ID: 953883736

View in Genome Browser
Species Human (GRCh38)
Location 3:46704395-46704417
Sequence TGTCCCCTAGAGACCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 4, 2: 3, 3: 18, 4: 184}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953883724_953883736 26 Left 953883724 3:46704346-46704368 CCCTAGACACCCAAGGTGGACCA 0: 1
1: 6
2: 2
3: 8
4: 73
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883732_953883736 0 Left 953883732 3:46704372-46704394 CCCTAGACACTCAGGGTGGACTA 0: 1
1: 0
2: 6
3: 13
4: 84
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883733_953883736 -1 Left 953883733 3:46704373-46704395 CCTAGACACTCAGGGTGGACTAT 0: 1
1: 0
2: 6
3: 8
4: 103
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883726_953883736 17 Left 953883726 3:46704355-46704377 CCCAAGGTGGACCATGTCCCTAG 0: 1
1: 1
2: 1
3: 5
4: 71
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883725_953883736 25 Left 953883725 3:46704347-46704369 CCTAGACACCCAAGGTGGACCAT 0: 1
1: 6
2: 2
3: 10
4: 91
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883727_953883736 16 Left 953883727 3:46704356-46704378 CCAAGGTGGACCATGTCCCTAGA 0: 1
1: 1
2: 1
3: 20
4: 87
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883723_953883736 27 Left 953883723 3:46704345-46704367 CCCCTAGACACCCAAGGTGGACC 0: 1
1: 5
2: 2
3: 7
4: 63
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184
953883730_953883736 6 Left 953883730 3:46704366-46704388 CCATGTCCCTAGACACTCAGGGT 0: 1
1: 2
2: 3
3: 16
4: 144
Right 953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG 0: 1
1: 4
2: 3
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953883736 Original CRISPR TGTCCCCTAGAGACCCAGGG TGG Intronic
900160204 1:1219708-1219730 TCTGTCCTGGAGACCCAGGGTGG - Intronic
900415158 1:2531408-2531430 CCTCCCCTAAGGACCCAGGGTGG - Intergenic
900548937 1:3243977-3243999 TGTCCCCAAAAGTCACAGGGTGG - Intronic
900972984 1:6001642-6001664 TGTCCCCTCCAGAGCCTGGGGGG - Intronic
901182338 1:7350260-7350282 TGTGTCCTAGAGCCCCAGGAGGG + Intronic
901229234 1:7632785-7632807 TCTTCCCCAGAGACCCACGGAGG - Intronic
902727103 1:18344523-18344545 TGTCCCCCAGAGAAGCAGAGTGG - Intronic
903325725 1:22567515-22567537 TGGCCCCTGGGGACCCAGGGAGG + Intronic
904029587 1:27525903-27525925 TGTCCCCTGGAGTCCCTGGATGG - Intergenic
904468607 1:30722439-30722461 TGTCCTCCAGAGACCCAAGAAGG + Intronic
906070671 1:43013993-43014015 TGTCTCATAGAAGCCCAGGGAGG + Intergenic
906635378 1:47406200-47406222 TGTCCCTGTGAGGCCCAGGGAGG - Intergenic
907317613 1:53582498-53582520 TGGGGCCTTGAGACCCAGGGCGG - Intronic
911489100 1:98540323-98540345 TTTCCCCTAGAGAGTCAGAGGGG - Intergenic
913135263 1:115882336-115882358 TCTCCCCTAGAGACTCTGGAAGG + Intergenic
