ID: 953883934

View in Genome Browser
Species Human (GRCh38)
Location 3:46705084-46705106
Sequence TCCCCTCAGTCCCCCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 417}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953883928_953883934 3 Left 953883928 3:46705058-46705080 CCTCTAGACCCTGGGGCAGTGTC 0: 1
1: 0
2: 1
3: 5
4: 169
Right 953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 417
953883929_953883934 -5 Left 953883929 3:46705066-46705088 CCCTGGGGCAGTGTCCTATCCCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 417
953883930_953883934 -6 Left 953883930 3:46705067-46705089 CCTGGGGCAGTGTCCTATCCCCT 0: 1
1: 0
2: 3
3: 21
4: 215
Right 953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 417
953883924_953883934 30 Left 953883924 3:46705031-46705053 CCTCTCAGAACTGGGGCAGGACT 0: 1
1: 0
2: 0
3: 22
4: 290
Right 953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953883934 Original CRISPR TCCCCTCAGTCCCCCAGGGC AGG Intronic
900326865 1:2112505-2112527 ACCCCACAGTCCCCCATGCCGGG - Intronic
900497697 1:2983541-2983563 TCCGCACAGTCGCCCAGGGCAGG + Intergenic
901537396 1:9891442-9891464 TCCCCTCAGAATCCCAGGGCTGG + Intronic
901559549 1:10059198-10059220 CTCGCTCTGTCCCCCAGGGCTGG - Intronic
901772033 1:11535420-11535442 TCCTCTGAGGCCTCCAGGGCGGG + Intronic
902237762 1:15068573-15068595 TCCTCTCGGTCCTCCAGGGAGGG - Intronic
902620268 1:17646744-17646766 GCCCCTCACCTCCCCAGGGCTGG - Intronic
902665030 1:17931432-17931454 TCTCCTCTGTCACCCTGGGCAGG - Intergenic
902768050 1:18630094-18630116 CCTCCTCAGGCCCCCAGGCCGGG - Intergenic
902897035 1:19485873-19485895 ACCCCACAGTCCCCGCGGGCGGG + Intergenic
903369823 1:22828102-22828124 GCCCATCAGTGGCCCAGGGCTGG - Intronic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
903577471 1:24347681-24347703 GCCCCTCAGGCCCCCTGGACAGG - Intronic
903580313 1:24365817-24365839 TTCCCCCAGGCCCACAGGGCTGG + Intronic
904472589 1:30745374-30745396 TCCCCTCAGTGCCTCAGTGGAGG + Intronic
904558064 1:31378370-31378392 TACCCCCTGTCCCCCAGGGCAGG - Intergenic
904599491 1:31665729-31665751 TCCCCTCTGCCCACCATGGCTGG + Intronic
905106857 1:35568627-35568649 TCCACTCAGTCTCCCAGATCAGG - Intergenic
905953739 1:41974908-41974930 TCACCTCAGTCCTGAAGGGCAGG - Intronic
906112007 1:43330379-43330401 TCCCCTCCCGCCCCCAGGGAAGG + Intergenic
906241513 1:44245081-44245103 TGACCTCTGACCCCCAGGGCTGG + Intronic
906467749 1:46098947-46098969 CCACCTCAGTCTCCCAGAGCTGG + Intronic
906699144 1:47844950-47844972 TCACATCCCTCCCCCAGGGCAGG + Intronic
907513473 1:54979294-54979316 TCCACTCATTTCCACAGGGCAGG - Intergenic
907939387 1:59072834-59072856 TCTTCTCAGCCGCCCAGGGCTGG + Intergenic
910208996 1:84775006-84775028 TCCCTGCAGACCCTCAGGGCAGG - Intergenic
911001477 1:93170501-93170523 TCCCCTCAGCCCCCCACTGTGGG + Intronic
911333951 1:96558704-96558726 TCCACTCAGTCTCCAATGGCAGG + Intergenic
912412581 1:109488848-109488870 TCCACTCAGTACACCAGCGCCGG + Exonic
912840541 1:113035304-113035326 TTCCATGATTCCCCCAGGGCAGG - Intergenic
913109297 1:115642649-115642671 GCCCCCCAGGCCTCCAGGGCCGG - Intronic
913405770 1:118489144-118489166 TACCCTCAGTCTCCCAGCGCTGG + Intergenic
915037715 1:152942709-152942731 TCCTCTCAGTCCTCCAGTCCTGG + Intergenic
