAAGG + Intronic
1158101648 18:53835793-53835815 ATGGCAGAGCAGGAGAGAGAGGG - Intergenic
1158147935 18:54336691-54336713 ATGGCAGAGCAGGAGAGAGAGGG - Intronic
1158157562 18:54443027-54443049 ATGAGAGTTGAGAAGTGGGATGG - Intergenic
1158305037 18:56095904-56095926 ATGGGACTGCAGAAGAGAGAAGG - Intergenic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158427372 18:57352363-57352385 GAGGGGGTGCAGGAGAGGGAGGG - Exonic
1158485090 18:57859094-57859116 TTGGCAGGGCAGAAGATGGAAGG - Intergenic
1158783313 18:60678204-60678226 ATGGGAGAGCAGAAGATAAAGGG + Intergenic
1158834667 18:61318039-61318061 ATGGGAGACCAGCAGAGAGAAGG - Intergenic
1158979656 18:62747502-62747524 AGGGGAGGGGAGAGGAGGGAAGG - Intronic
1159911409 18:74149899-74149921 AATGGGGTGCAGATGAGGGAAGG - Intronic
1160050714 18:75430864-75430886 CAGGGAGTGACGAAGAGGGAAGG - Intergenic
1160425424 18:78775606-78775628 ATGGAAGGGAAGAAAAGGGAAGG + Intergenic
1160505093 18:79422573-79422595 AGGGGAGTGAGGGAGAGGGAGGG + Intronic
1160800286 19:964489-964511 AGGGGCCTGCAGAAGAGGGAGGG + Intronic
1161063305 19:2226018-2226040 ATGGGAGAGGACAGGAGGGAAGG - Intronic
1161200010 19:3009432-3009454 AAGGGAGTGCAGAAAGGGAAGGG - Intronic
1161718367 19:5890102-5890124 AGGGGAGGGGAGGAGAGGGAGGG + Intronic
1162351090 19:10150196-10150218 GTGGCAGAGCAGAAGTGGGAGGG - Intronic
1162877079 19:13628326-13628348 AGGGGAGGGGAGAAGAGGGGAGG + Intergenic
1162877086 19:13628346-13628368 AGGGGAGAGGAGGAGAGGGAAGG + Intergenic
1162991097 19:14302646-14302668 ATGGGAGTGGAGGGGAGGGGAGG + Intergenic
1163174860 19:15557134-15557156 AGGGCAATGGAGAAGAGGGATGG - Intergenic
1163351167 19:16777459-16777481 AGGGGAGGGAAGAGGAGGGAAGG + Intronic
1164511823 19:28903906-28903928 TAGGGAGTGCAGAAGGGTGATGG - Intergenic
1164721258 19:30433230-30433252 ATGGGAGTGCAGGAGAGAGAAGG - Intronic
1165085944 19:33347644-33347666 TGGGGAGTTCGGAAGAGGGAGGG + Intergenic
1165295928 19:34925788-34925810 AGGGGAGTGCTGGGGAGGGAAGG - Intergenic
1165440674 19:35825156-35825178 AGGGGAGGGGAGAGGAGGGAAGG + Intergenic
1165752648 19:38270020-38270042 TTGGAAGTGCAGGAGAGGGCTGG - Intronic
1166063687 19:40343679-40343701 ATGGCAGTGGAGCAGAAGGAAGG - Intronic
1166409429 19:42546846-42546868 AGGGGAGGGGAGGAGAGGGAAGG + Intronic
1166533045 19:43553777-43553799 ATGGGTGTTCATGAGAGGGAAGG - Intronic
1166999831 19:46739200-46739222 ATGGCAGTGGAGAGGAGGGTGGG + Intronic
1167492395 19:49800246-49800268 ACGGCAGTGCAGGAGAAGGAGGG - Intronic
1167646847 19:50710654-50710676 AAGGGAGTGCTGAAGGGAGATGG - Intronic
1167689828 19:50978487-50978509 ATGGGGGTGGAAAAGAAGGAGGG + Intronic
1167689844 19:50978574-50978596 ATGGGGGTGGAGAAGAAAGAGGG + Intronic
1167732424 19:51268274-51268296 ACGGTGGTGCAGAAGAGGGAGGG + Intronic
1168249685 19:55134701-55134723 AGGGGAGAGGAGAAGAGGGGAGG + Intronic
1168249692 19:55134721-55134743 AGGGGAGAGGAGAAGAGGGGAGG + Intronic
1168249699 19:55134741-55134763 AGGGGAGAGGAGAAGAGGGGAGG + Intronic
1168403729 19:56100209-56100231 GTTGGAGTGCCAAAGAGGGAGGG - Intronic
1168562180 19:57393688-57393710 AGGGGAGGGCAGAGGAGGGGAGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925446456 2:3930268-3930290 ATGGGAGGGGAGGGGAGGGAAGG - Intergenic
925450859 2:3968298-3968320 AGGGGAGAGGAGAGGAGGGAAGG + Intergenic
925610134 2:5695909-5695931 ATGGGTGGGGAGAAGAGGCAGGG - Exonic
925626177 2:5843822-5843844 ATAGAAGTGCAGAGGAGGGCTGG + Intergenic
925644280 2:6020329-6020351 ATAGGTGTTCAGAGGAGGGAGGG + Intergenic
926323419 2:11764894-11764916 ATGGGACTGCAGAGGAGACAGGG + Intronic
926767350 2:16333877-16333899 ATGGGAGCAGAGAAGAGGAAGGG + Intergenic
927146921 2:20172361-20172383 GTTGGAGGGGAGAAGAGGGAGGG - Intergenic
927438460 2:23090607-23090629 AGGGGAGGGGAGAAGAGGGGAGG + Intergenic
927521317 2:23700105-23700127 ACGGGAGTGCTGATGATGGAAGG - Intronic
927606391 2:24490926-24490948 AGGGGAGGGCAGGAGAGGGGCGG + Intergenic
927627786 2:24741912-24741934 CTGGTAGTCCAGATGAGGGAGGG - Exonic
927747814 2:25638208-25638230 ATGGGATGGCAGGAGGGGGAGGG + Intronic
927929800 2:27036794-27036816 ATGGGAGGGCAGCAAGGGGAAGG + Intronic
928264753 2:29802315-29802337 ATGGGAGGGGAGAGGAGGGGAGG + Intronic
929071692 2:38038053-38038075 AATGGAGGGGAGAAGAGGGAAGG - Intronic
929112332 2:38415399-38415421 CTGGAAGAGCAGAAGAGTGATGG - Intergenic
929137531 2:38638848-38638870 ATGGGGGTACAAAGGAGGGAGGG + Intergenic
929237898 2:39625761-39625783 AGGGGAATGGAGGAGAGGGAAGG + Intergenic
929947025 2:46379466-46379488 ACAGGAGTGCTGAGGAGGGAGGG - Intronic
930178774 2:48329490-48329512 ATGGGAGTGCAGAATACAAAAGG - Intronic
930866221 2:56124488-56124510 ATGGTAGTTCAGCAGAGGGGTGG - Intergenic
931216909 2:60253774-60253796 GTTGGAGGGCAGAAGAGGGAAGG - Intergenic
931945496 2:67301984-67302006 ATGGAGGTGCAGCAGAGGAAAGG - Intergenic
931963226 2:67504482-67504504 GTGGTAGGGGAGAAGAGGGAAGG + Intergenic
932449994 2:71803426-71803448 CTGGGAAGGAAGAAGAGGGAGGG - Intergenic
