ID: 953882728

View in Genome Browser
Species Human (GRCh38)
Location 3:46700048-46700070
Sequence TTCCTCATGCTGCTGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953882728_953882734 10 Left 953882728 3:46700048-46700070 CCTGTGACCAGCAGCATGAGGAA 0: 1
1: 0
2: 3
3: 32
4: 289
Right 953882734 3:46700081-46700103 GAGTGCTGCAACAAGTGATTTGG 0: 1
1: 0
2: 1
3: 14
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953882728 Original CRISPR TTCCTCATGCTGCTGGTCAC AGG (reversed) Intergenic
900655256 1:3753772-3753794 CCACACATGCTGCTGGTCACAGG - Intronic
902142895 1:14371222-14371244 ATGCTGATGCTGCTGGTCAGAGG + Intergenic
903120231 1:21211603-21211625 TTTCTCATGATGCTGGGCAGTGG + Intergenic
904120321 1:28193922-28193944 TTCATCCTGCTGCTGCTCATTGG - Intronic
904842576 1:33382732-33382754 TTTCTCCAGCTGCTGGTCTCAGG - Intronic
905214377 1:36396601-36396623 ATGCTGATGCTGCTGGTCAGGGG + Intronic
906102659 1:43273083-43273105 GGCCTCGTGCTGCTGGTCACCGG + Exonic
906211209 1:44013239-44013261 TCCCTCATCCTGCTGGGAACAGG - Intronic
907301226 1:53487494-53487516 GCCATCATGCTTCTGGTCACTGG + Intergenic
907553981 1:55328794-55328816 TTGCCTATGCTGCTGGTCCCAGG + Intergenic
908489904 1:64633115-64633137 TTTCTCATGGTGCTGGACAATGG - Intronic
908603859 1:65771952-65771974 TAGCCCATGTTGCTGGTCACTGG - Intergenic
909447071 1:75759365-75759387 TTCAGCGTGGTGCTGGTCACTGG - Intronic
909637889 1:77838270-77838292 TTGCTCATTCTGCAGGTGACTGG - Intronic
909831020 1:80189868-80189890 TTCCTCTTGCTTCTAGTTACTGG + Intergenic
911101904 1:94101951-94101973 TCGCTGATGCTGCTGGTCTCTGG + Intronic
911642368 1:100302890-100302912 TTCCTCAGTCAGCTGGTGACTGG - Intergenic
912122693 1:106492198-106492220 TTCCGCATGGTCTTGGTCACTGG - Intergenic
912484079 1:110010665-110010687 TTGCTGATGCTGCTAGTCAGAGG - Intronic
913180157 1:116313011-116313033 CTCCTCATGTTTCTGGTCTCAGG + Intergenic
913483095 1:119308263-119308285 TCCCCCATGATGATGGTCACAGG - Intergenic
914787150 1:150844523-150844545 TTGCTGATGCTCCTGGTCTCGGG - Intronic
915143216 1:153779459-153779481 TTCCTCAGGCTCCAGGTAACCGG + Exonic
917660871 1:177175557-177175579 TTTTTCATGCTGCAAGTCACCGG + Intronic
918339359 1:183554775-183554797 TTCCTTATTCTGCTTTTCACAGG + Intronic
920164434 1:204025767-204025789 TTCCTCAGGGAGCTGGTCCCTGG + Intergenic
920445365 1:206012274-206012296 TTCCTTATTCTGCAGGCCACAGG - Intronic
920850270 1:209623725-209623747 TTCCTCATGCTTCTCGCCACAGG - Exonic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
921654021 1:217712831-217712853 TTCCGAGTGCTGCTGGTCTCTGG - Intronic
921793121 1:219312467-219312489 ATCCTCATGCAGCTGCTCATTGG - Intergenic
922660437 1:227425139-227425161 GTCATCATGCTGCTGGGCTCTGG - Intergenic
923525059 1:234766221-234766243 TGCCTCTTGCTGCTCCTCACAGG - Intergenic
1065880143 10:30030741-30030763 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1067157806 10:43796949-43796971 TTCTTCCTGCTGCAGCTCACAGG + Intergenic
