ID: 953882074

View in Genome Browser
Species Human (GRCh38)
Location 3:46695790-46695812
Sequence TCCCCTAGATGTGGCTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953882074_953882077 1 Left 953882074 3:46695790-46695812 CCTGTTCAGCCACATCTAGGGGA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 953882077 3:46695814-46695836 TAGAAAGGCTGACTGAGCTCTGG 0: 1
1: 0
2: 0
3: 25
4: 401
953882074_953882078 2 Left 953882074 3:46695790-46695812 CCTGTTCAGCCACATCTAGGGGA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 953882078 3:46695815-46695837 AGAAAGGCTGACTGAGCTCTGGG 0: 1
1: 0
2: 2
3: 36
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953882074 Original CRISPR TCCCCTAGATGTGGCTGAAC AGG (reversed) Intergenic
901060924 1:6471601-6471623 TCTCCGGGATGTTGCTGAACAGG + Exonic
901423376 1:9165541-9165563 TCTCCAAGAAGTGGGTGAACCGG + Intergenic
903392722 1:22976129-22976151 TCCCCAAGAAATGGCAGAACTGG + Intergenic
906691978 1:47798696-47798718 TCCCCTAGATGGGGGTAAAGAGG - Intronic
912182680 1:107237663-107237685 TACCCCAGCTGTGGCTGAAAGGG + Intronic
914989290 1:152484660-152484682 TCCCCTAGATTTAGCAGAGCAGG - Intergenic
916394855 1:164374729-164374751 TCCTCCAGATGTGGCTAAAATGG + Intergenic
917892423 1:179452969-179452991 TGCTCTAGCTGTGGCTGAAAGGG + Intronic
919715075 1:200767741-200767763 TCTCATAGATGTTGTTGAACAGG + Intronic
919840494 1:201605759-201605781 TCCCCTAGATGCAGCTGGCCAGG - Intergenic
1063163758 10:3441353-3441375 TCCCCATGATGGGGCTGAGCTGG - Intergenic
1069110079 10:64436300-64436322 TTCACTCTATGTGGCTGAACTGG + Intergenic
1071406117 10:85334151-85334173 TGCCCCAGATGTTGCTGAAATGG - Intergenic
1072219876 10:93318033-93318055 GGCCCTAGATGTGGGTAAACAGG + Intronic
1075564366 10:123492864-123492886 TCCCCTTCAGGTGTCTGAACAGG + Intergenic
1078741054 11:14066715-14066737 TCCCAGAGATGTGGCTGTAAAGG - Intronic
1079967422 11:26995457-26995479 TCTTTTAGATGTGGCTGAAACGG - Exonic
1080120406 11:28670449-28670471 TCCGATACCTGTGGCTGAACAGG + Intergenic
1081629884 11:44681796-44681818 TCTCCTGGATGTGTCTGAAAAGG + Intergenic
1085194350 11:74659225-74659247 TGCTCTAGCTGTGGCTGAAAGGG - Intronic
1085236477 11:75019437-75019459 TGCTCTAGCTGTGGCTGAAAGGG + Intergenic
1087255576 11:95948823-95948845 TGCTCTAGCTGTGGCTGAAAGGG - Intergenic
1087691784 11:101328950-101328972 TCTCCTACATCTGGCTGGACTGG + Intergenic
1088713068 11:112525534-112525556 TCCACTACACGTGGCAGAACTGG + Intergenic
1090087422 11:123662865-123662887 TGCTCTAGCTGTGGCTGAAAGGG - Intergenic
1090710456 11:129380189-129380211 TCCCCTGGGTGTGACTGCACGGG - Intronic
1094477680 12:30853841-30853863 ACCCCTGGATATGGCTTAACTGG + Intergenic
1100953625 12:99881178-99881200 TCCTCTAGCTCTGGCTCAACAGG + Intronic
1102605917 12:114067072-114067094 TGCTATAGATGTGGCAGAACAGG + Intergenic