932623317 2:73279603-73279625 AAGTAAGAGCAGAAGAGGGAAGG + Intronic
932690424 2:73908406-73908428 AGGAGAGTGAAGAGGAGGGAAGG + Intronic
932692011 2:73921308-73921330 AGGGGGGCGCAGAAGAGGAAAGG + Intergenic
933926046 2:87091931-87091953 AGGGGAGGGAAGAAAAGGGAAGG - Intergenic
934478074 2:94606016-94606038 ATGGGCGTGGAGACGAGGGCCGG + Intergenic
934650411 2:96088234-96088256 ATGGGGGTGCAGTGGAGGCAGGG + Intergenic
934929754 2:98412145-98412167 GGGTGAGTGGAGAAGAGGGAGGG + Intergenic
935065296 2:99642135-99642157 ATGAGGGGGCAGGAGAGGGAGGG + Intronic
935130746 2:100259117-100259139 TTGGGAATGCCGAAGAAGGAAGG + Intergenic
935137158 2:100317221-100317243 ATGGGAGGGAAGAATAGAGAAGG - Intronic
935231526 2:101102039-101102061 AGGGGAGTGGAGAGGAGGGGAGG + Intronic
936276394 2:111101571-111101593 ATTGGAGTGGGGAAGAGAGATGG + Intronic
937128645 2:119490415-119490437 AGGAGAGTGCAGGAGCGGGAAGG - Intronic
937135121 2:119545038-119545060 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937406495 2:121634125-121634147 ATGGGAAAACTGAAGAGGGATGG - Intronic
937670582 2:124533517-124533539 GTGGGTGTGGAGGAGAGGGATGG + Intronic
937834753 2:126460952-126460974 ATGGGAGAACAGGAGTGGGAGGG - Intergenic
938116637 2:128606930-128606952 ATGGGAGTCCAGGAGTGGCAGGG + Intergenic
938212655 2:129481625-129481647 AGAGGAATGCAGAAGAGTGATGG - Intergenic
940968864 2:159872148-159872170 TTGGGAATTCAGAGGAGGGAGGG - Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
942310815 2:174655153-174655175 ATGGGGGTGAATACGAGGGAAGG - Intronic
942492710 2:176506039-176506061 ATGGGAGAGCATCAGAGGCAAGG + Intergenic
942962146 2:181843670-181843692 ATGGATATGTAGAAGAGGGAGGG + Intergenic
943892733 2:193311057-193311079 TTTGGAGTGCAGAAGAGGCAGGG + Intergenic
944257790 2:197641401-197641423 CTGGGAGAGAAGAAGAGGGAGGG + Intronic
944634797 2:201665021-201665043 ATGGGGGTGATGAAGGGGGAAGG + Intronic
944926213 2:204467619-204467641 AGGGGAGGGGAGGAGAGGGAAGG + Intergenic
944986897 2:205187661-205187683 ATGGCTTTGCAGAAAAGGGAAGG - Intronic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945842489 2:214904791-214904813 TTTGGAATGCAGAAGAGGTAAGG + Intergenic
945906983 2:215604852-215604874 AGAGGAGTGGAGAATAGGGAAGG + Intergenic
946079647 2:217106543-217106565 AAGGGAGGGAAGAGGAGGGAAGG - Intergenic
946190525 2:218005421-218005443 ATAGGCTTGGAGAAGAGGGATGG - Intergenic
946635393 2:221719377-221719399 ATTGCAGTGGAGAAAAGGGAGGG - Intergenic
946682424 2:222230882-222230904 ATGGGAGTTGAGAAGAGGAAAGG - Intronic
947367316 2:229410026-229410048 ATGGGAGTGGTGAGGAGGGCAGG - Intronic
947873164 2:233450817-233450839 GTGGGAGGGCTGAGGAGGGAGGG - Intronic
948243319 2:236456709-236456731 ATGGGAGTGGGGTAGAGGGTGGG + Intronic
948249458 2:236514005-236514027 TTGGGAGTTTAGAAGAGAGAGGG + Intergenic
948318748 2:237052124-237052146 ATTGGACTGCAGGTGAGGGATGG + Intergenic
948647007 2:239411660-239411682 AGGACAGGGCAGAAGAGGGAGGG + Intergenic
948941834 2:241200705-241200727 AGGGGAGTCCAGAAGTGGCAGGG + Intronic
949072863 2:242036554-242036576 ATGGGGGAGCAGCAGAGTGAGGG - Intergenic
1170011356 20:11727615-11727637 TTTGGAGTGCAGAAGACTGATGG - Intergenic
1170391058 20:15874942-15874964 AGAGGAAAGCAGAAGAGGGAAGG + Intronic
1170516330 20:17134177-17134199 GTGGGAGTACTGAAAAGGGAAGG - Intergenic
1170579540 20:17687400-17687422 ATGGGAGTGGAGAAGGTAGAAGG + Intergenic
1170614104 20:17935231-17935253 ATGGGGATGAAGGAGAGGGATGG + Intergenic
1170823554 20:19774270-19774292 CTGGGATTGCTGAAGAGGGCAGG + Intergenic
1171086059 20:22239354-22239376 ATTGAAGTGCAGAGGAGGGAGGG - Intergenic
1171472004 20:25379594-25379616 AGGGGAGAGGAGAAGATGGACGG - Intronic
1171564252 20:26163621-26163643 ATGGGAGTGCTGGGAAGGGAAGG - Intergenic
1172079950 20:32332250-32332272 ATGGGACTGGAGTTGAGGGAAGG + Exonic
1172318546 20:33976863-33976885 AGGGGAGGGGAGAAGAGGAAGGG + Intergenic
1172357475 20:34290274-34290296 ATGGGAGTGCAGAGGAGTGCTGG - Intronic
1172749349 20:37239069-37239091 ATGGGAGGGAAGTGGAGGGAAGG + Intronic
1172888583 20:38247763-38247785 AAGAGGATGCAGAAGAGGGAAGG + Intronic
1172983597 20:38964095-38964117 ATGGAAGTATGGAAGAGGGAGGG + Intronic
1173216853 20:41093415-41093437 AGGGGAAAGAAGAAGAGGGACGG - Intronic
1173224151 20:41152122-41152144 ATGGGAGTGGGGAACTGGGAGGG + Intronic
1173370054 20:42427163-42427185 ATGGGGGAGAAGAGGAGGGATGG - Intronic
1173430408 20:42982741-42982763 GTGGGAGAGGAGCAGAGGGATGG - Intronic
1174158217 20:48531062-48531084 ATGGCAGCCCAGAAGAAGGACGG + Intergenic
1174539821 20:51280176-51280198 ATGGCAGAGCAGGAGAGAGAGGG + Intergenic
1174723599 20:52838924-52838946 AAGGGAGGGGAGGAGAGGGAAGG - Intergenic
1174759798 20:53195825-53195847 GAGGGAGGGCAGAAGAGAGAAGG - Intronic
1175129675 20:56779918-56779940 ATGGGAGGGGAGGGGAGGGAGGG - Intergenic
1175278606 20:57788087-57788109 ATGGGAGGGGTGGAGAGGGATGG + Intergenic