1067168005 10:43880456-43880478 TGCTTCATGCTGCTGCTCCCCGG + Intergenic
1068132782 10:52915517-52915539 CTCCTCATGCCACTGGTCAGAGG - Intergenic
1069916985 10:71793274-71793296 TTCCTCATTCATCTGGTCACCGG + Intronic
1069952095 10:72026084-72026106 ATGCTGATGCTGCTGGTCCCCGG + Intergenic
1070206299 10:74266134-74266156 TTCCTTTTGCTGCTGGACATAGG - Intronic
1070534678 10:77366954-77366976 TTTGCCATGATGCTGGTCACCGG + Intronic
1071843345 10:89495799-89495821 TTTCTCATGATGCTGGTCAGAGG - Intronic
1072777254 10:98211217-98211239 ATACTCATGCTGCTGGTCTAGGG - Intronic
1073039122 10:100587463-100587485 TTCTTGTTGCTGCTGGTCAGAGG - Intergenic
1073642523 10:105267635-105267657 TTCCTCATGCCGCTGCCCTCTGG + Intergenic
1074693138 10:116025247-116025269 TTCTCCATGATGCTGGGCACTGG + Intergenic
1075046030 10:119147284-119147306 TTTCTCATACTGGTGGCCACAGG + Intronic
1075518622 10:123130060-123130082 TTCCTCTTTCTGCTGGTGGCTGG - Intergenic
1075726474 10:124613266-124613288 TTCCGGATGGTGCTCGTCACTGG - Exonic
1076026833 10:127122418-127122440 TTCCTGATGCTGATGGTGCCGGG + Intronic
1076100214 10:127771351-127771373 TTTCTCCCGTTGCTGGTCACAGG - Intergenic
1076125360 10:127969890-127969912 CTCCTCAGGCTGCTGGCCATGGG + Intronic
1077046069 11:545793-545815 TGCCTTATGCTGCTGGGAACAGG - Intronic
1077142711 11:1031441-1031463 TGGCTCATGTTGCTGGTCAGGGG + Intronic
1077544352 11:3162815-3162837 GTCCTCATGCTGCTTGTGACCGG - Intronic
1077953644 11:6989695-6989717 TTCCTCTGTCAGCTGGTCACAGG - Intergenic
1078761142 11:14252942-14252964 TTGCTGATGCTGCTGGTCCAAGG + Intronic
1080349264 11:31363990-31364012 TTTCTCATGATGCTGGGCAGTGG + Intronic
1083002658 11:59309706-59309728 TTCCTCAGGCTGTAGATCACTGG + Intergenic
1083046618 11:59741960-59741982 TTCCTCATGCTGCAGATCAAGGG - Intronic
1083047450 11:59749500-59749522 TTCCTCATGCTGTAGATCAAAGG - Intronic
1083419628 11:62545795-62545817 TTCCTCAGGCTGCTGGCGCCGGG + Intronic
1084650202 11:70485140-70485162 TTTCTCATGCTCCTGGACTCCGG - Intronic
1084961846 11:72720999-72721021 TTCCTCCTGCTGCTGCCCTCAGG - Intronic
1085325107 11:75600598-75600620 TTCCTAACCCTGCTGGTCTCAGG + Intronic
1085786486 11:79456165-79456187 ATGCTGATGCTGCTGGTCCCAGG + Intergenic
1086825939 11:91496707-91496729 TTCCTGATGCTGCTGGTCTGGGG - Intergenic
1088668310 11:112116975-112116997 TTCCTCCTCCTTCTGGTCTCTGG + Intronic
1089093067 11:115894512-115894534 TTCCTCACGGTGCTGGCTACAGG - Intergenic
1089294754 11:117460933-117460955 TTCCTGCTGATGCTGGTCCCAGG + Intronic
1090297920 11:125606352-125606374 GTCCTCGTGCTGATGCTCACAGG + Exonic
1091761552 12:3090733-3090755 TTCCTCATGCTTCTGGGCACAGG - Intronic
1092948167 12:13475863-13475885 TTCCTTATGCTTCTTGCCACAGG + Intergenic
1094399857 12:30050770-30050792 ATGCTGATGCTGCTGGTCCCTGG - Intergenic
1095367390 12:41423864-41423886 TTCCTCATGGTGCTGCTGATAGG - Intronic
1096080355 12:48828575-48828597 TTCACCATGCTCCTGGTCCCTGG - Exonic
