ID: 953878035

View in Genome Browser
Species Human (GRCh38)
Location 3:46677377-46677399
Sequence CAGCTGTAAGGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 425}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953878035_953878047 18 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878047 3:46677418-46677440 TCCCGCCCTGGCCAACAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 317
953878035_953878054 25 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878054 3:46677425-46677447 CTGGCCAACAGGCTGGGGCCTGG 0: 1
1: 0
2: 2
3: 41
4: 413
953878035_953878042 -9 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878042 3:46677391-46677413 TTACAGCTGGTTCCTTCCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 266
953878035_953878044 6 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878044 3:46677406-46677428 TCCTGTGGTTGATCCCGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 51
953878035_953878051 20 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878051 3:46677420-46677442 CCGCCCTGGCCAACAGGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 325
953878035_953878049 19 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878049 3:46677419-46677441 CCCGCCCTGGCCAACAGGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 189
953878035_953878046 14 Left 953878035 3:46677377-46677399 CCCTCTGCCCTCCCTTACAGCTG 0: 1
1: 0
2: 2
3: 47
4: 425
Right 953878046 3:46677414-46677436 TTGATCCCGCCCTGGCCAACAGG 0: 1
1: 0
2: 0
3: 25
4: 717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953878035 Original CRISPR CAGCTGTAAGGGAGGGCAGA GGG (reversed) Intronic
900490973 1:2949006-2949028 CAGGTGCCGGGGAGGGCAGACGG + Intergenic
900894130 1:5471046-5471068 CATCTGTGAGGTAGGGCTGAGGG - Intergenic
900954099 1:5876218-5876240 CAGCTGGGAGGGAGGGAGGAAGG + Intronic
901653641 1:10756813-10756835 GAGCTGTGAGGGCTGGCAGATGG - Intronic
901814774 1:11787888-11787910 GAGCTGGAAGGCAGGGCAGAGGG - Exonic
902828169 1:18991716-18991738 CAGCTATAGGGAAGGGCATATGG + Intergenic
903178407 1:21593659-21593681 CTGCTGTGAGGTAGGGGAGATGG + Intergenic
904286669 1:29457234-29457256 CAGCAGTAAGGGTGGGGAGGAGG - Intergenic
904404558 1:30277510-30277532 ATGCTGGAAGGGAGGGCAGAAGG - Intergenic
904832894 1:33316645-33316667 GGGCTGTCAGGGAGGGCACATGG + Intronic
904976732 1:34462224-34462246 CAGCTGTAAGGAGGGCGAGAGGG + Intergenic
906231002 1:44164307-44164329 CAGCAGTAAGGAAGGGAAGATGG + Intergenic
906943065 1:50272775-50272797 AAGATGGAAGGGTGGGCAGATGG + Intergenic
907339424 1:53724161-53724183 CAGTTGAGAGGGTGGGCAGATGG - Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907563582 1:55413480-55413502 AAGCTACAGGGGAGGGCAGATGG + Intergenic
907919157 1:58896789-58896811 CAGCTGGGAGGGAGGGAGGAAGG + Intergenic
909571872 1:77122340-77122362 CAGCTATAAGGAAGACCAGATGG - Exonic
911829264 1:102530118-102530140 AATCTGTCAGGGAGGGCAGCAGG - Intergenic
912232435 1:107810848-107810870 CAGTTGTAAGGAAAGGAAGATGG + Intronic
912457580 1:109808139-109808161 CAGCTGTGATTGAGTGCAGATGG - Intergenic
912836366 1:112999990-113000012 CAGCTTCCAGGGAGGGAAGAGGG - Intergenic
912968848 1:114261278-114261300 CATCTGTAAAGGACGGCAGTTGG + Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915108853 1:153550286-153550308 CAACTCTGGGGGAGGGCAGATGG - Intergenic
915452206 1:156013887-156013909 CAGATGAAAAGGAAGGCAGAAGG + Intronic
915472650 1:156135167-156135189 CAGCTGGAGGGGAGGACAAAGGG - Exonic
916028468 1:160855774-160855796 ACTCTGAAAGGGAGGGCAGAGGG + Intronic
916531552 1:165661112-165661134 CAGGTAAAAAGGAGGGCAGAAGG + Intronic
916795261 1:168161364-168161386 CAGCTGGAAGTGAGGGCAATGGG + Intergenic
917310065 1:173669613-173669635 CAGCCGCAAGGGATCGCAGAAGG - Intronic
918734170 1:188037807-188037829 CAGCTGGAATGCAGGGCACAAGG - Intergenic
919373729 1:196764334-196764356 CAGCTGCAAGTGTGGGGAGAGGG + Intergenic
919380170 1:196849011-196849033 CAGCTGCAAGTGTGGGGAGAGGG + Intronic
919936104 1:202251834-202251856 CACCTGGAAGGGAGAGGAGATGG + Intronic
919986795 1:202681231-202681253 CAGCTTTCAGGGATGGCAGTGGG - Intronic