915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG + Intergenic
915530769 1:156500934-156500956 GCCCCTCGCTTCCCCAGGGCTGG + Intergenic
916211849 1:162366137-162366159 TACACTCAGTACCCCTGGGCTGG + Intronic
916762119 1:167826457-167826479 TCCCCTCAGTGCTCAAAGGCAGG - Intronic
917230762 1:172834996-172835018 TGCCCTAAATCACCCAGGGCTGG - Intergenic
919471907 1:197989239-197989261 CCCCCATGGTCCCCCAGGGCCGG - Intergenic
920528638 1:206685736-206685758 TCCCCTGAGTCCCCAGGAGCGGG - Intronic
921104302 1:211960152-211960174 TCATATCAGTCCCCCAGAGCAGG + Intronic
921300316 1:213745603-213745625 CCACCTCTGTCCCCCAGGGAAGG + Intergenic
922006563 1:221536802-221536824 TCCACTCAATCCTCCAGGACAGG - Intergenic
922470683 1:225875326-225875348 TCCCCACAGTCCACCTTGGCAGG + Intronic
923106931 1:230861619-230861641 TCGCCTCACTCCCCCAGAGCCGG + Intronic
924161590 1:241238562-241238584 TTCACTCTGTCACCCAGGGCTGG + Intronic
1062979797 10:1712635-1712657 CTCCCTCTGTCCCCCAGGGAAGG + Intronic
1063179360 10:3583999-3584021 TCTCCTGAGCCCCCCAGGCCAGG + Intergenic
1063292358 10:4762228-4762250 TCCCCTAAGTCCCACAGGTAAGG - Intergenic
1063449936 10:6144704-6144726 TCCCCCCGGTCCCGCAGGGGCGG - Intergenic
1065118544 10:22505939-22505961 TGCCCCCAGTCCTCCAGTGCTGG + Intergenic
1065523546 10:26594829-26594851 TCCCCTCAATCCCCCACAACAGG + Intergenic
1065529623 10:26655188-26655210 TCCCCTCAATCCCCCACAACAGG + Intergenic
1066963502 10:42241916-42241938 TCCCCCCAGTCCCCGTGGGGCGG - Intergenic
1067068792 10:43118121-43118143 TCCCCAGAGTGTCCCAGGGCTGG - Intronic
1067180852 10:43985024-43985046 ACTCCTCACTCCTCCAGGGCAGG - Intergenic
1067416278 10:46106014-46106036 TACCCTCACTCCCCCACTGCAGG + Intergenic
1069936981 10:71924334-71924356 TCCCTTAGGTCCCCCAGGACTGG + Intergenic
1070836868 10:79452989-79453011 TCCCTTCTGTGCCCCTGGGCTGG - Intergenic
1070895621 10:79981549-79981571 TCGCCTCGCTCCCCCTGGGCTGG - Intronic
1071797066 10:89018825-89018847 GCCCCTCACTGCCCCAGGGCCGG + Intergenic
1072741485 10:97912585-97912607 ACCCCCCAGTCCCTGAGGGCTGG - Intronic
1073045808 10:100637655-100637677 TCCCCACAGTCATTCAGGGCTGG - Intergenic
1073185683 10:101613878-101613900 TCCTCTCAGTAGCCCAGAGCTGG + Intronic
1074196071 10:111186528-111186550 TCCCCTGAGGACCCCATGGCAGG + Intergenic
1074371496 10:112904299-112904321 TCAGCTGAGTCACCCAGGGCAGG + Intergenic
1074720140 10:116257079-116257101 TCCCCACTGTCCACCAGGGGAGG + Intronic
1075301591 10:121329407-121329429 TCCCATCACTCCCCAAGGGCTGG + Intergenic
1075424466 10:122330756-122330778 TTCACTCTGTCCCCCAAGGCTGG + Intronic
1075627520 10:123973276-123973298 TCCCCGCAGACACCCATGGCTGG - Intergenic
1075933783 10:126322569-126322591 TCCTATCACTGCCCCAGGGCTGG - Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076722822 10:132400195-132400217 CCCTCTCACTCCCCAAGGGCAGG - Intronic
1077371870 11:2186110-2186132 TCCCCACTGTCCGCCTGGGCAGG + Intergenic
1077394027 11:2312418-2312440 TCCCCGCAGTGCCCAGGGGCGGG - Intronic
1077900156 11:6481249-6481271 TCCCCTCAGGGCGCCAGGCCCGG + Exonic
1080614162 11:33931652-33931674 TCCCCTCAATGCCTCTGGGCTGG - Intergenic
1080742918 11:35082497-35082519 CACCATCAGTCCACCAGGGCAGG - Intergenic
1081785523 11:45744172-45744194 TCCCATCAGTCTCCCAAAGCCGG - Intergenic