1096723013 12:53538219-53538241 TTCCTGAATCTGCTGGCCACTGG + Intronic
1098625592 12:72661906-72661928 TTGCTAATGCTGCTGGGCAAAGG + Intronic
1098683774 12:73394044-73394066 TAACTCATTCTGCTGTTCACAGG - Intergenic
1099083107 12:78210951-78210973 TGCCACACGGTGCTGGTCACAGG + Exonic
1101061442 12:100976647-100976669 CAGCTAATGCTGCTGGTCACGGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102802579 12:115749546-115749568 TTTCTTTTGCTGCTGCTCACTGG + Intergenic
1103023800 12:117557530-117557552 ATCCTGATGCTGCTGGTCCACGG + Intronic
1103188342 12:118980691-118980713 TTCCTAATGCCGCTAGTCTCGGG - Intergenic
1103516216 12:121509951-121509973 CTCCTGAGGCTGCTGATCACAGG + Exonic
1105021839 12:132821960-132821982 TTCCTCTGTGTGCTGGTCACAGG - Intronic
1106344409 13:28861753-28861775 CTCCTCAGGCTGCTGGATACGGG - Intronic
1107761051 13:43679285-43679307 TGTCTCATGCTGCTGACCACAGG - Intronic
1108621759 13:52191698-52191720 TTGCTAATGCTGCTGGTCAGGGG + Intergenic
1109272901 13:60273972-60273994 TTCCTCATGTTGCTGTTGCCAGG + Intergenic
1113348157 13:109500971-109500993 TTCCTGTGGCTTCTGGTCACAGG - Intergenic
1113458861 13:110467818-110467840 TTTCTCAGGCTGATGGACACAGG - Intronic
1116049641 14:39787461-39787483 TTCCTGATGCGGCTGGTCTCAGG + Intergenic
1116222454 14:42105987-42106009 TTCCTCATGCTCCAGATCAAGGG + Intergenic
1116241083 14:42343764-42343786 TTGCTGATGCTGCTGGTCTGAGG + Intergenic
1117665904 14:58055606-58055628 TCCCTGATGCTGCTGGTCTGTGG - Intronic
1117856874 14:60043407-60043429 TTCATTATGCTGCTAGTCATAGG + Intronic
1119415315 14:74465771-74465793 GCCCTCATGCTGATGTTCACAGG - Intergenic
1119989450 14:79179473-79179495 TTGCTAATGCTGCTGGTCCTGGG - Intronic
1120096030 14:80388661-80388683 TGGCTGATGCTGCTGGTCCCAGG - Intergenic
1121214537 14:92237183-92237205 GTGCTGATGCTGCTGGTCCCAGG + Intergenic
1121352259 14:93183454-93183476 TTCCTCATCCTTCTGGTAAGTGG + Exonic
1125725095 15:41864107-41864129 TTCCTCATGCTCCGGGGCCCAGG - Intronic
1127395933 15:58544068-58544090 TTGTTCATCTTGCTGGTCACTGG + Intronic
1128364013 15:66984129-66984151 TGGCTCATGATTCTGGTCACTGG + Intergenic
1128723639 15:69971744-69971766 TTCCTAGTGCTAATGGTCACTGG - Intergenic
1129115637 15:73363972-73363994 GACTTCCTGCTGCTGGTCACTGG - Intronic
1129938010 15:79466790-79466812 TTCCTACTGGTGCTGGTCTCTGG - Intronic
1130742118 15:86612187-86612209 TGCATCCTGCTGCTGGTCAAAGG - Intronic
1132261696 15:100431005-100431027 ATTCTCATGCTGGAGGTCACTGG + Intronic
1133654756 16:7850091-7850113 TTCCTCATTCTGCTTTGCACTGG + Intergenic
1133888370 16:9853528-9853550 TTTCTCATGCTTCTGGAGACTGG - Intronic
1134625662 16:15720863-15720885 CTCCTCATTCTGCTCGTCCCGGG + Exonic
1135466556 16:22691283-22691305 ATACTAATGCTGCTGGTCCCAGG - Intergenic
1137402143 16:48162609-48162631 TTGCTGATACTGCTGGTCTCTGG - Intergenic
1137950252 16:52776798-52776820 TTCCGCAGGCTTCTGGTCATAGG + Intergenic
1138554467 16:57763630-57763652 TTCCTCTCCCTGCTCGTCACCGG - Intronic