920067928 1:203282295-203282317 AAGCTGGGAGGGAGGGCAGTGGG - Intergenic
920204851 1:204283958-204283980 CAGCTGTAGGGCAGGCCAGCAGG + Intronic
921048513 1:211494113-211494135 CAGCTGTCAGGGAGGGTCGTGGG - Intergenic
921155264 1:212433668-212433690 AAGCTGGAAGTGAGCGCAGAGGG + Intronic
921254889 1:213330168-213330190 CAGATGGATGGGAGGGGAGATGG - Intergenic
921482289 1:215677047-215677069 CAACGGTGAGGGAGGGAAGAGGG - Intronic
921582967 1:216916254-216916276 CAGCGGTCAGGGAGAGCTGAGGG - Intronic
921991550 1:221372638-221372660 CAGGTGAAAGGGAGGCCAGAAGG + Intergenic
922171589 1:223160008-223160030 CAGCTGTAGGGGACAGCATATGG - Intergenic
922354786 1:224765409-224765431 CTGCTGGAAGGAGGGGCAGATGG + Intergenic
922535008 1:226373169-226373191 CAGCTCTAAGGCAGGCCAGGAGG + Intronic
923610205 1:235485262-235485284 CAGCTGTGAGGGAGTGGAAAGGG - Intronic
1063264807 10:4435923-4435945 CATCTGTAAGAGAGGACATAGGG - Intergenic
1065816029 10:29483312-29483334 CAGCTGTAAGTCAGGGAAGGGGG - Intronic
1067513283 10:46912935-46912957 CAGCTTAGAGGGAGGGCAGCGGG + Intronic
1067525764 10:47037563-47037585 CAGCTGTTAGGGAAGGGAGGTGG - Intergenic
1067648969 10:48138907-48138929 CAGCTTAGAGGGAGGGCAGCGGG - Intergenic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1067827905 10:49592667-49592689 CAGCTATAAGGGAAGAGAGAAGG + Intergenic
1068811770 10:61263655-61263677 CATCTGAAAGGGAGGGCAGTGGG - Intergenic
1069198287 10:65581700-65581722 CAGCGCTAATGGAGGGCAAAGGG - Intergenic
1069889618 10:71644826-71644848 CACCTGCAAGAGAGGTCAGAAGG + Intronic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1070573987 10:77663321-77663343 CAGCTGTGGAGGAGGGGAGAAGG - Intergenic
1073103284 10:101018322-101018344 GAGCTGGAGGGGTGGGCAGAAGG + Intronic
1073111528 10:101065795-101065817 CAGCCCCAATGGAGGGCAGACGG - Intronic
1075400327 10:122156660-122156682 AAGCTGTAAGAAAGGGCAGCTGG - Intronic
1075652964 10:124142044-124142066 CAGCTTTATGGGTGGGCACAGGG - Intergenic
1075760083 10:124849050-124849072 CAGCTGTAAGAGGAGGCAGGAGG - Intergenic
1076307341 10:129474540-129474562 CAGATGCCAGGCAGGGCAGAGGG - Intronic
1076324240 10:129609028-129609050 CAGCAGTAAGAGAGGAGAGAAGG - Intronic
1076610617 10:131723681-131723703 CAGGTGTCAGGGACAGCAGATGG - Intergenic
1076666504 10:132095977-132095999 CTGCTGTTAGGGAGAGCAGGAGG + Intergenic
1077082376 11:729791-729813 CAGCTGTGGGGGAGGACAGAAGG - Intergenic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077191245 11:1256684-1256706 CAGCTGGAGGGGATGGCGGAGGG + Exonic
1077357327 11:2124490-2124512 GAGCTGTAATGGGGGGCAGATGG - Intergenic
1077370217 11:2178212-2178234 CAGCTGGAAGGAAGGGCATCCGG + Intergenic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1078078360 11:8182243-8182265 CAGCTGTAAGTGAGAGCATATGG + Intergenic
1078109455 11:8381029-8381051 CACCTGTAAGTGAGGACATAGGG - Intergenic
1079985998 11:27201506-27201528 CAACTGTAATGCAGAGCAGACGG + Intergenic
1080651349 11:34225185-34225207 TGGCCGTCAGGGAGGGCAGAGGG + Intronic
1080765152 11:35289171-35289193 CTGGTGTCAGGGAGGACAGAGGG - Intronic
1081150706 11:39627293-39627315 CAGCTGGAAAGCAGGGCACATGG + Intergenic
1081540490 11:44031239-44031261 CTGCTGGAAGGGATGGCAGGGGG - Intergenic
1081556829 11:44171781-44171803 CAGCTGTCAGGGTGGGTGGAAGG + Intronic
1081989529 11:47330359-47330381 CACCTGTAAGGGAACGGAGAGGG - Intergenic
1082006551 11:47422556-47422578 AAGCGGTAAGGGAGGGCCAAGGG - Exonic
1082176506 11:49066242-49066264 AAGCTGTAAGGGAGGGAAAAGGG - Intergenic
1083206207 11:61150761-61150783 CAGCTGAAAGGGAGTGGAGGAGG - Intronic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084083978 11:66846303-66846325 CAGCTGTGAGTGAGGGGACAAGG + Exonic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084487985 11:69462250-69462272 CAGCTGGCTGGGAGGGCAGAGGG + Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085195669 11:74670249-74670271 AAGCTCTGAGGGAGGGGAGAGGG - Intergenic
1085681087 11:78575457-78575479 TAGCTGTGTTGGAGGGCAGAGGG - Intergenic
1086437625 11:86798102-86798124 CAGCTGGAAGGAAGGGAAGAAGG - Intronic
1086446434 11:86875774-86875796 CAGCTGTGAGGATGTGCAGAAGG + Intronic