1112041978 13:95555828-95555850 CCCACCAGATGTGGCTGACCTGG - Intronic
1126471509 15:49016640-49016662 TCCCCTAAATCTAGCTGCACAGG + Exonic
1128066904 15:64770820-64770842 TCCCTGAGATGTGGGTGAACAGG - Intronic
1130554380 15:84912586-84912608 TCCCCTGGGTCTGGCTGACCCGG + Intronic
1131727425 15:95242495-95242517 TCACCTATAAGTGACTGAACTGG - Intergenic
1137759796 16:50931146-50931168 GCCCCTAGCTCTTGCTGAACTGG + Intergenic
1144879909 17:18425825-18425847 TCCCCAAGATGTGGCTCCTCGGG - Intergenic
1145997032 17:29110717-29110739 GCCCCTGGACGTGGCTGAATGGG - Intronic
1146163668 17:30572762-30572784 TCCCCAAGATGTGGCTCCTCAGG + Intergenic
1146275721 17:31514422-31514444 TCCCCAGGATGTGGCTGTAGGGG + Intronic
1146903488 17:36602684-36602706 TCCCCTTGAAGAGGCTGAGCTGG - Intronic
1147580662 17:41625573-41625595 TCCCCAAGATGTGGCTCCTCAGG + Intergenic
1156496866 18:37531416-37531438 TCCCCTTGATGAGGCTGCACGGG + Intronic
1161933307 19:7355665-7355687 TCTCCAAGCTGTGGCTGAAGCGG + Intronic
1163586956 19:18169371-18169393 ACCCCTGGATGTGGCTGGTCTGG - Exonic
1163727587 19:18931613-18931635 TGCCCTACAGGTGGCTGAGCTGG - Exonic
1166410017 19:42550479-42550501 TGCTCTAGCTGTGGCTGAAAGGG + Intronic
1166559982 19:43726361-43726383 TCCGCTAGATAATGCTGAACTGG - Intergenic
1167367805 19:49064129-49064151 TCTCCCAGATGGGGCGGAACTGG + Intronic
1167833406 19:52046222-52046244 TCCTGAACATGTGGCTGAACTGG - Intronic
1168569747 19:57456363-57456385 TCCCCTAGATTTTGATGAAATGG - Exonic
926134506 2:10326885-10326907 CTCCCTAGATTTGGCTGAGCTGG + Intronic
930076133 2:47407158-47407180 TGCCCCAGCTGTGGCTGAAAGGG + Intronic
932074033 2:68646413-68646435 CCCCCTAGATGTGGTTGCATGGG + Intronic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
934079079 2:88452362-88452384 ACCCCTACCTGTGGCTCAACGGG - Exonic
934092036 2:88560147-88560169 TACCCTAGATGGTGCTGAAGTGG + Intronic
938686404 2:133742325-133742347 TGCTCTAGCTGTGGCTGAAAGGG - Intergenic
944448770 2:199819571-199819593 TCCCAAAGATGTGGTTTAACAGG - Exonic
945370931 2:209016890-209016912 TGCCCTAGCTGTGGCTTGACTGG + Intergenic
945474631 2:210266456-210266478 TATTCTAGATGTGGCTGAAGAGG + Intergenic
948835102 2:240622642-240622664 TCCCCTAGATAGGGCTGCAGGGG + Intronic
1170800520 20:19586471-19586493 TCTCCTAGAAGTGGCTGATTGGG + Intronic
1172356150 20:34281373-34281395 TCCCCTACATGTGGCTTGACAGG + Intronic
1173175075 20:40758796-40758818 TTCCCTAGAAGAGGCTTAACTGG + Intergenic
1174905336 20:54544591-54544613 TCACCCAGAGCTGGCTGAACAGG + Intronic
1184899075 22:47432981-47433003 TCCCCCAGATGTGACTGTCCAGG + Intergenic
949628761 3:5898861-5898883 TCACCTAGATCTGGGTGAGCTGG - Intergenic
951920125 3:27845470-27845492 TTCCTTAGATGTGGCTGGCCAGG + Intergenic
953882074 3:46695790-46695812 TCCCCTAGATGTGGCTGAACAGG - Intergenic
954059913 3:48058484-48058506 TTCACTAGGTCTGGCTGAACAGG + Intronic