1139148044 16:64345941-64345963 TACCTCATTCTTCTGGACACAGG + Intergenic
1139310900 16:66027206-66027228 TCCCTCATGCTGCTGGGTTCTGG + Intergenic
1140193885 16:72840757-72840779 TTCCTCATTCTGCTGTCCACTGG - Intronic
1141512986 16:84524733-84524755 TTCTTGGTGCTGCTGGTCATTGG - Intronic
1142848339 17:2692602-2692624 TACCTCATGCTGCTGGTGTTCGG - Exonic
1143252772 17:5535329-5535351 ATGCTCATGCTGCTGGTCCACGG + Intronic
1144536857 17:16098089-16098111 TTCCTCCTGCCGCTTGCCACTGG - Intronic
1144731514 17:17528875-17528897 GTCCTCATGCTGCTGGGCCTGGG - Intronic
1146806359 17:35868103-35868125 ATGCTGATGCTGCTGGTCATGGG + Intronic
1147565304 17:41532646-41532668 TTCCTTGTGCTGGTGGTCCCTGG - Intergenic
1148958446 17:51372882-51372904 TTCCTCATTCTCCCGGGCACAGG - Intergenic
1148964362 17:51422334-51422356 TTCCTCATGCTTAAGGCCACAGG + Intergenic
1150286473 17:63957172-63957194 TTCCTCATGGTCATGGTCATCGG - Exonic
1154103156 18:11495788-11495810 CTCCTCATGCAGCTGGTCCTGGG - Intergenic
1155336116 18:24767062-24767084 CTCCCAATGCTGCTGTTCACAGG + Intergenic
1157555983 18:48613166-48613188 CTCCTCATGCCGTTTGTCACTGG + Intronic
1158040847 18:53091486-53091508 TTTCTCATGGTTCTGGTGACCGG + Intronic
1160553008 18:79707099-79707121 TTCCACATGCTCCTCCTCACTGG - Intronic
1161312086 19:3600390-3600412 TTCCTGGGGCTGCTGGTGACCGG - Exonic
1163758239 19:19119719-19119741 ACCCTCATGCTGCTGGGCCCAGG + Exonic
1164508491 19:28878509-28878531 TTTTTCCTGCTGCTGGTCAGGGG + Intergenic
1164963436 19:32457198-32457220 TTCCTCTTGTTGTAGGTCACTGG - Intronic
1165734311 19:38166089-38166111 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1166740333 19:45110884-45110906 TGCCTCAGGCTTCTGGTCATGGG - Intronic
1167404261 19:49293919-49293941 TTCCTGATGTTGCTGGCCATGGG - Exonic
1168423384 19:56219788-56219810 GTGCTCATGCTGCTGGTCTTGGG - Exonic
925917381 2:8616261-8616283 TTTCTGATGCTGCTGGTGATCGG - Intergenic
926219794 2:10927240-10927262 AGCCTGATGCTGCTGGTCCCTGG + Intergenic
927553840 2:24019218-24019240 TTGCTGATGCTGCTGGTCCAGGG - Intronic
929059616 2:37910013-37910035 TTTCTCATGCTGCTGGCCTTGGG + Intergenic
931066584 2:58594568-58594590 TCACTGATGCTGCTGGTCAGTGG + Intergenic
931576697 2:63724663-63724685 TTCCTCATGCTGCTGTTAAAAGG - Intronic
932734446 2:74244806-74244828 TCCCTGATGCTGCTGGTCCAGGG + Intronic
932825184 2:74932685-74932707 AAACACATGCTGCTGGTCACCGG - Intergenic
933039300 2:77442079-77442101 TTCCACATTCTGCTGTTCTCAGG - Intronic
934157641 2:89218335-89218357 TTACCCAAGCTGCCGGTCACTGG + Intergenic
934209624 2:89964091-89964113 TTACCCAAGCTGCCGGTCACTGG - Intergenic
934534754 2:95123579-95123601 TTCTTCAGGCAACTGGTCACAGG + Intronic
934902573 2:98172330-98172352 TGCGTCATTCTGCTGGTCAGGGG + Intronic
935214212 2:100963284-100963306 TTCCTGATACTGATGGTCCCAGG - Intronic
935797594 2:106659993-106660015 TTATTCATGCTGCTGTTCACAGG + Intergenic