1086689207 11:89769633-89769655 AAGCTGTAAGGGAGGGAAAAGGG + Intergenic
1086716651 11:90070338-90070360 AAGCTGTAAGGGAGGGAAAAGGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087011348 11:93516955-93516977 CAGCTTTAAGGGAAGGTGGAAGG - Intronic
1088901339 11:114120124-114120146 AATCTGTAAGGGAGAGGAGATGG + Intronic
1089002067 11:115060256-115060278 CAGCTGCCAGGATGGGCAGAGGG - Intergenic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1089769072 11:120789708-120789730 CACCTGGCAGGGAAGGCAGATGG - Intronic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1090660123 11:128876253-128876275 CATCTCTAAGGGTGGGGAGATGG - Intergenic
1090977466 11:131689714-131689736 CTGCGGTATGGGAGGGGAGATGG - Intronic
1091528180 12:1327555-1327577 CAGTTGTAAGGGAGAGAAAAAGG - Intronic
1092408874 12:8239270-8239292 CACATGGAACGGAGGGCAGAGGG + Intergenic
1094451289 12:30585408-30585430 AACCTGTAAGAGAGGGGAGAGGG + Intergenic
1095888552 12:47214420-47214442 GTGCTGTAAGGGAGGGAAAATGG + Intronic
1100015311 12:90003209-90003231 CAGCTATGAGGGATTGCAGATGG + Intergenic
1100828835 12:98499591-98499613 CAGCTGTCTGGGAGGCCTGAGGG - Intronic
1101003195 12:100376669-100376691 TATCTGTAGAGGAGGGCAGAGGG + Intronic
1101660419 12:106760109-106760131 CAACTGTCAGGGAAGACAGATGG + Intronic
1102029998 12:109734846-109734868 CTGCTGTGAGTGAGGGTAGAGGG - Intronic
1103206042 12:119129946-119129968 CAGATGGAAGGAAGGACAGATGG + Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1104320779 12:127749020-127749042 CAGCTGTGATGGGGGGCGGAGGG - Intergenic
1104486021 12:129151710-129151732 CAGCTAAAAGGAAGAGCAGAGGG + Intronic
1105211118 13:18257748-18257770 TAGCCAAAAGGGAGGGCAGAGGG + Intergenic
1105578147 13:21671813-21671835 CTGCAGTAAGGGAGGGGAGTTGG + Exonic
1106546682 13:30737050-30737072 TAGCTGTATGGGTGGGCAGGTGG + Intronic
1107071337 13:36272856-36272878 CAGCTGCGTGGGATGGCAGAGGG + Intronic
1107432408 13:40351874-40351896 AAGCAATAAGGGAGGGGAGAAGG - Intergenic
1109068792 13:57736349-57736371 CATCTGTAAGGCAGGGTAGGCGG + Intergenic
1110404046 13:75128729-75128751 CAGGTCTAAGGGAGGGGAGGTGG + Intergenic
1111971752 13:94923979-94924001 CACCTGTAAAGGAGTGAAGAAGG - Intergenic
1112018771 13:95353505-95353527 CAGCACTAAGGGAGGACAGGTGG - Intergenic
1112483749 13:99801043-99801065 AGGGTGTAAGTGAGGGCAGAAGG + Intronic
1113985312 13:114310280-114310302 CAGCTGCCAGGGGTGGCAGATGG - Intergenic
1114528712 14:23381952-23381974 CAGCTGGCAGGAAGGACAGATGG + Intergenic
1118590961 14:67400619-67400641 TAGCTGGAAGGGAGTGGAGAAGG + Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121704883 14:95984041-95984063 CAGCTGTAAGGAAAGGAGGAAGG - Intergenic
1121812938 14:96907546-96907568 TGGCTGGAAGGAAGGGCAGATGG + Intronic
1122348481 14:101074559-101074581 GAGCTGTAAGGGAGAGGAGTGGG + Intergenic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1124604552 15:31160854-31160876 CAGCTGGGCGGAAGGGCAGAGGG - Intronic
1124921114 15:34027653-34027675 GAGCTGTCAGGGAGGTCAAATGG - Intronic
1124953658 15:34345834-34345856 CTGCTGTGGGGGAGGGGAGAGGG - Intronic
1125578574 15:40770655-40770677 GAGCTACAAGGGAGGCCAGATGG + Exonic
1126100590 15:45116104-45116126 CAGCTGTAGGGAAAGGCACACGG - Exonic
1126495897 15:49290304-49290326 CAGCTGTCATTGAGGGCATATGG + Intronic
1126859391 15:52869608-52869630 TAGCAGAAAGGAAGGGCAGAAGG + Intergenic
1126980559 15:54238021-54238043 CAGCTGGAAGGGGAGGAAGATGG - Intronic
1127173285 15:56326667-56326689 CAGCTGTCAGGGTGGGCAACTGG + Intronic
1127289096 15:57554506-57554528 CCACTCTAAGGGAAGGCAGATGG + Intergenic
1127691298 15:61399979-61400001 TATCTGTGAGGAAGGGCAGAGGG - Intergenic
1127903409 15:63358231-63358253 CAGCTGGAAGGAAAGGAAGATGG + Intronic
1127965240 15:63918229-63918251 CACCTGTAAGGGAGGGGAGGGGG + Intronic
1128579539 15:68799256-68799278 CTGCTGGAAGGAAGGGGAGAGGG + Intronic
1128927193 15:71668457-71668479 CAGGTAAAAGGGAGGGGAGAAGG + Intronic
1129771603 15:78206563-78206585 CAACTGTAAGGGAGGTGACAAGG - Intronic
1130020833 15:80229985-80230007 CATCTGTAAGGATGGGCAGCAGG + Intergenic