1175315525 20:58044170-58044192 GAGGGTGTGCAGCAGAGGGAGGG + Intergenic
1175491619 20:59384155-59384177 ATGGGAGTGGAGTGGCGGGAAGG + Intergenic
1175523598 20:59618587-59618609 AGGGAAGGGCAGGAGAGGGAAGG + Intronic
1175740978 20:61419624-61419646 CTAGGACTGCAGAAGAGGGGAGG - Intronic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1176383964 21:6127788-6127810 AGGGGAGGACAGAAGAGGAAAGG + Intergenic
1177897881 21:26875855-26875877 AGGGGAGTTGAGAACAGGGAGGG + Intergenic
1178252490 21:31017626-31017648 ATGAAAGTTCAAAAGAGGGAAGG + Intergenic
1178833090 21:36072589-36072611 AAGGGAGTGCACCAGAAGGAGGG + Exonic
1179739510 21:43410450-43410472 AGGGGAGGACAGAAGAGGAAAGG - Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180115274 21:45699387-45699409 ACTGGAGTGCAGTGGAGGGAGGG - Intronic
1181094585 22:20496480-20496502 ATGGGAGAAGAGGAGAGGGAGGG - Intronic
1181437456 22:22918982-22919004 CTGGGAGTCCAGGAGATGGAGGG - Intergenic
1181527890 22:23500517-23500539 AAGGGAGGGGAGAAGAGGAAGGG + Intergenic
1181924720 22:26348872-26348894 AGGGGAGTGAAGGGGAGGGAGGG + Intronic
1182618689 22:31605877-31605899 ATGGGACTCCATATGAGGGATGG - Intronic
1182830259 22:33299313-33299335 AGGGGAGGGGAAAAGAGGGAAGG + Intronic
1182937481 22:34239104-34239126 ATGGGAGTGCAAGAGAGGAGGGG + Intergenic
1183131036 22:35836357-35836379 TTGGGAGAAGAGAAGAGGGAGGG - Intronic
1183304187 22:37073333-37073355 ATTGGAGACCAGAAGATGGATGG + Intronic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183483820 22:38078755-38078777 CTGAGAGTGCAGGAGAGTGAGGG - Intronic
1183694544 22:39414237-39414259 TTGGTAGGGAAGAAGAGGGAGGG + Intronic
1184045410 22:41969771-41969793 ATGGGAGTGCAGTGAGGGGATGG + Intergenic
1184170627 22:42757494-42757516 CTGTGAGTGCAGAAGAGGCCAGG - Intergenic
1184955977 22:47886190-47886212 GTGGGAGTGTAGCAGAGAGATGG + Intergenic
949494589 3:4619757-4619779 AGGGGAGGGCAGAAGAGAGGAGG - Intronic
949803375 3:7927814-7927836 AGGGGAGAGTAGAAGAGGAATGG - Intergenic
949823333 3:8138707-8138729 AGGGGAGGGGAGAGGAGGGAAGG + Intergenic
950080266 3:10216846-10216868 AGGAGAGGGCAGAAGAGGGGTGG + Intronic
950188874 3:10962497-10962519 AAGGGAGAGGAGAAGAGGGTAGG + Intergenic
950492510 3:13314587-13314609 ATGGGAGCGCAGGAGGGGGCAGG + Intergenic
951624789 3:24647182-24647204 GTGAAAGGGCAGAAGAGGGATGG + Intergenic
951762470 3:26161700-26161722 ATGGTGGTGCAGAATATGGAAGG + Intergenic
951840061 3:27024648-27024670 CTGTAAGTGCAGCAGAGGGAAGG - Intergenic
951916136 3:27802776-27802798 GTGTTAGTGGAGAAGAGGGAAGG + Intergenic
952721883 3:36542080-36542102 AGGGGAGAGGAGAAGAGGAAAGG + Intronic
953035892 3:39210740-39210762 ATGGGGGTGCAAGAAAGGGAAGG - Intergenic
953520311 3:43636148-43636170 AGGGGAGTGAAGAAGAGAGATGG + Intronic
953604703 3:44404210-44404232 AGGGGAGTGCAGCAGAGGGTGGG - Intronic
953852763 3:46478614-46478636 AGGGGAGGACAGAAGAGGGTAGG + Intronic
953870127 3:46619112-46619134 ATGGGAGTGCAGAAGAGGGAGGG - Intronic
953894899 3:46789539-46789561 CGGGGAGTGGGGAAGAGGGAAGG + Intronic
954072606 3:48153991-48154013 ATGGGAGTGAGGGAGAGGGATGG - Intergenic
954250189 3:49361451-49361473 TTGGGAGTGGAGGAGAGGGAAGG + Intronic
954907860 3:54077941-54077963 ATGCCAGTGAAGGAGAGGGAAGG + Intergenic
955037343 3:55281968-55281990 AGGTGTGTGCTGAAGAGGGAGGG + Intergenic
955099300 3:55831440-55831462 AGGGGAGGGGAGAGGAGGGAAGG + Intronic
955988575 3:64601008-64601030 ATGGAACTGCAGGAGGGGGAGGG - Intronic
956073541 3:65480424-65480446 TTGGGGGTGCTGAAGAGGGAAGG + Intronic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956242577 3:67147121-67147143 AGGGGAGGGGAGAGGAGGGAAGG - Intergenic
956332134 3:68123192-68123214 TTGTGAGTGCAGAAGAGTGGAGG + Intronic
957253912 3:77812170-77812192 ATGGAAGGGCAAAAGAGAGAGGG + Intergenic
957683409 3:83469619-83469641 ATGAGAGAAGAGAAGAGGGAAGG + Intergenic
957734607 3:84189486-84189508 ATGGTAGTGCAGTATATGGAAGG + Intergenic
958422282 3:93942306-93942328 ATGGTAGTGCAGGATATGGACGG - Intronic
958452972 3:94296745-94296767 AAAGGAGTTCATAAGAGGGAAGG - Intergenic
959406777 3:105970484-105970506 ATGTGAGTGCAGTGGAGTGAGGG - Intergenic
959893309 3:111580652-111580674 AGGGGAGGACAGAGGAGGGAAGG - Intronic
959957810 3:112258898-112258920 ATGGCAGAGCAGGAGAGAGAGGG + Intronic
960128933 3:114032405-114032427 ATTGGTGAGCAAAAGAGGGATGG - Intronic
960396289 3:117141754-117141776 AGGGGAGGGAAGAGGAGGGAGGG - Intergenic
960569622 3:119172985-119173007 AAGGGAGGGAAGAAGAGGGGAGG + Intronic
960822895 3:121753003-121753025 AGGGGAAAGAAGAAGAGGGATGG + Intergenic
961591425 3:127984527-127984549 ACAGGAGAGCAGCAGAGGGAGGG + Exonic
961603675 3:128078191-128078213 ATGGGGGTACAGAAGGGGGCTGG - Intronic
961789603 3:129366144-129366166 ATTGGAGAGAAGGAGAGGGAGGG + Intergenic
961918176 3:130398868-130398890 TTGAGAGAGCAGAAAAGGGAAGG - Intronic
962415160 3:135175134-135175156 AGGGAAGAGCAGAAGAGGGCTGG - Intronic
962709024 3:138070141-138070163 GTGGGAGCTCAGAGGAGGGAGGG - Intronic