914325841 1:146615435-146615457 TGTCCCTTGGAGCCCCAGGTTGG + Intergenic
915085499 1:153385458-153385480 TGTCCCATCCACACCCAGGGTGG + Intergenic
916988692 1:170218811-170218833 GGTACCCCAGAGACACAGGGAGG + Intergenic
917047174 1:170874046-170874068 TTTCTGCTAGAGTCCCAGGGAGG - Intergenic
918101193 1:181376481-181376503 TATCTCTTAGAGACTCAGGGAGG - Intergenic
923291242 1:232548319-232548341 TATCCCCTAGGGAGTCAGGGTGG - Intronic
1063715092 10:8519254-8519276 TCTCCCCTAGAGCCCCTGGAAGG + Intergenic
1065229250 10:23580089-23580111 TGTCTCCTAGTGACCCAGCCTGG + Intergenic
1071860596 10:89668833-89668855 TGTCCCCTGAATACCCAGGGTGG + Intergenic
1072295641 10:94007091-94007113 TTTCCCCTAGAAACCCAGAAAGG - Intronic
1074295402 10:112183372-112183394 TGTTCCCTAGGGACCCAGGCGGG + Intronic
1074948111 10:118300795-118300817 ACTTCCCTAAAGACCCAGGGAGG + Exonic
1076704408 10:132293455-132293477 TGTCCCCATGAGTCCAAGGGAGG - Intronic
1077246569 11:1542168-1542190 TGTTTCCTCAAGACCCAGGGAGG - Intergenic
1077543208 11:3157382-3157404 CGTCCCCAGGAGACCCGGGGAGG + Intronic
1077663816 11:4091429-4091451 TCTCCACCAGAGACCCTGGGTGG - Exonic
1080642297 11:34165016-34165038 TTCCCTCTGGAGACCCAGGGAGG - Intronic
1080932287 11:36824513-36824535 TGTTCTCTAAAGACCCAGAGGGG + Intergenic
1081677970 11:44981977-44981999 TGTCCCCTTGAGACAAAGGCAGG - Intergenic
1083699254 11:64464270-64464292 TGTCCCCAAGAGACAGAGTGTGG - Intergenic
1085976308 11:81659873-81659895 TGTACCCTAGAGAGCCACAGGGG - Intergenic
1086373485 11:86177511-86177533 TACCCCCTAGAGCCACAGGGAGG - Intergenic
1087231997 11:95676436-95676458 TTACCCCTAGAGACCTAGGGTGG + Intergenic
1087779001 11:102283600-102283622 AAACCCCTAGAGACCCAGAGAGG - Intergenic
1089299602 11:117490637-117490659 TATCCCCTACAGAACCAGTGAGG + Intronic
1091195930 11:133730722-133730744 TGTCCCTTAAGCACCCAGGGAGG + Intergenic
1092241228 12:6837631-6837653 TGCCCCCAAGAGCCCCGGGGTGG + Intronic
1093280051 12:17182670-17182692 TTTCCCCCAAATACCCAGGGAGG - Intergenic
1098466677 12:70794949-70794971 TGTCTTCTAGAGATTCAGGGTGG + Intronic
1103961608 12:124612385-124612407 TGTCCCGCTGACACCCAGGGTGG + Intergenic
1104601992 12:130161070-130161092 TGACCCGGAGAGACCCTGGGAGG + Intergenic
1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG + Intergenic
1107016219 13:35709655-35709677 TGTCCCCAAGAGAGCCACGCTGG - Intergenic
1119425269 14:74531067-74531089 TGTCCCTTTGAACCCCAGGGTGG + Intronic
1121631162 14:95422847-95422869 TGTCCCCAAGACTCCCAGGAAGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1123110285 14:105863972-105863994 TGGACCCCAGAGGCCCAGGGTGG + Intergenic
1125628161 15:41126079-41126101 TGTGCCCAAGAGAACCAGGAAGG - Intergenic
1128752417 15:70158976-70158998 TCTCCCCTAGAGTCCCTGGAGGG + Intergenic