1131195120 15:90349338-90349360 CAAGTGTGCGGGAGGGCAGAAGG + Intergenic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1132291306 15:100705628-100705650 CAGCTGTGTGGGAGGGAAGAGGG + Intergenic
1132343089 15:101090262-101090284 CAGCTGTTAGGAAGAGAAGAAGG + Intergenic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1133065668 16:3205029-3205051 CAGCTGAGTGGGAGGACAGAGGG - Exonic
1133247881 16:4461445-4461467 CAGCAGTAAGGGAGGGTCCAAGG - Intergenic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1134187695 16:12097599-12097621 GAGCTGTTAGGGAGGTCAGGAGG - Intronic
1134517876 16:14901535-14901557 CTGCTGTAAGGCACAGCAGAAGG - Intronic
1134705545 16:16300186-16300208 CTGCTGTAAGGCACAGCAGAAGG - Intergenic
1134961996 16:18411928-18411950 CTGCTGTAAGGCACAGCAGAAGG + Intergenic
1134966294 16:18494527-18494549 CTGCTGTAAGGCACAGCAGAAGG + Intronic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1136412368 16:30084913-30084935 CAGCTGGAAGGCGGGGCAGCAGG - Exonic
1136459430 16:30400458-30400480 CAGCCCAAAGGGAGGGCAAACGG + Intergenic
1137598758 16:49742324-49742346 CAGATGAGAGGGAGGGAAGAGGG + Intronic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138414217 16:56862160-56862182 CAGCTGTAGGGCCAGGCAGAAGG - Intergenic
1138474539 16:57263105-57263127 CAGCTGGGAGGGAGGACACAGGG - Intronic
1138599636 16:58046938-58046960 CAGCTGGAAGGGCGTGCAGGTGG + Intergenic
1140626934 16:76805116-76805138 GACCTGCAAGGGAAGGCAGATGG - Intergenic
1141170258 16:81686487-81686509 GAGCGGTATGTGAGGGCAGAGGG - Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1143585709 17:7849198-7849220 CAGCTGTAAGCGGCGACAGAAGG + Exonic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1143707370 17:8708164-8708186 CAGATGGAAGGGAGACCAGAAGG + Intergenic
1143892373 17:10112369-10112391 CAGGAGCAAGGTAGGGCAGATGG + Intronic
1143977094 17:10837901-10837923 GAGATGGAAGGAAGGGCAGAAGG + Intronic
1144038296 17:11386830-11386852 CAGCTGTAAGTGAGGGGTTAGGG + Intronic
1144093745 17:11881405-11881427 CAGCTGAAGGTGAGGACAGAAGG + Exonic
1144282967 17:13745113-13745135 CATCTGAAAAGGAGGGAAGAAGG - Intergenic
1144830581 17:18128831-18128853 GAGCTGTCAGGGAGGACGGATGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1146189873 17:30755749-30755771 TAGCTGCAAGAGAGGGGAGAGGG + Intergenic
1146334772 17:31960101-31960123 TAGCTGCAAGAGAGGGCAGAGGG + Intronic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1146617965 17:34371710-34371732 CAGATCTAAGGTGGGGCAGAAGG + Intergenic
1147568974 17:41555729-41555751 CAGCTGCAAGGGAGGCTGGAAGG - Intergenic
1148624057 17:49055395-49055417 CAGCTGGCTGGGAGGGGAGAAGG - Exonic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1150864590 17:68836297-68836319 CAGAGGTATGGGAGGGTAGAGGG + Intergenic
1151354973 17:73553016-73553038 CAGCTCCCAGGTAGGGCAGACGG + Intronic
1151868353 17:76820000-76820022 CTCCTGTAGGGGAGGGCAAATGG + Intergenic
1151938661 17:77279886-77279908 GTGCTGTAAGGGAGGGGAGCAGG - Intergenic
1152035278 17:77868418-77868440 CAGCGGTGAGGGAGGGGAGGTGG - Intergenic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1156326610 18:36079429-36079451 CAGCTGACAGTGAGGGCGGATGG + Intergenic
1157479390 18:48043900-48043922 GAGCTGTAAGGGAGGAGAGGAGG + Intronic
1158098521 18:53803353-53803375 CATCTGTAAGGTTGGGGAGATGG + Intergenic
1159343944 18:67174270-67174292 CACCTGTAAGTGAGGTCAGATGG - Intergenic
1159851016 18:73527414-73527436 CAGATGTTAGGGATGGGAGAAGG - Intergenic
1160135246 18:76266056-76266078 CAGCTCTCAGGCAGGGCGGAGGG + Intergenic
1160148280 18:76381396-76381418 TGGCTGTAAGGGACTGCAGATGG - Intronic
1160403023 18:78624909-78624931 GTGCTGTCAGGGAGGTCAGAGGG + Intergenic
1160663269 19:311357-311379 AAGGTCTAAGGAAGGGCAGAAGG + Intronic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1161718663 19:5891678-5891700 CTGCTGTGAGGGAGAGCAGTGGG - Exonic
1162824400 19:13242871-13242893 CAGCTGGTAGGGAGGGCTGGGGG + Intronic
1163675719 19:18654369-18654391 CAGGTGGATGGGTGGGCAGATGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166083550 19:40460019-40460041 CAGCAGTAAGGCTGGGCAGCAGG - Intronic
1166302624 19:41921113-41921135 CAGCTCTGGGGGAGGGGAGAGGG + Intronic