962826464 3:139104387-139104409 ATGGGAGTCCAGAGGAGGGGTGG - Intronic
963445057 3:145395295-145395317 ATGGCAGTGCAGAGAAGGGAAGG + Intergenic
963639412 3:147839787-147839809 ATTGGCGTGGAGAAGTGGGAAGG + Intergenic
963686983 3:148448161-148448183 ATGTGAAGGCAGAAGAGGGGAGG + Intergenic
964162274 3:153659716-153659738 ATGCAATTGCAGGAGAGGGAGGG - Intergenic
964212081 3:154239759-154239781 ATGGGAGTGCAGGAGAAAGAAGG + Intronic
964299941 3:155276499-155276521 ATGGTGGTGCAGAATATGGAAGG + Intergenic
964479182 3:157125156-157125178 AGGGGTGTGCAGCAGAGGGGAGG + Intergenic
965340723 3:167487885-167487907 AAGGCTGTGCAGAAAAGGGAAGG + Intronic
965394130 3:168141772-168141794 ATGGCAGAGCAGGAGAGCGAAGG + Intergenic
965515855 3:169620175-169620197 AGGGGAGTACAAAAGAAGGAAGG - Intronic
965698562 3:171436147-171436169 ATAGGAGTGGGGAAGATGGAGGG - Intronic
965824320 3:172715550-172715572 ATGGGAGTTCTGAAGTGTGATGG + Intergenic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
966331746 3:178822378-178822400 ATGGGAATAGAGAAGAGGGAAGG - Intronic
966597941 3:181742849-181742871 ATGGGAGGGTAGAAGAAGGGGGG + Intergenic
967341023 3:188398132-188398154 CAGGGAGTGTAGATGAGGGAAGG - Intronic
968134451 3:196211072-196211094 AGGGGAGTGCAGAAGACCGGGGG - Intronic
968136664 3:196224712-196224734 ATGGGAGGGGAGGAGAGGGGAGG + Intronic
968606658 4:1538511-1538533 GTGGGAGGGCAGAGGTGGGAGGG + Intergenic
968611370 4:1558647-1558669 AGGGGAGGGGAGAGGAGGGAAGG + Intergenic
969447468 4:7253458-7253480 AAGGCACTACAGAAGAGGGATGG + Intronic
969525317 4:7701252-7701274 GAGGGAGGGAAGAAGAGGGAGGG + Intronic
969593128 4:8133177-8133199 TTGGGAAGGGAGAAGAGGGAAGG - Intronic
969637287 4:8376740-8376762 ATGTGAGATCAGAAGAGGGCAGG - Intronic
970038147 4:11763579-11763601 AAGGGAGGGGAGGAGAGGGAAGG - Intergenic
970107797 4:12604608-12604630 CTGGGAATGCAGAAGAGTTATGG - Intergenic
970239484 4:13993492-13993514 ATGGGAGTGCAGGAGTGTGCAGG + Intergenic
970574149 4:17411543-17411565 ATGGGAGGGGAGGGGAGGGAAGG + Intergenic
971218080 4:24680540-24680562 AAGGAAGAGAAGAAGAGGGAAGG + Intergenic
971251427 4:24976019-24976041 AAGGGAGGGAAGGAGAGGGAGGG + Intronic
971331085 4:25681982-25682004 AGGGGAGAGGAGATGAGGGAAGG - Intergenic
971582296 4:28357280-28357302 ATGGGAAAGGAGGAGAGGGAAGG + Intergenic
971751627 4:30656904-30656926 ATGTGAATGGAGAAGAGGGTGGG + Intergenic
971784623 4:31084712-31084734 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
971986510 4:33831894-33831916 ATGGGATTGACGAAGAGGAAAGG + Intergenic
972634360 4:40870255-40870277 CTGCCAGTGCAGATGAGGGAGGG + Intronic
972670020 4:41206305-41206327 ATGGGAGTGGAGGGGAAGGAAGG - Intronic
972871263 4:43301843-43301865 GTGGGTGTGGAGAAAAGGGAAGG - Intergenic
973692132 4:53446439-53446461 CTCAGAGTGCAGAAAAGGGAAGG - Intronic
974000739 4:56508281-56508303 AAGGGAATGGAGAAGAGGCAGGG + Intronic
974981535 4:68963699-68963721 CTTGGAATGCAGAAGAGGCAAGG - Intergenic
975867392 4:78738036-78738058 AGGGGAGTGAAGAGGAGGGGAGG + Intergenic
975867398 4:78738051-78738073 AGGGGAGGGGAGGAGAGGGAAGG + Intergenic
975910730 4:79263818-79263840 GTGGAAGTGAAGATGAGGGATGG - Intronic
976416002 4:84775659-84775681 ATTGGTGTCCAGAAAAGGGAAGG + Intronic
977465046 4:97373335-97373357 ATGGGAGTGGAATAGAGGCAAGG + Intronic
977600760 4:98931415-98931437 ATGGGAGGGGAGGGGAGGGAGGG - Intergenic
977630842 4:99240963-99240985 AAGGGAGTACAGAGGTGGGAGGG - Intergenic
977799486 4:101209432-101209454 AAGGGAGTTCAGAAGAGGTTGGG - Intronic
977989617 4:103425140-103425162 ATTGGAGTCTGGAAGAGGGAGGG + Intergenic
978160763 4:105545311-105545333 TTGTGATTTCAGAAGAGGGAGGG + Intergenic
978197691 4:105990317-105990339 ATGAGAGTTCAGAATGGGGAAGG + Intronic
978728623 4:111999325-111999347 AGGGGAGGGGAGAGGAGGGAAGG + Intergenic
978976340 4:114879478-114879500 AAGGGAATGGGGAAGAGGGATGG - Intronic
979188666 4:117831763-117831785 ATGGGAGGCCAGAAGGGGAATGG + Intergenic
980969960 4:139558434-139558456 GTGGGAGTGAAGGAGAGGGGAGG + Intronic
981107876 4:140901946-140901968 ATGGGAGTGGGGAAGAGGCAGGG + Intronic
982772384 4:159408797-159408819 ATGGGAGAGCAGGTGGGGGAAGG - Intergenic
983717674 4:170805271-170805293 ATGGGAGGCCAGAAGAGAGATGG - Intergenic
983999650 4:174224961-174224983 AGGGGAGGGGAGAAGAGGGGAGG - Intergenic
984628947 4:182040005-182040027 AGGGGAGGGGAGAAGAGGGCAGG + Intergenic
984628957 4:182040030-182040052 AGGGGAGGGCAGAAGAGGGCAGG + Intergenic
984628967 4:182040055-182040077 AGGGGAGGGCAGAAGAGGGCAGG + Intergenic
984628978 4:182040080-182040102 AGGGGAGGGGAGAAGAGGGCAGG + Intergenic
984628988 4:182040105-182040127 AGGGGAGGGCAGAAGAGGGCAGG + Intergenic
984628998 4:182040130-182040152 AGGGGAGGGCAGAAGAGGGCAGG + Intergenic
984629008 4:182040155-182040177 AGGGGAGGGCAGAAGAGGGCAGG + Intergenic
984629029 4:182040205-182040227 AGGGGAGGGGAGAAGAGGGCAGG + Intergenic