1129351383 15:74957594-74957616 TGGCCCCTTGAGATCCAGTGGGG + Intronic
1129415066 15:75371859-75371881 TGTCCCAGAGAGGCCCAGTGAGG + Exonic
1129777732 15:78247678-78247700 TATCCCCTAGAGCCTCCGGGAGG + Intergenic
1131290530 15:91102941-91102963 TGTTCCCAAGAGACCCAGAAAGG + Intronic
1134077492 16:11302171-11302193 TCTCCCCTAGAGCCTCTGGGAGG - Intronic
1135899439 16:26443345-26443367 TGTCCCCAGGAGACCCTGGAGGG + Intergenic
1136530842 16:30867945-30867967 TGTCCCCTAGAGCCTCCAGGAGG + Intronic
1137696628 16:50466140-50466162 TGTCCCCTAGAGGTGCAAGGAGG - Intergenic
1138393734 16:56688946-56688968 AGTCCTCTAGGGACCCAGAGAGG + Intronic
1138596931 16:58034150-58034172 TGTCACCTAGAGTCACAGGTGGG - Intronic
1140007724 16:71095507-71095529 TGTCCCTTGGAGCCCCAGGTTGG - Intronic
1141164109 16:81648904-81648926 TGTCCCCTAGAGCCCCCAGCAGG + Intronic
1142104999 16:88297899-88297921 TGTCCCCAGGAGTCCCTGGGAGG + Intergenic
1143946078 17:10593570-10593592 TGTCCCCTGGAGGGGCAGGGGGG + Intergenic
1143972722 17:10807112-10807134 TGTCCCCAGGAGAGACAGGGAGG - Intergenic
1144331055 17:14224503-14224525 AGTCCCCTAGAGAGACAGTGAGG - Intergenic
1144718630 17:17452057-17452079 TGTCCCCTACAGGGACAGGGTGG - Intergenic
1144801993 17:17935639-17935661 GATCCCATAGAGACCCAGGGAGG - Intronic
1146668037 17:34717652-34717674 TGTCCCCTCCCGCCCCAGGGGGG + Intergenic
1148342867 17:46883922-46883944 TGGGCCCAAGAGAGCCAGGGAGG - Intronic
1149661200 17:58334903-58334925 CCTCCCCAAGAGACACAGGGAGG + Intergenic
1150155625 17:62850678-62850700 TCTCCTCTAGGGACCCAGGTTGG - Intergenic
1150248703 17:63694294-63694316 CGTCCCCTAGAGTCCCAGGTTGG + Exonic
1152611019 17:81315052-81315074 TGTCCAGCAGAGACCCTGGGGGG - Intronic
1153685937 18:7545406-7545428 TCTCCCCTAGAGCCCCTGGAGGG - Intergenic
1159937681 18:74382069-74382091 TGTCCCCCAGAGGTGCAGGGTGG - Intergenic
1160411559 18:78678512-78678534 TCTCCCCTGGAGCCCCAGAGGGG - Intergenic
1160782888 19:885622-885644 TCTCCCCTGGAGCCCCCGGGAGG + Intronic
1160783996 19:891409-891431 TGTTCCCTAGACAGCCAGAGGGG - Intronic
1160840251 19:1143572-1143594 TTTCCCCTGGAGCCCCCGGGAGG - Intronic
1160866947 19:1260337-1260359 TGTCCCCTCGGGGCTCAGGGTGG + Intronic
1161140002 19:2641571-2641593 TTTCCCCTGGAGCCCCAAGGAGG + Intronic
1162022698 19:7874833-7874855 TGCCCCCCAGAGACCCTGGGCGG - Intergenic
1162498675 19:11038409-11038431 GGCCCCCTGCAGACCCAGGGCGG - Intronic
1163003324 19:14382332-14382354 TGCCCCCAAGAAACCCAAGGTGG - Intronic
1163799648 19:19356750-19356772 TGTGCCCCAGAGACCCAGCAGGG - Exonic
1164710629 19:30354730-30354752 TGTCCCCTGGAGACCAAGAAAGG + Intronic
1164717026 19:30399715-30399737 TGTCACCTAGTCACCCAGGCTGG + Intronic
1164830168 19:31314142-31314164 TGTCCCCTAGACAACCAGAAAGG + Intronic