1166599599 19:44082256-44082278 CAGATGTCAGGGTGGGAAGAGGG - Intronic
1168317031 19:55488986-55489008 CCGCTGGAAGGGAGGGCGGAGGG - Exonic
1168539956 19:57201961-57201983 CAGCAGTATGGGAGGCAAGAGGG + Intronic
925080443 2:1059216-1059238 CAGCTCTAAGAGATGGCAGAAGG - Intronic
925855184 2:8122661-8122683 CAGCTGGAATGGGAGGCAGAGGG + Intergenic
925919181 2:8627584-8627606 CAGCTGTAAGGGAGAAATGAGGG - Intergenic
927204550 2:20598985-20599007 CAGATGCTAGGGAGGGCAGTGGG + Intronic
927419270 2:22912871-22912893 CAGCTGTATTGGCTGGCAGAAGG + Intergenic
927651097 2:24914184-24914206 CAGCCGGAAGGGAGGACAGATGG - Intronic
927711802 2:25330757-25330779 GAGCTGTCCGGGAGAGCAGAGGG - Intronic
929172945 2:38949523-38949545 CAGAAGTAAGGAAGGGAAGAAGG - Intronic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
933368149 2:81381061-81381083 GAGGTGGAAGGGAGGTCAGATGG + Intergenic
933434977 2:82237447-82237469 TAGCTGTAAGTTAGGCCAGATGG - Intergenic
933632184 2:84671370-84671392 CAGCTGCAAGAGGGTGCAGATGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934102527 2:88666671-88666693 CAGCAGTTGGGGAGGGCAGGAGG - Intergenic
934903103 2:98176534-98176556 TAGCTGAAAAGGAAGGCAGAAGG - Intronic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
935092150 2:99905429-99905451 CAAGAGGAAGGGAGGGCAGAGGG - Intronic
935550397 2:104446983-104447005 CAGCTGTAAAGGAGGGGAGGGGG + Intergenic
935649736 2:105372031-105372053 CAGCTGTAAGGGAAAACAGCTGG - Intronic
936342982 2:111654057-111654079 CAGATAGGAGGGAGGGCAGAGGG - Intergenic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937395303 2:121530026-121530048 CAGCTGGAAGGGAAGGCAGCGGG + Intronic
937470686 2:122171712-122171734 GAGCTGTAGGGGAAGGCAGGAGG - Intergenic
939887852 2:147700739-147700761 CGGCTGTTAGGTGGGGCAGAGGG + Intergenic
941060542 2:160842394-160842416 CAGCTGAAAGTGTAGGCAGATGG + Intergenic
941116623 2:161479909-161479931 CAGCTGGAAGTGAAGGCAGTGGG - Intronic
941712850 2:168732610-168732632 CAGCTGTAAGGGACAGCATGTGG - Intronic
941825145 2:169886760-169886782 CAGCTGTAAGGTGGGGCCCAGGG - Intronic
942070528 2:172311850-172311872 CTTCTGGAAGAGAGGGCAGAGGG + Intergenic
942499119 2:176569752-176569774 CAGCTGGCAGGGACCGCAGAGGG - Intergenic
942672271 2:178388731-178388753 CAGAAGTATGGGAGGGTAGATGG - Intronic
942867013 2:180688948-180688970 AATCTGTAAGGGAGGTAAGATGG - Intergenic
946633413 2:221697174-221697196 AAGGTGTATGGGAGGGCAGAGGG + Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947126472 2:226874017-226874039 CAGGTGTAAGAGAGAGCACAGGG + Intronic
947436857 2:230080338-230080360 CAGGTATCAGGCAGGGCAGAAGG + Intergenic
948211275 2:236195055-236195077 CATCTGGAAGGGAAGGCAGGTGG + Exonic
948272909 2:236687764-236687786 GAGCTGGAAGTCAGGGCAGAGGG + Intergenic
1170055297 20:12196152-12196174 CAGCCGTAAGGGAGGGTAGTTGG - Intergenic
1171055416 20:21901904-21901926 GAGCTGTCAGGGAGGGAACAAGG + Intergenic
1172433641 20:34913307-34913329 CAGCTGGGAGGGAGGCCAGCTGG + Intronic
1173239517 20:41281897-41281919 CAGCTGAGAGAGAAGGCAGAAGG + Intronic
1173570117 20:44070602-44070624 CAGCTGTGAGGGGTGGCAGCAGG - Intergenic
1173939354 20:46896131-46896153 TAGCTGTTAGCGAGGGCGGAGGG + Intronic
1176289977 21:5038514-5038536 CAGCTGTAAGGGAGGGAAAATGG + Intronic
1178329845 21:31678633-31678655 CAGCAGGAAGGGAGAGCAAAGGG - Intronic
1178968949 21:37154002-37154024 CTGCTTTAGGGGAGGGCAGGGGG - Intronic
1179127655 21:38605029-38605051 AAGCTGGAAGAGAGGACAGATGG - Intronic
1179628630 21:42663429-42663451 CAGCTCGGAGGGAGGGCAGAAGG + Intronic
1179809895 21:43864359-43864381 CAGGTGCAAGGGAGGGGGGACGG + Intergenic
1179867275 21:44225125-44225147 CAGCTGTAAGGGAGGGAAAATGG - Intronic
1180892077 22:19296736-19296758 AAGCTGAAAGGGAAGTCAGAAGG + Intergenic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181406009 22:22685647-22685669 GAGCTGGAAGGAAAGGCAGAGGG - Intergenic
1181413985 22:22746350-22746372 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181419630 22:22788873-22788895 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183062688 22:35345705-35345727 GATCTGGAAGGAAGGGCAGAGGG - Exonic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183446399 22:37858659-37858681 CATCTGAAAGAGATGGCAGAAGG - Exonic