955301455 3:57783916-57783938 TGCCCTAGCTGTGGCTCAAGTGG + Intronic
957354424 3:79063021-79063043 TCCTCTAGATGTTTCTGTACAGG + Intronic
959901397 3:111665797-111665819 TCCCACACATGTGGCAGAACTGG + Intergenic
964489234 3:157217310-157217332 TCCCCAAGATGTGACTCCACAGG - Intergenic
973718449 4:53700542-53700564 TGCTCCAGATGTGGCTGAAAGGG - Intronic
977130243 4:93226946-93226968 TGCCCTAGTTGTGGCTCAAGTGG - Intronic
981660524 4:147161013-147161035 TCCTCTGGCAGTGGCTGAACTGG - Intergenic
985604004 5:849071-849093 TCCTCTAGATCTGGGTGAGCAGG - Intronic
986739692 5:10695272-10695294 TCTCCTTGAGGTGGCTGAGCTGG - Intronic
988662262 5:33284449-33284471 TCAGCTAGAAGTGGCTGAGCTGG - Intergenic
990462485 5:56042306-56042328 TCCCATGGAGGTGGCTGAGCAGG - Intergenic
996505892 5:124267195-124267217 TGCCCAAGATGTGGCGGAGCCGG + Intergenic
996512400 5:124331393-124331415 GCCCAAAGATGTGGCTGAATTGG - Intergenic
996688476 5:126310898-126310920 TTCCCTTGATGTGTCTGAAGGGG - Intergenic
997057284 5:130459788-130459810 TGCTCTAGCTGTGGCTGAAAGGG + Intergenic
999292935 5:150439271-150439293 TTCCCAAGATGTGGCTGCAAAGG - Intergenic
999696903 5:154195315-154195337 TCCCATATATGTGTCAGAACTGG + Intronic
1005419872 6:25637992-25638014 TCCCCTCCATGTGGCTCACCTGG - Intergenic
1007172976 6:39877525-39877547 TGTCCTTGATGTGGCTGAAGAGG + Intronic
1013480402 6:110548106-110548128 TCCTTTTGGTGTGGCTGAACTGG - Intergenic
1017723302 6:157259201-157259223 GCCCCTAGATATGGCAGAGCCGG + Intergenic
1021079706 7:16349151-16349173 CCCTCTAGATGTAGCTGAAAAGG - Intronic
1022909167 7:34883315-34883337 TGCTCCAGATGTGGCTGAAAGGG - Intergenic
1023801446 7:43838616-43838638 TTTCCTAGCTTTGGCTGAACTGG - Intergenic
1032053143 7:128662348-128662370 TGCCCCAGCTGTGGCTGAAAGGG + Intergenic
1033850449 7:145488489-145488511 ATCCCTACATGTGGCTCAACTGG - Intergenic
1035315533 7:157995474-157995496 TCTCCCAGATGTGGCTGGACTGG - Intronic
1039247188 8:35621866-35621888 TCCACTTAATGTGGCTGAAGAGG + Intronic
1041984857 8:63909529-63909551 TGCTCTAGCTGTGGCTGAAAGGG - Intergenic
1048064906 8:130957725-130957747 AGCTCTAGATGTGGCTGAAAGGG + Intronic
1048429789 8:134359583-134359605 TCCCCTAGAAGTGGGTGCTCTGG - Intergenic
1050263748 9:3868733-3868755 ACCCCTAAATGTGGCTGATAAGG + Intronic
1051518886 9:17961788-17961810 TCCCTTAGATGGGGCAGAAATGG - Intergenic
1051691748 9:19720709-19720731 TCACCTTGATGTGGCTCAAGAGG + Intronic
1057913727 9:99039925-99039947 TCCCCTGGATCTGGATGAATGGG - Intronic
1060894684 9:127210041-127210063 TCCCCGCGAAGAGGCTGAACAGG + Intronic
1187440110 X:19310680-19310702 TCCCCTAGGTCAGGCTGAAATGG + Intergenic
1187837173 X:23444360-23444382 TCCCATAAATGTGTCAGAACAGG - Intergenic
1189595904 X:42565139-42565161 TTCCCCAGCTGTGGCTGAAGGGG + Intergenic
1193083203 X:77425606-77425628 TCCCCTAAATCTGGCAGAATTGG - Intergenic