1166499904 19:43332755-43332777 TGACCCAAAGAGACCCAGGCTGG + Intergenic
1166683948 19:44784093-44784115 TATCCCCTAGAGAGGCAGGCAGG + Intronic
1167376928 19:49117433-49117455 TCTCCCATAGAGTCCCAGAGTGG - Intronic
926185051 2:10683767-10683789 TGTCCCCAGGAGACCCAAGAGGG + Intronic
926300546 2:11599100-11599122 TGTCTCCCAGAGTCACAGGGTGG + Intronic
926942437 2:18152527-18152549 TTTCCCCTAGATCCCCTGGGAGG + Intronic
927648937 2:24899169-24899191 TGACCCACAGAGGCCCAGGGAGG + Intronic
927713244 2:25338627-25338649 TGTCCAATGGGGACCCAGGGAGG + Intronic
928615428 2:33033988-33034010 TGTCCCCCAGGGAGCCGGGGAGG - Intronic
929519095 2:42631717-42631739 TCTCCCTTAGTGACCCAGGCTGG + Intronic
929693072 2:44090669-44090691 TGACCCCTTGAGGCCTAGGGTGG + Intergenic
932212841 2:69946285-69946307 TGTCCCCTAGGTACCCCGGAAGG + Intergenic
933291554 2:80443881-80443903 TGTGCCCTAGAGACCAAATGGGG + Intronic
934032010 2:88056382-88056404 TGAGACCTAGAGTCCCAGGGAGG - Intergenic
935272809 2:101449661-101449683 TGTCCAGTAGAGAGCCAGGGAGG + Intronic
935974496 2:108564542-108564564 AATCCACTTGAGACCCAGGGAGG + Intronic
938324443 2:130388981-130389003 TCTCCCCTAGAGACCCCAGAAGG - Intergenic
944618331 2:201485072-201485094 TCTCCCCTAGAGACTCCGGAAGG - Intergenic
946603781 2:221379586-221379608 TTTCCCCCAGCAACCCAGGGTGG - Intergenic
948241742 2:236443404-236443426 TGTCCCCCACAGACACATGGAGG - Intronic
948672927 2:239580017-239580039 TGTGCCTTAGAGAACCAGGAAGG + Intronic
1169322488 20:4645064-4645086 TGACCCCTAGAAATCCAGAGGGG - Intergenic
1170118554 20:12887524-12887546 TGTCCCCCAGTGATCAAGGGTGG + Intergenic
1173554905 20:43959019-43959041 TGTCTCCTGGAGACCCAGGAGGG - Intronic
1173624986 20:44466046-44466068 TGTCCCCTAGAGCCTCCTGGAGG - Intergenic
1174038516 20:47682961-47682983 CATCCCCCAGGGACCCAGGGAGG - Intronic
1174509482 20:51040353-51040375 TCTCCGCTAGAGACCCGGGAGGG - Intergenic
1175141404 20:56862823-56862845 TGTCCCAGAAAGTCCCAGGGAGG + Intergenic
1175215375 20:57389592-57389614 TGCCCCCTAGAGGCCGGGGGAGG - Intergenic
1175593120 20:60209204-60209226 TGACCTCCAGAGAGCCAGGGTGG + Intergenic
1175999860 20:62826932-62826954 TGTTCCCTGGACACCCTGGGAGG + Intronic
1178305869 21:31489600-31489622 TGGGTCCAAGAGACCCAGGGTGG - Intronic
1179383799 21:40923512-40923534 TGTCCCCTCGAGGCGCAGCGTGG + Intergenic
1179471575 21:41614039-41614061 AGTCCCCCAGGGACCCAGGTTGG + Intergenic
1180956508 22:19743699-19743721 TGTCCCCCAGCACCCCAGGGTGG + Intergenic
1183018353 22:35008075-35008097 TTTCCCCGAGAAACCCAGGGTGG - Intergenic
1183075868 22:35426395-35426417 TGACACCTAGAGAGGCAGGGAGG + Intergenic
1183309679 22:37102706-37102728 TGGACCCTGGAGACCCAGAGGGG + Intronic
1183715296 22:39529747-39529769 GTTCCCCTAGGGACCCATGGCGG - Intronic