937062512 2:118991043-118991065 TGCCTCCTGCTGCCTGTCACTGG + Intronic
937123640 2:119458756-119458778 TTGCTCATGCTGCTGGTCCAGGG - Intronic
938210380 2:129461825-129461847 TTCCTCTTACTGGTCGTCACTGG + Intergenic
938644171 2:133314472-133314494 TTTCTAATGCTGCTGGTCTGGGG + Intronic
940361549 2:152801246-152801268 TTTCTCCTGGTGCTGCTCACAGG - Intergenic
941068009 2:160924961-160924983 ATGCTCATGCTGCTGGTCCAGGG + Intergenic
941588081 2:167384593-167384615 TCCCTCATGCTGTCAGTCACTGG + Intergenic
942962705 2:181851975-181851997 TTCTTCATTCTGCTTTTCACAGG - Intergenic
943156856 2:184190922-184190944 TTCCTCAGGCTGGTGGTCTGAGG + Intergenic
944638800 2:201701033-201701055 TTCCTCAGGCTGCCATTCACAGG + Exonic
944843626 2:203646783-203646805 TTCTTCGTGCTGGTGTTCACTGG + Intergenic
947002892 2:225477568-225477590 TTACTGATACTGCTGGTCTCTGG + Intronic
947517908 2:230823272-230823294 GTCTTCATGCTGCAGTTCACGGG - Intergenic
947935870 2:234002806-234002828 ATCCTCATTCTACTGTTCACAGG + Intronic
948355924 2:237376993-237377015 TTCCTGGTGCTGCTGGTCGCAGG - Exonic
1168854066 20:996732-996754 TTCTTCATGGTGATGGTGACTGG + Intronic
1169123114 20:3109286-3109308 TTCCTCATGCAGTTGGTTTCAGG - Exonic
1169503664 20:6185499-6185521 ATGCTGATGCTGCTGGTCCCAGG - Intergenic
1169542576 20:6616439-6616461 TTTCTCATACTTCTGGTCATTGG + Intergenic
1169818799 20:9686652-9686674 TTCCTGTTGCTGCTAGTCCCTGG + Intronic
1170044432 20:12070715-12070737 TTCCTGATGCTGCTGGTATGGGG - Intergenic
1171417598 20:24993724-24993746 TTCCTCGTGCCACTGGTAACGGG - Intergenic
1173527626 20:43745123-43745145 TTCCCCTTGCTGCTGGTGCCTGG - Intergenic
1173550836 20:43932200-43932222 TTTCTCATGCTTCTGGTGAGTGG - Intronic
1174515339 20:51087806-51087828 ATCCCCATGCTGCTGGTCCCTGG + Intergenic
1175354267 20:58350608-58350630 TTCCTCTGGCTTCTGGTCTCCGG - Intronic
1176168292 20:63685798-63685820 TCCATCCTGATGCTGGTCACCGG + Exonic
1178220165 21:30647268-30647290 TGTCTCATGCTGCTGCCCACAGG - Intergenic
1178226653 21:30726854-30726876 ATCCTAATGCTGCTGGTTCCTGG - Intergenic
1178494460 21:33075331-33075353 TCCCTCCTGCTGCTGTTGACAGG + Intergenic
1178532539 21:33387480-33387502 TGCCTCAGGCTGAAGGTCACTGG - Intergenic
1181211629 22:21292534-21292556 CTCCTCCTGCTGCTGTTCGCCGG - Intergenic
1181508865 22:23379924-23379946 TCCCTGAGGCTGCTGGTCACAGG - Intergenic
1181651529 22:24261706-24261728 CTCCTCCTGCTGCTGTTCACCGG - Intergenic
1181705846 22:24649033-24649055 CTCCTCCTGCTGCTGTTCGCCGG + Intergenic
1183400955 22:37604114-37604136 TTCCAGATGCTGCTGCTGACTGG - Intergenic
1183408402 22:37641270-37641292 TTCCTCAAGCTGTTGGCCATGGG + Intronic
1183574067 22:38675847-38675869 GTCCTAATGGTGCTGGTCATGGG - Intergenic
1185176171 22:49328248-49328270 TTCCTCCTGCAGCTGAACACTGG - Intergenic
1203215324 22_KI270731v1_random:2898-2920 CTCCTCCTGCTGCTGTTCGCCGG + Intergenic
1203275306 22_KI270734v1_random:82491-82513 CTCCTCCTGCTGCTGTTCGCCGG - Intergenic