984629039 4:182040230-182040252 AGGGGAGGGCAGAAGAGGGCAGG + Intergenic
984629050 4:182040255-182040277 AGGGGAGGGGAGAAGAGGGCAGG + Intergenic
984661683 4:182381548-182381570 AGGGGAGGGGAGAAGAGGGGAGG - Intronic
984703988 4:182834592-182834614 AGGGGAGGGGAGAAGAAGGAGGG - Intergenic
984703995 4:182834611-182834633 AGGGGAGGGGAGAAGAAGGAGGG - Intergenic
984714865 4:182916759-182916781 AGGGAAGAGCAGGAGAGGGAAGG + Intronic
985078715 4:186243684-186243706 ATGGTGGTGCAGAATATGGAAGG + Intronic
985653030 5:1115804-1115826 AGGGCAGAGCAGAAGAGAGAGGG + Intergenic
985944354 5:3165454-3165476 ACGGGAGTGCTGAGGAGTGAAGG + Intergenic
986253170 5:6079774-6079796 TCGGGACTGCAGAAGAGGAATGG + Intergenic
986386479 5:7238842-7238864 ATGGGAGTGCAGAAGGCCCAAGG + Intergenic
987142238 5:14958231-14958253 AGGGGAGGGGAGGAGAGGGAAGG - Intergenic
989001223 5:36762732-36762754 ATGGGGGTGCAGCATAGGGCAGG + Intergenic
989009767 5:36856704-36856726 ATGGGACTGCAGAAAAAGCATGG - Intergenic
989266941 5:39486082-39486104 ATGAGTGTGCTGAAGAGGGCAGG + Intergenic
989424072 5:41275445-41275467 TGGAGAGTGCAGAAGAGTGAGGG - Intergenic
989661410 5:43802347-43802369 TTGGGAGTGAAGAAGACTGAGGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990457824 5:56005150-56005172 AGGGGAGGACAGAGGAGGGAAGG - Intergenic
990495302 5:56341574-56341596 CTCAGAGTGCAGAAGAGGCAGGG + Intergenic
990746873 5:58967551-58967573 ATTGGAGAGCAAAAGAAGGAAGG + Intergenic
990861763 5:60335280-60335302 ATGAGAGAGTAGAAAAGGGAAGG + Intronic
992323254 5:75635257-75635279 ATGGGAGGAGAGAAGAGGGGTGG - Intronic
992658619 5:78935918-78935940 AGGGGAGTGGAGGAGAGGGGAGG - Intronic
992745391 5:79815579-79815601 AGGGGAGGGGAGAAGAGGGGAGG - Intergenic
992869033 5:80987582-80987604 GTGGGAGAGCAGACAAGGGAGGG + Intronic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993384881 5:87251945-87251967 TTGGGAGTGGAGAAGCGTGAGGG - Intergenic
993390326 5:87313109-87313131 ATGGGAGTTCAGAGTAGGGGAGG + Intronic
993650330 5:90512354-90512376 ATGAGAGTACATAAGAGAGATGG - Exonic
994294814 5:98078178-98078200 ATGGGGTTGAAGAGGAGGGAGGG + Intergenic
994958453 5:106565388-106565410 AGGGGAGAGAAGACGAGGGAAGG - Intergenic
995402959 5:111762098-111762120 ATGGGAAAGGAAAAGAGGGAAGG + Intronic
996053872 5:118963766-118963788 TTAGGAGTGCAGAGGTGGGAGGG - Intronic
996090892 5:119350821-119350843 ATGAGTGTGGAGATGAGGGAAGG - Intronic
996508987 5:124298145-124298167 ATGGGAGTGTGAAACAGGGAAGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997198373 5:131994647-131994669 TGGGGTGTGGAGAAGAGGGAAGG + Intronic
997223825 5:132193961-132193983 CTGGGAGTGGAGATTAGGGATGG - Intronic
997440707 5:133906948-133906970 AAGGAAGTGGAGAAGAGGGCGGG + Intergenic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
997678516 5:135733054-135733076 ATGGTGGTGCAGAATATGGAAGG + Intergenic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
998168776 5:139859913-139859935 CTGGCAGTGCAGAAGAGCGAGGG + Intronic
1000021512 5:157322887-157322909 ATGGGAGGGCAGGAGAGACAGGG - Intronic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000607214 5:163338028-163338050 ATGGTGGTGCAGGAGATGGAAGG - Intergenic
1000645327 5:163754591-163754613 TTTGGAATGCAGAAGAGGCAAGG - Intergenic
1000721953 5:164719137-164719159 ATGGGAGTGGAGGGGAGGAAAGG - Intergenic
1000727030 5:164784423-164784445 ATGGGAGGGGAGGACAGGGAGGG + Intergenic
1001266514 5:170278333-170278355 ATGGGAGTGCAGGGGGGGGCTGG + Intronic
1001651443 5:173318878-173318900 ATGGAAGAGCTGAAGTGGGAGGG + Intronic
1001753804 5:174150903-174150925 ATGGGAGGGGAGGACAGGGAGGG + Intronic
1001759541 5:174195699-174195721 GTGGGAATGCAGGAGAGGAAAGG + Intronic
1002090588 5:176803195-176803217 ATGGGAGCCTGGAAGAGGGAGGG + Intergenic
1002398066 5:178973162-178973184 ATGGGAGGGGAGAGGAGGGAAGG - Intergenic
1002593300 5:180305786-180305808 CTTGGAGTGCAGTAGAGGCAAGG - Intronic
1002723539 5:181280646-181280668 AAGAGCGTGCAGAAGAGGGAGGG - Intergenic
1003061372 6:2865328-2865350 AGGGGAGTGCAGGGGAGGGGAGG - Intergenic
1003100091 6:3170416-3170438 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1003160127 6:3627488-3627510 ATGGGAGTGCAGTGGAAAGATGG - Intergenic
1004278068 6:14255566-14255588 ATGGATGGGCAGATGAGGGAGGG + Intergenic
1005291559 6:24384461-24384483 GTGGGAGTGTAGAGGAGGGATGG - Intergenic
1005784174 6:29225926-29225948 TTGGGAGTGAAGAAAAGGAAAGG - Intergenic
1005942685 6:30572425-30572447 ATGGGACTGTAGAAGAGAGGAGG + Intronic
1007278531 6:40693154-40693176 ATGGCAGTGAAGAAGAGGGATGG - Intergenic
1007292536 6:40798402-40798424 CTGGGAGAGAGGAAGAGGGAGGG + Intergenic
1007385410 6:41517156-41517178 GTGGGAGAGCAGAGGAGGCAGGG + Intergenic
1007710278 6:43818504-43818526 ATGGGGGTGCAGAGAAGGGCTGG + Intergenic
1007811182 6:44486861-44486883 ATGGGAGCCCAGAACAAGGAGGG - Intergenic
1007907412 6:45476197-45476219 ATGAGAATGCAGAAATGGGATGG + Intronic
1008497208 6:52145468-52145490 ATGGGAGAGGAGGAAAGGGAGGG + Intergenic