1184114487 22:42414438-42414460 TGTCCCCCAGGGACCCAGGTGGG + Intronic
1184355856 22:43979194-43979216 TGTCCCAGAGAGAAGCAGGGTGG - Intronic
1184437434 22:44487967-44487989 TGTGCCCTGGAGGACCAGGGTGG - Intergenic
1184750452 22:46483314-46483336 TGCGCCCTAGACACCCAGTGAGG - Intronic
951486347 3:23215747-23215769 TGTCCCCTACCCACCCAGTGGGG + Intronic
953883667 3:46704154-46704176 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883682 3:46704207-46704229 TATCCCCTAGACACCCAGGGCGG + Intronic
953883722 3:46704342-46704364 TGTCCCCTAGACACCCAAGGTGG + Intronic
953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG + Intronic
953883803 3:46704615-46704637 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883828 3:46704697-46704719 CGTCCACTAGACACCCAGGGTGG + Intronic
953883860 3:46704807-46704829 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883869 3:46704834-46704856 TGTCCCCTAGACACCCAGGGTGG + Intronic
956825945 3:72996983-72997005 GGTCCCCAAGAGACCCGCGGAGG + Exonic
957637834 3:82809668-82809690 TCTCCCCTAGAGCCTCAGGAAGG + Intergenic
959350476 3:105255909-105255931 TGTCCCCTGGGGAGCCTGGGTGG + Intergenic
961109787 3:124274144-124274166 TGTGCCCTAGGCACCCAGGAAGG - Intronic
961393214 3:126568998-126569020 TGTCCCCTGGAGGCAGAGGGTGG + Intergenic
962806784 3:138933172-138933194 TGACCCCTGGAGACCCAGGCAGG - Intergenic
968050497 3:195651671-195651693 GGTCCCCAAGAGACCCGCGGAGG - Intergenic
968096825 3:195937188-195937210 GGTCCCCAAGAGACCCGCGGAGG + Intergenic
968105328 3:195996683-195996705 GGTCCCCAAGAGACCCGCGGAGG + Intergenic
968106193 3:196003096-196003118 TTTCAGCTAGAGACTCAGGGAGG - Intergenic
968303617 3:197634260-197634282 GGTCCCCAAGAGACCCGCGGAGG + Intergenic
968579932 4:1385113-1385135 TGTCCCCATGAGACACAGGGAGG - Intronic
968846532 4:3045467-3045489 TTTCCCCTAGATCCTCAGGGTGG + Intergenic
985410893 4:189682715-189682737 TGCACCCTGGAGACTCAGGGAGG + Intergenic
985740727 5:1614781-1614803 GGTCCCCAAGAGACCCGCGGAGG + Intergenic
985886460 5:2683942-2683964 TGTCCCCCAGAAACCCACGATGG + Intergenic
987331707 5:16863056-16863078 TGTAGTCTACAGACCCAGGGAGG + Intronic
988068691 5:26258621-26258643 TCTCCCTTAGAGACTCAGGTTGG + Intergenic
988681088 5:33484725-33484747 CGTCTCCTAGAGACCCAGGGTGG + Intergenic
995627027 5:114091141-114091163 TGTGCCCTAGAGTTCCAGGAAGG + Intergenic
997421595 5:133772659-133772681 TGTGCACGAGAGAGCCAGGGAGG + Intergenic
998168818 5:139860103-139860125 AGTCCCCAAGAGCCCCAAGGAGG + Intronic
999804543 5:155069663-155069685 TCTCCCCTAGAGCCCCTGGAAGG + Intergenic
1000044789 5:157513296-157513318 AGTGCCATAGAGGCCCAGGGCGG - Intronic
1001534821 5:172491021-172491043 AGCCCCCTAGAGAAGCAGGGTGG - Intergenic
1008101019 6:47391637-47391659 GGTTCCCTTGTGACCCAGGGTGG + Intergenic