949858469 3:8483716-8483738 ATGCTCATGCTGTTGGTCTCTGG - Intergenic
949887691 3:8709494-8709516 ATGCTCATGCTGCTGGTCTGGGG + Intronic
950465840 3:13153214-13153236 CTCCTCTGGCTGCTGGGCACAGG - Intergenic
950649816 3:14400419-14400441 TCCCTCATGGAGCTGGTAACTGG + Intergenic
952818599 3:37466744-37466766 TTCCCCATGCTGCTGGTCTGAGG + Intronic
952971548 3:38653940-38653962 TTCCTCCTTCTGCTGGGCGCTGG + Intergenic
953545621 3:43861947-43861969 TTCCTGATGGTGCTGGTCTCTGG + Intergenic
953804818 3:46059227-46059249 TTCCTCATTCAGCTAATCACAGG - Intergenic
953820090 3:46200595-46200617 TACCTCATGCTGCTGTTCTGAGG - Intronic
953882728 3:46700048-46700070 TTCCTCATGCTGCTGGTCACAGG - Intergenic
955877748 3:63511187-63511209 ATCCTGATGCTCCTGCTCACGGG + Intronic
956855761 3:73273343-73273365 GTTCTCATGCTCCTGGCCACTGG - Intergenic
957014418 3:75046146-75046168 TTACTGATGCTGCTGGTCCATGG - Intergenic
959641574 3:108643520-108643542 TGCTTGATGCTGCTGGTCTCTGG + Intronic
961051822 3:123753026-123753048 CTACTGATGCTGCTGGTCCCTGG + Intronic
968947059 4:3670674-3670696 TCCCTCATGCTGTAGGTCTCAGG + Intergenic
969286574 4:6206201-6206223 GCCTTCATGCTGCTGTTCACTGG - Intergenic
969306542 4:6329163-6329185 AGCCCCATGCTGCGGGTCACCGG + Intronic
971633172 4:29021570-29021592 CTCCCCATGCTGCTGTTCTCAGG - Intergenic
972385601 4:38562795-38562817 TTCCTGCTGCTGCTGGTCTCTGG - Intergenic
979973455 4:127166410-127166432 TTCCTTAGTCAGCTGGTCACAGG - Intergenic
979982098 4:127269691-127269713 TTCCCCATGCTGTTGGCCCCAGG - Intergenic
983139996 4:164138411-164138433 TTGCTCCTACTTCTGGTCACAGG - Intronic
984560541 4:181263731-181263753 TTGCTCATGCTGCTGGGTCCAGG - Intergenic
985096764 4:186420543-186420565 TCCCTCCTGCTGCTGGGCAGGGG - Intergenic
985517552 5:354714-354736 TGCCACATGCTGCTGGTCACGGG - Intronic
986148029 5:5098690-5098712 TTCCTCATGGTTCTGGAGACTGG + Intergenic
988334043 5:29882091-29882113 TTCCTTATTCTGGTTGTCACAGG - Intergenic
988718319 5:33850742-33850764 TTTCCCATCCTGCTGGTCCCTGG + Intronic
988721255 5:33881366-33881388 TTCCTCCTGCTGCTCGTGATGGG + Exonic
988833242 5:35007269-35007291 TTCCTCATGGTTCTGGAGACTGG - Intronic
990662859 5:58037887-58037909 TTCCTCAGGCTGCATGTCTCTGG - Intergenic
991176942 5:63699563-63699585 GTCCTCATGTTGCTGCTTACAGG - Intergenic
992671010 5:79061287-79061309 TTCTTCATGCTGCTGCTCAGAGG + Intronic
993800712 5:92332107-92332129 TTCCTTATGCAGCTGAACACTGG + Intergenic
994929492 5:106163423-106163445 TGCCTCATTCTGCAGGTCAGTGG - Intergenic
995037979 5:107556817-107556839 TTCCTCTTGCTGCAGACCACTGG - Intronic
995303462 5:110613516-110613538 TTACTCCTGCTAATGGTCACTGG + Intronic
996581617 5:125037807-125037829 TTCCTCATTCTGATTGTCAAGGG - Intergenic
996882238 5:128312682-128312704 CTCTTCATGCTGCTGCTCTCTGG - Exonic
997229845 5:132234370-132234392 TTCCGCATGCAGCTGTCCACTGG + Intronic
997834855 5:137184075-137184097 ATCCTCCTGCTTGTGGTCACTGG - Intronic
997930035 5:138065218-138065240 GTCCGCATGCTGCTGGTAGCTGG - Intergenic