1183930319 22:41232353-41232375 CACCTGTAAAGGATGGCAGTGGG + Intronic
1183991969 22:41603155-41603177 CACCTGGTTGGGAGGGCAGATGG + Intronic
1184189359 22:42884747-42884769 CAGCTGAGAGACAGGGCAGATGG - Intronic
1185236657 22:49717604-49717626 CGGCTGTGTGGGAGGGCAGACGG - Intergenic
949909060 3:8885645-8885667 GCACTGTAAGGGAGGGAAGAGGG + Intronic
952361589 3:32635689-32635711 AAGATGTAAAAGAGGGCAGACGG - Intergenic
953829392 3:46282500-46282522 TAGATGTAAGGGAAGACAGAAGG - Intergenic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
954700384 3:52447763-52447785 GAGCTGTGAGGGATGGCTGATGG - Intergenic
954897855 3:53992222-53992244 CAGCTGCAAAGGAGGGTAAAAGG + Intergenic
955769773 3:62375288-62375310 CAACTGGATGGGTGGGCAGAAGG - Intergenic
956848979 3:73210985-73211007 CAGCTGTCAGGGTGGGCCCAGGG + Intergenic
958850324 3:99317376-99317398 CATCTGGAAGAGAGAGCAGAGGG - Intergenic
959903474 3:111685164-111685186 TAGCTGTTAGTGAGGGTAGAAGG - Intronic
959984926 3:112561782-112561804 CAGCCGCGAGGGAGGGCAGCGGG + Exonic
960620023 3:119628522-119628544 AAGCTGTAGGTGTGGGCAGAGGG + Intronic
960997458 3:123349485-123349507 CAGGCGTCAGGGAGGGCAGAGGG - Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961798015 3:129423823-129423845 CAAACGTAAGGGAAGGCAGAAGG - Intronic
961985290 3:131125555-131125577 CAACTGTAAGAGATGGCAGAAGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962878013 3:139550700-139550722 CAGTTGGAAGGAAGGACAGAAGG - Intergenic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
966316039 3:178646225-178646247 CAGCTGTAGGGGAGAGCCCAAGG + Intronic
967218284 3:187228413-187228435 GAGCTGCCAGCGAGGGCAGAGGG - Intronic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
971021163 4:22537257-22537279 AAGCTGTGAGGGAGGGCTGGTGG - Intergenic
973204920 4:47549728-47549750 CACCTCTAAGGGAGTGAAGAAGG + Intronic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
976184548 4:82430779-82430801 CTGCTGTTGGGGAGGGCGGAGGG - Exonic
976452002 4:85200496-85200518 CAGCTGCCAGGGGTGGCAGAGGG + Intergenic
977299859 4:95255461-95255483 CAGCTGAAAGTGAGGCTAGAAGG - Intronic
978377717 4:108093398-108093420 TCGCTGTAAGGGAGGGAAGGAGG + Intronic
979124307 4:116948383-116948405 TAGCTGTAAGGGGAGGGAGATGG - Intergenic
979188663 4:117831756-117831778 CAGATGGATGGGAGGCCAGAAGG + Intergenic
979856525 4:125639525-125639547 AAGCAGTAAGGAAGGGGAGAAGG - Intergenic
981016312 4:139977984-139978006 AAGCTGAAAGGGACTGCAGAAGG + Intronic
981888908 4:149713593-149713615 CAGCTGAAAGTAAGGGCAGGGGG - Intergenic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
984007753 4:174333978-174334000 CAGATGTAAGGAAGGGAGGAAGG - Intergenic
985130462 4:186733783-186733805 CAGCTGTAAGGCACTGCAGTGGG + Intergenic
985542613 5:493866-493888 CACCTGTCAGGCAGGGCAGCGGG + Intronic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
987709786 5:21492407-21492429 CTGCTGTAGGGCAGGCCAGATGG + Intergenic
987991752 5:25221584-25221606 AATATTTAAGGGAGGGCAGATGG - Intergenic
988749827 5:34181756-34181778 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
988965577 5:36414169-36414191 CAGGGGTTAGGGAGGACAGAGGG + Intergenic
989603727 5:43224150-43224172 CAGCTCTCAGGGAGGCAAGAGGG - Intronic
989997194 5:50849802-50849824 CAGCATTAAGAGAGGGCAAAGGG - Intergenic
990514156 5:56516698-56516720 CAGCTCTGAGGGTGGGCTGAGGG + Intronic
991738086 5:69644960-69644982 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
991760108 5:69911464-69911486 CTGCTGTAGGGCAGGCCAGATGG + Intergenic
991787224 5:70206636-70206658 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
991789662 5:70224686-70224708 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
991814411 5:70499796-70499818 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
991817546 5:70521088-70521110 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
991839339 5:70786515-70786537 CTGCTGTAGGGCAGGCCAGATGG + Intergenic
991879670 5:71207026-71207048 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