1008887132 6:56443940-56443962 GGCCCCCAAGAGGCCCAGGGAGG - Intergenic
1017485814 6:154900962-154900984 TGTCCCCTTGGTCCCCAGGGCGG + Intronic
1018344750 6:162888688-162888710 TGACCCCTGCAGACCCAGGCAGG - Intronic
1019315166 7:380792-380814 TCTCCCCGGGAGAGCCAGGGAGG + Intergenic
1019616212 7:1963731-1963753 AGTGCCCCAGACACCCAGGGAGG - Intronic
1020213054 7:6169825-6169847 GGACCCCTAGAGACACAGGGTGG + Intronic
1023333144 7:39140475-39140497 TGTCCCCTAGAGTCCCTAGAGGG - Intronic
1027123609 7:75539954-75539976 AGTTCCCTAGAAACCCAGGTAGG + Intronic
1028165141 7:87529965-87529987 TGTCCCCTACAGACACTGGCTGG + Intronic
1034161982 7:149000761-149000783 TTTCCCCCAGAGCCACAGGGTGG - Intergenic
1034433634 7:151052885-151052907 TCTCCCCTAGAGATTCATGGGGG - Intergenic
1034576717 7:152006122-152006144 GGTTCCCTGGAGGCCCAGGGAGG + Intronic
1035888978 8:3324001-3324023 TAACCCCCAGAGACCCAGGAGGG + Intronic
1036770369 8:11574876-11574898 GGGCCGCTAGAGCCCCAGGGCGG - Intergenic
1038535059 8:28347737-28347759 TGGCCGGGAGAGACCCAGGGAGG - Exonic
1039877310 8:41597948-41597970 TGTCCCCCAGATACTCAGAGTGG - Intronic
1042876778 8:73447800-73447822 TGTCCCCTAGCCACCCAGAGGGG - Intronic
1045242863 8:100417526-100417548 TGTCCCCAAGAGATCCAAGACGG - Intergenic
1047251215 8:123183094-123183116 TGTCCCCCAGACACCCTGGGAGG + Exonic
1048419911 8:134267916-134267938 TGTACCCTAGGGATCCATGGGGG + Intergenic
1048885271 8:138904390-138904412 TCAACCCTATAGACCCAGGGAGG - Intronic
1048964284 8:139604127-139604149 TGCGCCCTGGAGAGCCAGGGAGG - Intronic
1050307080 9:4315691-4315713 TGGCCCCAAAAGACCCAGGGAGG - Intronic
1052573722 9:30264493-30264515 AGTTCCCTTCAGACCCAGGGTGG + Intergenic
1055829213 9:80359716-80359738 AGGGCCCTGGAGACCCAGGGAGG - Intergenic
1058676907 9:107407861-107407883 TGTCATCCAGAGAACCAGGGAGG - Intergenic
1059277818 9:113110250-113110272 GGGCCCCTAGATACCCAGTGGGG + Intergenic
1059278433 9:113114301-113114323 GGGCCCCTAGATACCCAGTGGGG - Intergenic
1059446706 9:114342564-114342586 AGTCCCCTGGGGAACCAGGGGGG + Intronic
1060001815 9:119965689-119965711 TGTCCCCTAGAGCCCTCAGGAGG + Intergenic
1060213324 9:121723707-121723729 TTTCCCCTAGAGGCCCTGTGTGG + Intronic
1061661760 9:132134982-132135004 TGCAAGCTAGAGACCCAGGGAGG - Intergenic
1061795205 9:133082214-133082236 TGTCCCCTAGGTCCCCAGAGGGG - Intronic
1062617583 9:137404982-137405004 TGTCCCCTCGAGCACCTGGGAGG - Intronic
1062627011 9:137447979-137448001 TGTCCCCTCCAGACCCGGCGAGG + Exonic
1203671869 Un_KI270755v1:22721-22743 TGCACCCTGGAGACTCAGGGAGG - Intergenic
1185700060 X:2223968-2223990 TCTCTCCTGGGGACCCAGGGTGG - Intronic
1197267936 X:124396226-124396248 TTTCCCCAGGAGACTCAGGGAGG - Intronic
1199804004 X:151279729-151279751 TGGCCCCTAGGGACTCAGAGAGG - Intergenic