998893273 5:146769249-146769271 TTCCTGATGCTGTTGGTTTCAGG - Intronic
999089830 5:148926457-148926479 TTACTCATGAAGCTGGGCACAGG - Intronic
999254270 5:150201125-150201147 CTGCTCATGCTGCTGGTCCGCGG + Exonic
999438212 5:151580924-151580946 TTCCTTTTGCTGTTGGCCACAGG - Intergenic
999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG + Intergenic
1001149931 5:169218404-169218426 ATGCTGATGCTGCTGGTCTCTGG - Intronic
1002180987 5:177431075-177431097 GTCCTCATCCTCCTGCTCACTGG - Intronic
1002839101 6:890641-890663 CTTCTCATGCTGCTGGTGGCGGG + Intergenic
1003133796 6:3417556-3417578 GTGCTGATGCTGCTGGTCCCTGG - Intronic
1007019644 6:38506473-38506495 TCTCTCATGCTGCTGGGCAGTGG - Intronic
1007680086 6:43627988-43628010 ATACTAATGCTGCTGGTCCCAGG - Intronic
1007949570 6:45859404-45859426 TTGCTGATGCTGCTGGTCTGTGG + Intergenic
1008003018 6:46380472-46380494 TTCCTGATGCTGCCTGTCAGAGG - Intronic
1008428033 6:51381575-51381597 TTACTGATGCTGCTGGTCTCAGG + Intergenic
1011191962 6:84738765-84738787 TCTCTCCTGCTGCTGGTAACAGG - Intronic
1013290900 6:108717793-108717815 TTCCTGCTGTTGCTGGTCCCTGG + Intergenic
1013591365 6:111621879-111621901 CTACTGATGCTGCTGGTCTCTGG + Intergenic
1015111348 6:129595503-129595525 TGCCACATGCTGCTGTTCTCTGG + Intronic
1015882479 6:137882775-137882797 TTCCTCATACTCATGGTTACTGG - Exonic
1016303025 6:142652799-142652821 TTCATCTTGCTGCTGTTCATAGG - Intergenic
1017992170 6:159500396-159500418 TTCATCATGCTGATGTTAACTGG + Intergenic
1018160809 6:161040904-161040926 TTCTGCATGCTGCTGGCCAGTGG + Intronic
1019765868 7:2849729-2849751 TTCCTCCTGGTGCTCATCACAGG + Intergenic
1021301698 7:18981240-18981262 TTCCTCATTCTGCTGGTTGGAGG - Intronic
1022249533 7:28593672-28593694 TTCCACATGATCCTAGTCACTGG + Intronic
1022256566 7:28664077-28664099 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1022501626 7:30885649-30885671 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1022647355 7:32243642-32243664 TACCTCTGACTGCTGGTCACTGG - Intronic
1024051225 7:45624635-45624657 TTCATCTTTCTGCTGGGCACTGG + Intronic
1026770721 7:73196534-73196556 TTCCTTATGCTGCTGGTAGAAGG + Intergenic
1026826470 7:73585299-73585321 TTCCTAGTGCTGCTGGTCCAGGG - Intergenic
1027011588 7:74749925-74749947 TTCCTTATGCTGCTGGTAGAAGG + Intronic
1027076452 7:75196119-75196141 TTCCTTATGCTGCTGGTAGAAGG - Intergenic
1028323733 7:89495915-89495937 TTGCTGATGCTTCTGGTCAGAGG + Intergenic
1028850122 7:95528316-95528338 TTCCTCAACCTGCTGACCACTGG - Intronic
1030109456 7:106014150-106014172 TTTCTCAAGCTCCTGGTCTCAGG + Intronic
1030574709 7:111271622-111271644 ATGCTGATGTTGCTGGTCACGGG + Intronic
1031507756 7:122607576-122607598 TTTCTCATGCTGTTTTTCACTGG + Intronic
1032151635 7:129434458-129434480 TCCTCCATGCTGCTGGTCAGCGG - Exonic
1033717938 7:144022319-144022341 TTCCTAATGTTGCTGGTCTCTGG - Intergenic
1034481317 7:151322032-151322054 TACCTCATTCTTCTGGTCACAGG + Intergenic