991882110 5:71225055-71225077 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
993503068 5:88683626-88683648 CAGGTGTAATGGATGGCAGGGGG + Intergenic
994421906 5:99533726-99533748 CTGCTGTAGGGCAGGCCAGATGG + Intergenic
994460936 5:100066855-100066877 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
994485083 5:100380283-100380305 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
996089327 5:119335623-119335645 TGGCTGGAAGGGAGGGCAGAAGG - Intronic
996215250 5:120858007-120858029 GAGCTGTAAGGGAATGCACAGGG + Intergenic
996496517 5:124163069-124163091 CAACTGAAAGTGAGGACAGAAGG + Intergenic
996802655 5:127420784-127420806 AAGCTGTCAGGGAGTGCAAACGG + Intronic
997413330 5:133706846-133706868 GAGCGGTAAGGCAGTGCAGACGG + Intergenic
998174754 5:139894918-139894940 CAGCTGCAAGGTAGAGAAGAGGG + Intronic
998681639 5:144474106-144474128 CATCTATAAGGGAGGGCTGGGGG + Exonic
998876745 5:146607845-146607867 CAGTTGTAATGGAGACCAGATGG - Intronic
999240821 5:150126435-150126457 CAGCATTCAAGGAGGGCAGAGGG + Intronic
1000009705 5:157219748-157219770 CGTCTGCAAGGGAGGGCAGTAGG - Intronic
1001771428 5:174300002-174300024 CAGCAGTAAAGGAGGGCAGCTGG + Intergenic
1001913112 5:175537277-175537299 GAGGTGTGAAGGAGGGCAGAGGG - Intergenic
1002046788 5:176545992-176546014 CAGCCGTAAGGGCAGGGAGAGGG + Intronic
1002354530 5:178614448-178614470 CAGCTACAGGGGAGGGCAGTGGG + Intronic
1002473753 5:179452562-179452584 CAGCTGCCAGGGAGGAGAGAGGG - Intergenic
1002477779 5:179478506-179478528 CAGCTGTAAGAAAAGGAAGAAGG + Intergenic
1004329672 6:14710084-14710106 CACATGTCAGGGAGAGCAGATGG - Intergenic
1004563110 6:16770251-16770273 AAACTGTAAGGGAGGTCAAATGG - Intergenic
1005547893 6:26888099-26888121 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
1005802928 6:29445378-29445400 CAGATGGAAGGGAAGGGAGAAGG + Intronic
1006398670 6:33803210-33803232 GTGCTGCAAGGGAGGGCAGACGG - Intronic
1006638661 6:35477406-35477428 CAGGTGGAAGGTAGGGAAGAGGG - Intronic
1008738592 6:54577285-54577307 CATCTGAAAGAGAGGGCAGAAGG + Intergenic
1009018654 6:57929180-57929202 CTGCTGTAGGGCAGGCCAGATGG - Intergenic
1009965902 6:70577708-70577730 CGACTGTCAGGGAGGGAAGAAGG - Intronic
1011032405 6:82937927-82937949 CAGCTGTTAGGGAGGTCTTACGG + Intronic
1011237890 6:85237807-85237829 AAGCAGTAAGGGAGGGAAAAGGG + Intergenic
1012815507 6:104018067-104018089 ATGCAGCAAGGGAGGGCAGATGG + Intergenic
1012844403 6:104371288-104371310 TAGCTACAAGGCAGGGCAGAAGG - Intergenic
1013004946 6:106063730-106063752 CAGCTGACATGGAGGGTAGAAGG + Intergenic
1013360585 6:109390586-109390608 CAGGAGTTAGGGATGGCAGAGGG + Intronic
1014462857 6:121718927-121718949 CAGCTATAAGGCATGGCTGATGG - Intergenic
1014480505 6:121930265-121930287 CAGATGTAAGGGAGGAAAGATGG - Intergenic
1015047532 6:128794218-128794240 CAGCTATTCGGGAGGGCTGAGGG + Intergenic
1017235236 6:152111684-152111706 AGGCTGGAAGGGAGGGGAGAAGG + Intronic
1017452890 6:154570821-154570843 CAGCTGTATGGGATGGGAGAAGG + Intergenic
1017874143 6:158510452-158510474 GAGCTGTAAGGGAGTTTAGAGGG - Exonic
1018469013 6:164080167-164080189 CAGTTGTTTGGGATGGCAGAGGG + Intergenic
1019138482 6:169927611-169927633 CAACTGCAAAGGAAGGCAGAAGG + Intergenic
1019415121 7:923573-923595 CACCCGCAGGGGAGGGCAGAGGG - Intronic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1022392724 7:29957657-29957679 AAGCTCTAAGGGAGCACAGAAGG + Intronic
1023743822 7:43303800-43303822 CAGGTGTAAGGGAGGAGAGTGGG - Intronic
1023905017 7:44515982-44516004 CAGGTGTCAGGCAGGGCACAGGG + Intronic
1023923811 7:44650435-44650457 CATCTGTAAGGCAGGGGTGATGG + Intronic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025986115 7:66453734-66453756 AGGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027900468 7:84107682-84107704 CTGCTGTATGGGTGGGCAGCTGG - Intronic
1029694518 7:102204128-102204150 CAGCTCCCAGGGAGGGAAGAGGG - Intronic
1029735672 7:102464696-102464718 CAGCGGTAAGGGGTGGGAGAGGG - Exonic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1031089260 7:117333966-117333988 GAGCTTAAAAGGAGGGCAGAAGG + Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032805525 7:135350309-135350331 CAGATGGATGGGTGGGCAGATGG - Intergenic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035463854 7:159063192-159063214 CACTTGTAAGGGAGGCTAGACGG + Intronic