1009734824 6:67663010-67663032 ATGGCAGTGCAGCAAGGGGAGGG + Intergenic
1010083291 6:71887430-71887452 ACTGGGGTGCAGAGGAGGGATGG + Intronic
1010656143 6:78514134-78514156 ATGGGACAGCAGGAGAGGGAAGG - Intergenic
1011389677 6:86838195-86838217 TTTGGGGTGCAGAAGAGGCAGGG + Intergenic
1012042960 6:94233893-94233915 AGCAGAGTGCAGCAGAGGGAAGG + Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1013393747 6:109713560-109713582 ATGGCAGTGCAGCTGAAGGAGGG + Intronic
1014634467 6:123828141-123828163 ATGTGAGTGCAGAGGAAGGATGG - Intronic
1015489782 6:133812446-133812468 AGGGGAGGGAAGAGGAGGGAAGG + Intergenic
1015489795 6:133812476-133812498 AGGGGAGGGAAGAGGAGGGAAGG + Intergenic
1015489808 6:133812506-133812528 AGGGGAGGGAAGAGGAGGGAAGG + Intergenic
1015506296 6:133992365-133992387 ATTAGAGTGAAGAAGTGGGAGGG + Intronic
1015892558 6:137983243-137983265 ATCGGAGTGGGGAGGAGGGAGGG - Intergenic
1016033632 6:139362677-139362699 CTGGTGGTGAAGAAGAGGGAAGG + Intergenic
1016464095 6:144308746-144308768 ATAGGGATGCAGAAGAGAGAAGG - Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017245848 6:152223654-152223676 AAGGGAGGGGAGAAGAGGGGAGG + Intronic
1017626950 6:156358612-156358634 AGGGGAGTGTCGAAGAGGGAAGG + Intergenic
1017679322 6:156847442-156847464 ATGGGAGATCTGAAGTGGGAAGG + Intronic
1018237221 6:161738371-161738393 ATGTGAATTCAGAAGATGGAGGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018470702 6:164095451-164095473 GTGGGAGTGAAGGAGGGGGAAGG + Intergenic
1019339078 7:499867-499889 GTGGGATTGCAGAGCAGGGAGGG - Intronic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1019622480 7:1999405-1999427 AGGGGAGCGCAGTGGAGGGAGGG - Intronic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019846789 7:3510636-3510658 ATGGGAGGGAAGAAGGGGGGAGG + Intronic
1019932080 7:4230391-4230413 AAGGGAGGGCAGGGGAGGGAAGG + Intronic
1020179108 7:5907523-5907545 CTGAGAGTGAGGAAGAGGGAAGG + Intronic
1020223489 7:6260678-6260700 GTGGCATTGCAGAAGAGAGAAGG - Intronic
1020303825 7:6817346-6817368 CTGAGAGTGAGGAAGAGGGAAGG - Intronic
1020509132 7:9030568-9030590 ATGGGAGAGCAGAAGAAATAAGG + Intergenic
1020837876 7:13177189-13177211 GTGGGAAAGTAGAAGAGGGACGG - Intergenic
1021451605 7:20787239-20787261 GAGAGAGTGCAGAAAAGGGAGGG + Intergenic
1021656716 7:22880697-22880719 ATGGGAGGAAGGAAGAGGGAAGG - Intergenic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1022272357 7:28821205-28821227 ATAAGAGTGCAGAAAAGGGAAGG + Exonic
1022410790 7:30136692-30136714 GTGGCACTCCAGAAGAGGGATGG + Intronic
1022776156 7:33529598-33529620 ATGGGAGAGGAGGGGAGGGAAGG - Intronic
1023026951 7:36059420-36059442 ATTGGAGGGCAGAGGAGGCAGGG - Intergenic
1023296658 7:38721847-38721869 ATGGGACTGGAGAAGGGGAATGG + Intergenic
1023441138 7:40186207-40186229 AGGGGAGGGGAGAGGAGGGAAGG - Intronic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1023910088 7:44547721-44547743 AGGGGAGAGGAGAAAAGGGAAGG + Intergenic
1023916994 7:44597055-44597077 AAGGGAGGGGAGGAGAGGGAGGG + Intergenic
1023979884 7:45062934-45062956 GTGGAAGGGCAGGAGAGGGAAGG + Intronic
1024361836 7:48476491-48476513 TTTGGAATGCAGAAGAGGCAGGG + Intronic
1024911916 7:54456248-54456270 ATGAGAATGAAGAGGAGGGAAGG + Intergenic
1024966360 7:55025462-55025484 ATGGGACTGCAGGGAAGGGAAGG + Intronic
1025094656 7:56087777-56087799 CTGGGAGTGCAGAGGACAGATGG + Intronic
1025710419 7:63902654-63902676 ATGGCAGAGCAGAGGAGGGTCGG - Intergenic
1025971441 7:66329941-66329963 ACAAGAGGGCAGAAGAGGGAAGG + Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026168360 7:67931367-67931389 TTGGGAGTCCAGATGAAGGATGG - Intergenic
1026431837 7:70355550-70355572 ATGGGCGTCCAGGAGAGAGAGGG - Intronic
1026463458 7:70634193-70634215 TTGGGAGTGCTGGAGTGGGAAGG + Intronic
1028054605 7:86226326-86226348 ATGGGAGTGAGGCTGAGGGAAGG - Intergenic
1028946789 7:96589167-96589189 ATGGGAAGGCAGCAGAGGGCAGG - Intronic
1029088297 7:98028565-98028587 AGGTGAGTGCAGAAGGGTGAAGG + Intergenic
1029131630 7:98335786-98335808 ATGGGACTGAAGCTGAGGGAAGG - Intronic
1029199484 7:98829081-98829103 AGGGGAGGGGAGGAGAGGGAAGG + Intergenic
1029282031 7:99441529-99441551 ATGGGGATGAAGAGGAGGGATGG - Intronic
1029620612 7:101688082-101688104 CTGGGAGTGCAGCAGGGGGGTGG - Intergenic
1029648192 7:101871582-101871604 ATGGGAGTGCAAGAGCCGGAAGG + Intronic
1029992277 7:104973253-104973275 AGGGGAGGGGAGAAGAGGGGAGG + Intergenic
1030272358 7:107684361-107684383 AAGGGAGTGGAGGGGAGGGAAGG + Intronic
1030280627 7:107770985-107771007 ATGGGAGAGCATTATAGGGATGG + Intronic
1030783083 7:113625755-113625777 AGGGGAGGGGAGAAGGGGGAAGG - Intergenic
1030956076 7:115854540-115854562 TATCGAGTGCAGAAGAGGGAAGG + Intergenic
1031126852 7:117783711-117783733 ATGGGAGTGCAGAAAAAGAGAGG - Intronic
1031509405 7:122630472-122630494 ATGGGATACCAGAAGAGGCAGGG + Intronic