1035572394 8:681274-681296 TTCCTGATGCTTCTGGACAATGG + Intronic
1036812893 8:11879921-11879943 ATCCTCATGCTGCTGTTACCTGG + Intergenic
1037165441 8:15822537-15822559 TTGCTGATGCTGCTGGTCTGAGG + Intergenic
1038351408 8:26779532-26779554 TTCATCATCCTGCTTGTCATGGG - Intronic
1038535032 8:28347614-28347636 TTCCTCATCCTGACGCTCACGGG + Exonic
1039076258 8:33693103-33693125 TGCCTCATTCTGCTGGTCAATGG + Intergenic
1039088408 8:33802569-33802591 ATCCTCATGCTCCTGGCCTCTGG - Intergenic
1041545821 8:59041033-59041055 TGCCTCCTGCTGATGGTCAAAGG - Intronic
1045894190 8:107194561-107194583 ATGCTAATGCTGCTGGTCAGGGG - Intergenic
1047636835 8:126772947-126772969 TCACTGATGTTGCTGGTCACTGG + Intergenic
1049031812 8:140043741-140043763 TTCCTGAAGCTGCTGGTCCAGGG + Intronic
1049257890 8:141623621-141623643 TTCTCCATGCTGCTGGTGGCAGG + Intergenic
1049914774 9:306758-306780 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1050702738 9:8359209-8359231 CTGCTGATGCTGCTGGTCATGGG - Intronic
1054887984 9:70219896-70219918 TTGCTGATGCTGCTGGTACCTGG - Intronic
1054956303 9:70914684-70914706 GTCCTAGTGCTGGTGGTCACAGG + Intronic
1055023757 9:71697187-71697209 ATCCTGATGCTGCTGGTCTGGGG + Intronic
1055472045 9:76621635-76621657 ATGCTGATGCTGCTGGTCTCAGG - Intronic
1056744717 9:89290423-89290445 TTTCTCATGCTGCTGGAAGCTGG + Intergenic
1056843714 9:90019305-90019327 TTCCTCCTGCGTCTAGTCACTGG - Intergenic
1058383928 9:104410568-104410590 TTCCTCATGCAAATGTTCACAGG - Intergenic
1058959206 9:109977119-109977141 TTTCTAATGCTGCTGGTCCTGGG + Intronic
1059293746 9:113251014-113251036 TGCCTCATGATTCTGGTGACTGG - Intronic
1060855856 9:126914800-126914822 TTCCTACTGCGGCTGGGCACCGG + Exonic
1061748077 9:132754617-132754639 TTCCTCCTGCTGCTGTTCCCGGG + Intronic
1062367237 9:136216712-136216734 TTCCTCATGCAGCTGTTCCCTGG - Exonic
1187337827 X:18396162-18396184 TTCCTGATGCTGCTAGTCCCTGG + Intergenic
1189052408 X:37660208-37660230 TTGCTCATGCTACTGGTTCCAGG - Intronic
1189952734 X:46248934-46248956 TTCCTGCTGCTGCTGGTCTCTGG + Intergenic
1190124369 X:47690340-47690362 TGCCACATGCTGCTGGCCACTGG + Intergenic
1193200294 X:78681803-78681825 TTCCTGATGCTGTTGGTCTGAGG + Intergenic
1193801420 X:85941271-85941293 TTGCTCATGCTGCTGGTCTAGGG - Intronic
1195738011 X:108033426-108033448 CTCCTCATGCTGCTGCACCCAGG + Intergenic
1196774408 X:119325363-119325385 TTCCTGGTGCTGCTGGACACGGG - Intergenic
1197850969 X:130859890-130859912 TTCCTCCTACTCCTGCTCACTGG + Intronic
1199242586 X:145564987-145565009 TTCCTTCTGCTGCTAGTCTCTGG + Intergenic
1199895949 X:152127946-152127968 TTCCTCATTCAGCTGGTCACAGG - Intergenic
1200017071 X:153174035-153174057 TTTCTCATGCTTCTGGTGGCTGG - Intergenic
1200683830 Y:6243598-6243620 TTCATCTTGCTGCCGGTAACAGG + Intergenic
1201048805 Y:9910788-9910810 TTCATCTTGCTGCCGGTAACAGG - Intergenic
1201281467 Y:12346432-12346454 TTCCTCAGGCTGCAGTGCACTGG + Intergenic