1035635420 8:1140316-1140338 CAGATGGAAGGGAGGCCAGAGGG - Intergenic
1035760750 8:2067023-2067045 CGGCAGTTAGGGAGGTCAGATGG + Intronic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036611152 8:10350870-10350892 CAGCTGTCAGGGAGGGGAAGTGG + Intronic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG + Intronic
1039119594 8:34130844-34130866 CAGCTCTAAGGGAGGGCAAGAGG - Intergenic
1040670611 8:49685610-49685632 CAGCTCCAAGGAAGGGCAGTTGG + Intergenic
1040984694 8:53280830-53280852 CCGCTGTGAGGGAGGAGAGAAGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042275105 8:66996516-66996538 CAGCTGTACGGTAGGCTAGAAGG - Intronic
1042581192 8:70280952-70280974 CATCTGCAGGGGAAGGCAGAGGG + Intronic
1046089220 8:109479194-109479216 CAAGTGTATGGGAGGACAGACGG - Intronic
1046177076 8:110590950-110590972 CAGTTGACAGGCAGGGCAGAAGG + Intergenic
1047287437 8:123500055-123500077 CAGTTGAATGGGAGGGCAAATGG - Exonic
1048591032 8:135820963-135820985 CAGCTGGATGGGAGGGCATCAGG - Intergenic
1049325849 8:142021079-142021101 TGGCTGTCAGGGAGGGAAGAGGG - Intergenic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049867034 8:144946015-144946037 CTGCTGATAGTGAGGGCAGATGG + Exonic
1051534150 9:18138131-18138153 CCTCTGTAAGGGAGGGGTGATGG + Intergenic
1052070754 9:24078871-24078893 CAGGTGAAAGGGAGGACAGTGGG + Intergenic
1052867475 9:33473427-33473449 CCGCTGTAGCGGAGGGCATACGG - Intronic
1053532929 9:38899518-38899540 TAGCTTTCAGGGAGGACAGAAGG + Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054205156 9:62123947-62123969 TAGCTTTCAGGGAGGACAGAAGG + Intergenic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1054633204 9:67464423-67464445 TAGCTTTCAGGGAGGACAGAAGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1057008850 9:91583976-91583998 CACCTGTCAGGGAGGGGAGTGGG - Intronic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057181628 9:93033798-93033820 CAGCTGTAAGTCAGAGCAGCTGG - Intronic
1058756974 9:108091674-108091696 AAGCTGTGAGGGAGTGGAGATGG - Intergenic
1060806955 9:126583738-126583760 CAGCTGGGAAGAAGGGCAGACGG + Intergenic
1061532130 9:131222744-131222766 AAGATGTGAGGGAGGTCAGAGGG - Intronic
1061679832 9:132237545-132237567 CAGGTGTCAGGGAGGGCTGATGG - Intronic
1061750459 9:132773382-132773404 CAGCTGGAAGGGAGAGGACAGGG - Intronic
1061938373 9:133871145-133871167 CAGATGGATGGGTGGGCAGATGG + Intronic
1062025623 9:134338908-134338930 CAGACCTGAGGGAGGGCAGAGGG - Intronic
1062096568 9:134706847-134706869 AAGCTGTTAGCAAGGGCAGAGGG + Intronic
1062635172 9:137486861-137486883 CAGCTCTCAGGGACCGCAGATGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1203785669 EBV:126178-126200 CAGAAGCCAGGGAGGGCAGACGG + Intergenic
1186788005 X:12971426-12971448 CTGCTGTGAGGGAGACCAGATGG + Intergenic
1186902305 X:14069856-14069878 ATGCTTTAAAGGAGGGCAGAGGG - Intergenic
1188629204 X:32330519-32330541 CAGCTGGAAGGGAGCTCAGATGG - Intronic
1190705106 X:53020950-53020972 CAGCAGTGAGGGATGGGAGATGG - Intergenic
1190983517 X:55479993-55480015 CACGGGTAAGGCAGGGCAGATGG + Intergenic
1190985182 X:55493190-55493212 CACGGGTAAGGCAGGGCAGATGG - Intergenic
1191898617 X:66018977-66018999 CAGCTCTAGGCCAGGGCAGATGG + Intergenic
1194828986 X:98597186-98597208 CAGCTGGAAAAAAGGGCAGAGGG + Intergenic
1195057033 X:101156256-101156278 CAGCACTTAGGGAGGCCAGAGGG - Intronic
1195770708 X:108347981-108348003 CAGCAATAAGGGAGTGCAGGAGG + Intronic
1195971717 X:110480538-110480560 CAGCTGCAGGGGAGCACAGACGG - Intergenic
1196657664 X:118235861-118235883 GAGCTGGAAGGGAGGGGAAATGG + Intergenic
1197448145 X:126578369-126578391 CAGATGTTAGGGAGAGTAGAGGG + Intergenic
1199348116 X:146766463-146766485 CACCTGCAAGGGAGGGGAAAAGG + Intergenic
1200585944 Y:5004327-5004349 CAGCTGAAAGGCCTGGCAGAAGG + Intronic
1200765017 Y:7073315-7073337 CAGTTATAAGGGAGACCAGATGG + Intronic
1202045418 Y:20732643-20732665 CAGCTGTAAGGGAGAAGACATGG + Intergenic
1202095097 Y:21241598-21241620 CAGATGCAATGGAGGCCAGAGGG + Intergenic