1031777653 7:125921963-125921985 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1031860804 7:126978157-126978179 ATAGGAGGGGAGAGGAGGGAAGG + Intronic
1032876457 7:136043799-136043821 TTGTGATTGCAGAAGAGTGAGGG + Intergenic
1032929977 7:136655023-136655045 AGGGGAGAGCAGAAGAGGGGTGG + Intergenic
1033380933 7:140818152-140818174 ATGGGTGTCCAGCAGAGGAATGG + Intronic
1033825691 7:145186953-145186975 AGGGGAGGGCAGGGGAGGGAGGG - Intergenic
1034075970 7:148231549-148231571 ATGAGAATGAAAAAGAGGGAGGG - Intronic
1034189075 7:149199789-149199811 ATGGGAGTGGGGAAGTGGGCAGG - Intronic
1034366288 7:150551425-150551447 ATGGCAGTGCAGATCAGGGGAGG - Intergenic
1034419740 7:150983379-150983401 AGGGGTGTTCAGAAGAAGGAGGG + Intergenic
1035016915 7:155774696-155774718 ATGGGAGGGCACAGGAAGGAGGG - Intronic
1035898431 8:3431241-3431263 ATGGGAGGGAAGGTGAGGGATGG - Intronic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036461807 8:8960098-8960120 AGGGCAGTGCAGAAGGGAGATGG - Intergenic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1036928011 8:12926203-12926225 ATTGGAGAGCAGGAGAGAGAGGG + Intergenic
1036971720 8:13362653-13362675 AGGGGGGTGTGGAAGAGGGAAGG + Intronic
1037223495 8:16554556-16554578 AGGGGAGTGGAGGGGAGGGAAGG + Intronic
1037537855 8:19843640-19843662 ATGGGATTGCAGAGAAGGAAAGG - Intronic
1037719129 8:21427917-21427939 ATGGGAATGGAGAAGGGAGAAGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1038089099 8:24233838-24233860 ATGGCAGAGCAGGAGAGAGAGGG - Intergenic
1038190781 8:25318463-25318485 AGGGGAGTGGAGAGGAGAGAAGG - Intronic
1038249221 8:25887270-25887292 ATAGGAGTTCAGCAGAGGAAAGG - Intronic
1038499164 8:28029186-28029208 AAGCGAGTGCAGAAGGTGGAAGG - Intronic
1038865620 8:31436080-31436102 TTTGGAATGCAGAAGAGGCAGGG - Intergenic
1038929772 8:32179985-32180007 ATGGAAGTATAGAAGAGGAATGG - Intronic
1039391239 8:37182470-37182492 ATGGGAGTGTGGAAGAGCCAAGG - Intergenic
1039411855 8:37361334-37361356 TTAGGAGTCCAGAAGAGAGAAGG + Intergenic
1039579923 8:38657025-38657047 GCTGGAGTGAAGAAGAGGGAGGG + Intergenic
1039638634 8:39194346-39194368 ATGGTGGTGCAGCAGAGGGATGG + Intronic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1040026400 8:42786196-42786218 ATGGGAGGGGAGGAAAGGGAAGG + Intronic
1040582547 8:48709065-48709087 TTGGGAGGGGACAAGAGGGAGGG - Intergenic
1040657962 8:49534491-49534513 CTTGGAGTTCAGAAGAGAGATGG - Intergenic
1041157534 8:55004022-55004044 GGGGGAGTGGGGAAGAGGGAAGG - Intergenic
1041450124 8:57996687-57996709 AAGGGAGTGCAGGGGAGGTAAGG - Intronic
1042289067 8:67148562-67148584 ATGGGAGTTCAGAATCAGGAAGG - Intronic
1042885339 8:73543620-73543642 ATGGTAGTGTGGAAGAGGGGAGG - Intronic
1044048720 8:87472433-87472455 ATGGGTGTGCAGAAAAGGGTAGG + Intronic
1044571487 8:93723778-93723800 AGGGGAATGCAGAAGAAAGATGG + Intronic
1044647986 8:94464890-94464912 GAGGGAGAGCAAAAGAGGGAGGG + Intronic
1044911827 8:97068016-97068038 ATGAGAGTGCAGACGGGGGGTGG + Intronic
1045052542 8:98340257-98340279 ATGGGAGGGAAAAAGAGGGAGGG + Intergenic
1045252184 8:100491464-100491486 CTGGGACTGCAGGAGAGGGATGG + Intergenic
1045399692 8:101800952-101800974 AGGGGAGGGGAGAAGAGGGGAGG + Intronic
1045814533 8:106264271-106264293 ATGAGAGTGGACAAGAGGGATGG - Intergenic
1046688535 8:117255732-117255754 AAGGCTGTGCAGAAAAGGGAGGG + Intergenic
1047252495 8:123191519-123191541 TGGGGAGTGCAGAGGAGGAAGGG - Intronic
1048287755 8:133154840-133154862 AGGGGAGGGCAGGGGAGGGAAGG + Intergenic
1048671717 8:136730290-136730312 ATGGCAGGCCAGAAGCGGGATGG + Intergenic
1048682160 8:136855170-136855192 AAGGAAGTAAAGAAGAGGGAAGG + Intergenic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1049258472 8:141626244-141626266 ATGGGTGGGCAGATGAGGAAGGG + Intergenic
1049428783 8:142549698-142549720 CTGGGAGTGCATAAGTGGGAGGG + Intergenic
1049489824 8:142890000-142890022 ATGAGACAGCACAAGAGGGATGG + Intronic
1050189531 9:3010279-3010301 ACGGGAGTGTGGAAGAAGGAAGG - Intergenic
1050302802 9:4276320-4276342 AGGGGAGGGGAGGAGAGGGAAGG + Intronic
1050920071 9:11189083-11189105 ATGGCAGTGAAGAAGTGAGATGG - Intergenic
1050985436 9:12076548-12076570 AGGGGAGTGGAGAGGAGGGGAGG - Intergenic
1051021944 9:12555462-12555484 TTGGGAGTGCAGGAAAGAGATGG + Intergenic
1051164594 9:14248288-14248310 AGGGGAGTGGAGGAGAGGGGAGG - Intronic
1051738152 9:20224680-20224702 AAGGCAGAGAAGAAGAGGGAGGG + Intergenic
1051809133 9:21030885-21030907 CTGGGAGTTCAGAAGAGTGACGG + Intronic
1052112741 9:24608956-24608978 AAGGGAGGGTAGAAGGGGGAGGG - Intergenic
1053293340 9:36896567-36896589 AAGGGAGGGCTGGAGAGGGATGG - Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1054453972 9:65420231-65420253 ATGGGAGGGGAAAGGAGGGAGGG + Intergenic
1056168358 9:83959539-83959561 AAGGGAGTGCAGTTGAGAGATGG - Intergenic
1056832320 9:89927294-89927316 ATGGGAGAGAGGAAGAGTGATGG - Intergenic
1057141664 9:92730073-92730095 GTGGGAGGGAAGGAGAGGGATGG - Intronic
1057295190 9:93830535-93830557 AAGGGGGTGCAGAGGAGGAAGGG - Intergenic
1057311946 9:93948449-93948471 AGGGGAATCCAGAACAGGGAAGG + Intergenic
1057708683 9:97417500-97417522 ATGGAAGTGGTGAAGAGTGAAGG + Intronic
1057967406 9:99517679-99517701 AGGGGCTTGGAGAAGAGGGAGGG - Intergenic
1058428823 9:104900067-104900089 ATGGGGGTACAGGAGAGGCAGGG + Intronic
1058715954 9:107722186-107722208 AGGGGAGTGAAGAGGAGGGGGGG - Intergenic
1058730771 9:107847558-107847580 ATGGAGGTGCAGTAGAGGGCAGG - Intergenic
1059245697 9:112848057-112848079 ATGGGTGTGTAGAGGAGGGCAGG + Intronic
1059429362 9:114240716-114240738 ACGAGGGTGCAGAGGAGGGAGGG - Intronic
1059557884 9:115299742-115299764 GTGGCAGTGCAGAAGGGGAAAGG + Intronic
1059667545 9:116463057-116463079 ATGGGAGTGAGACAGAGGGAAGG - Intronic
1059768491 9:117405945-117405967 ATGGGTGCTTAGAAGAGGGAAGG + Intronic
1059931900 9:119269170-119269192 TTGGGAGTGCCAAGGAGGGAGGG - Intronic
1060183213 9:121547920-121547942 ATGGGAGTGGAGAAGGGAGATGG - Intergenic
1060234886 9:121855634-121855656 ATGGGCGTTCAGAGGAGGGGAGG + Intronic
1060259990 9:122066027-122066049 ATGGGGGTGGAGTAGAAGGAGGG + Intronic
1060264183 9:122100880-122100902 ATGGGTGTGCAGAAGTGGAAAGG - Intergenic
1060432686 9:123564023-123564045 ACGGAACTGCAGAGGAGGGAGGG + Intronic
1060528147 9:124332082-124332104 AGGGGAGGGAAGGAGAGGGAAGG + Intronic
1060763655 9:126276671-126276693 CTGGGAGTGCTGGACAGGGAAGG + Intergenic
1061083467 9:128385877-128385899 GGGGGCGGGCAGAAGAGGGAGGG + Intronic
1061347755 9:130041174-130041196 TTGAGGGTGCAGAAGTGGGAAGG - Intronic
1061481270 9:130898782-130898804 GTGGGTGGGTAGAAGAGGGAGGG - Intergenic
1062319413 9:135983092-135983114 CTTGGAGTGCAGGAGAGGGGAGG - Intergenic
1062546668 9:137066657-137066679 CTGGGTGTGCAGAAGAGAGCTGG - Intronic
1203563690 Un_KI270744v1:76671-76693 ATGGGCCTGCAGAAGGGGAAGGG - Intergenic
1185537264 X:872693-872715 AGGGGAGGGGAGAGGAGGGAAGG - Intergenic
1186092750 X:6067375-6067397 ATGGTAGTGGAGAAAAGGAAAGG - Intronic
1186435427 X:9538923-9538945 AGGGCAGTGCAGCAGATGGAGGG + Intronic
1186472480 X:9832332-9832354 AGGGGTGTGCTGCAGAGGGAGGG - Intronic
1186725679 X:12355991-12356013 ATGGGAGGGGAGAAGAGGCCCGG + Intronic
1187505367 X:19874680-19874702 AAGGGAGAGCAGAAGTGGGGAGG + Intronic
1188985312 X:36763730-36763752 ATGGCAGAGCAGTAGAGAGAGGG + Intergenic
1189464294 X:41266654-41266676 CTTGGACTGCAGAAGAGGCACGG + Intergenic
1189630931 X:42952700-42952722 AGGGGAGGGGAGAGGAGGGAGGG - Intergenic
1189644753 X:43115976-43115998 AAGGAAGTGCAGAAGTGGCAAGG - Intergenic
1189728285 X:43990807-43990829 ATTGGAGTGCAGCAGGTGGAAGG - Intergenic
1189755942 X:44271377-44271399 AGGAGAGTGAAGAACAGGGATGG + Intronic
1190220349 X:48508909-48508931 ATGGGAGAGCAGGAGGGGGGCGG - Intergenic
1190528432 X:51351116-51351138 GTGGAAGTGCAAAAAAGGGATGG - Intergenic
1190939255 X:55025068-55025090 ACAGAAGTCCAGAAGAGGGAGGG + Intronic
1191162438 X:57345183-57345205 AGGGGAGGGGAGAGGAGGGAAGG - Intronic
1191689527 X:63925732-63925754 TTTGGAATGCAGAAGAGGCAGGG - Intergenic
1191805929 X:65133848-65133870 CTGGGAGTAGAGATGAGGGAGGG + Intergenic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1191979259 X:66907918-66907940 TTGGGAGTGAAGACGAGGGAGGG + Intergenic
1192358240 X:70423154-70423176 ATGGGAGGGAGGAAGCGGGAGGG - Exonic
1192362720 X:70449589-70449611 GTGGGAGGGCAGAGGAGGGGAGG + Intronic
1192556777 X:72096300-72096322 TTGGGAGTGAGGAAGAGGCAAGG + Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1194765415 X:97842661-97842683 GTGGCAGAGCAGAAGCGGGAGGG - Intergenic
1194954179 X:100160407-100160429 ATGGGAAAGCAGAAAAGGGCAGG - Intergenic
1195016777 X:100788801-100788823 ATGGTAGTGCAGGATATGGAAGG + Intergenic
1196205207 X:112931556-112931578 ATGGTAGTGAAGAAGATGGTAGG - Intergenic
1197591753 X:128418451-128418473 ATGGGAGAGTTGAACAGGGATGG - Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197727058 X:129783332-129783354 GTGGGAGTGCAGAGGGGGAAGGG - Intronic
1197986599 X:132272445-132272467 AGGGCAGTACAGAACAGGGAGGG - Intergenic
1198505298 X:137295259-137295281 ATGGGAGTGCACAAAAGGCTGGG - Intergenic
1198851107 X:140966256-140966278 TTTGGAATGCAGAAGAGGCAAGG - Intergenic
1199493140 X:148423249-148423271 AAGGGAGGGTAGAAGAGGGGAGG + Intergenic
1199715727 X:150506267-150506289 AAGGGAGGACAGAAGAGGGGAGG - Intronic
1199862130 X:151810487-151810509 ATGTGATTAGAGAAGAGGGAGGG + Intergenic
1199899056 X:152155187-152155209 ATGGGAATATAGAAGAGGAAAGG - Intergenic
1200089446 X:153627549-153627571 AGGGGAGTGGAGAGGAGAGAGGG - Intergenic
1200133220 X:153862592-153862614 ATGGGCCTGCTGGAGAGGGAGGG + Exonic
1201146280 Y:11067066-11067088 AAGGGAGGGAAGGAGAGGGAGGG + Intergenic
1201146560 Y:11067950-11067972 AAGGGAGGGAAGGAGAGGGAGGG + Intergenic
1201323285 Y:12724927-12724949 ATGGGATTTCAGAAAAAGGAAGG - Intronic
1201955757 Y:19620817-19620839 ATGGAAGTTGAGAAGGGGGATGG - Intergenic
1202076207 Y:21040245-21040267 ATGGTAGTGCAGAATATGGAAGG + Intergenic