1081812625 11:45922356-45922378 TCCCCTCACTCCCCAAGGGGAGG - Intronic
1081977610 11:47245644-47245666 TCCCCTCACCACCCCAGGGAAGG + Intronic
1082287552 11:50333878-50333900 TCACCTCTCTCCCCCTGGGCTGG + Intergenic
1083320569 11:61843513-61843535 TCATCTCAGGCCACCAGGGCTGG + Intronic
1084088897 11:66867518-66867540 TCCACTCAGTGCCACAGGCCAGG + Intronic
1084335536 11:68455533-68455555 CTGCCTCAGTGCCCCAGGGCAGG - Intergenic
1084544827 11:69810032-69810054 GCTCCTCAGTCTGCCAGGGCTGG + Intergenic
1084639268 11:70414755-70414777 TCTCTGCAGTCCCCCAGAGCTGG - Intronic
1089560999 11:119343033-119343055 CCCCCTCAGTCAGCCAGGGCTGG - Intronic
1090056032 11:123425858-123425880 TCCCTTCATTTCCCCAGGGAGGG - Intergenic
1090390813 11:126386166-126386188 TCCCCCCAGTGGCCAAGGGCTGG + Intronic
1090406637 11:126479708-126479730 TCCCTTCGCTCCCCCGGGGCCGG + Intronic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1094188863 12:27676466-27676488 TCCTCCCAGGCCCCCAGGGCAGG + Exonic
1096183860 12:49565900-49565922 TGCCCTCAGTCCCACAGGGAAGG + Intronic
1096585182 12:52615237-52615259 TCCCTTCAGTCCCCCAGCAGTGG - Intronic
1096627634 12:52905097-52905119 TCCCCCCCATCCCCCGGGGCTGG - Intronic
1102496245 12:113321166-113321188 TCTCACCAGCCCCCCAGGGCAGG + Intronic
1103342043 12:120225917-120225939 TCCCCTCTGTCCATCTGGGCAGG - Intronic
1103485300 12:121278923-121278945 TGGCCTGCGTCCCCCAGGGCAGG + Intronic
1103989013 12:124785964-124785986 CCCCCTCAATCCCCCTGAGCAGG + Intronic
1104003876 12:124878669-124878691 TGCCCTCAGTGCACCAGGACTGG + Intronic
1105455667 13:20538981-20539003 TTCCCTCATTCCCCCAGTCCTGG + Intergenic
1106468436 13:30033544-30033566 TCCCCTCTGTCCCTTAGGGCTGG + Intergenic
1106510439 13:30408379-30408401 TCTGCTCAGTTCTCCAGGGCGGG + Intergenic
1109204753 13:59468778-59468800 TCCCCTAAGTACCCCAAGGCAGG - Intergenic
1110305103 13:73977291-73977313 TCACCTCAGCCTCCCAGAGCTGG + Intronic
1112753472 13:102605294-102605316 TCGGCTCACTCCCCCAGGGAAGG - Intronic
1113120155 13:106917272-106917294 TCCCCTCAAACCCCCTGGACCGG - Intergenic
1113912221 13:113848166-113848188 TCCCCTCAGTTCCCCGGGTGGGG - Intronic
1113930293 13:113964749-113964771 TGCCCTCAGTCCCTCAGGCTCGG + Intergenic
1114657419 14:24324378-24324400 TCCCTTCAGGCCCCCAGCTCTGG - Exonic
1116972581 14:51081967-51081989 TGACCTCTGACCCCCAGGGCAGG - Intronic
1117124442 14:52606549-52606571 CCACCTCAGACTCCCAGGGCTGG + Intronic
1118180279 14:63485857-63485879 CTCCCTCTGTCACCCAGGGCTGG + Intronic
1119650759 14:76381246-76381268 GCCTCCCAGTCCCCCAGAGCTGG - Intronic
1121486653 14:94321552-94321574 TCACTGCAGTTCCCCAGGGCAGG + Intronic
1122003653 14:98684731-98684753 TCCCCACACCCCTCCAGGGCAGG - Intergenic
1122083919 14:99286249-99286271 ACCCCTGAGCCCCCGAGGGCAGG - Intergenic
1122263843 14:100537800-100537822 TCCCCTCAGGCCTACAGGGCTGG + Exonic
1122266687 14:100549965-100549987 GCCCCCCAGGCCCCCAGGCCTGG - Intronic
1122888178 14:104719796-104719818 GTCCCCCAGTCCCCCAGGCCAGG + Intronic
1122901595 14:104784396-104784418 TCTCCGCTGTCCCCCCGGGCAGG - Intronic
1122913310 14:104844197-104844219 TACCCCTAGTCCCCCAGGGGTGG + Intergenic
1122923491 14:104889619-104889641 GCCACTCAGACCCCGAGGGCTGG + Exonic
1122967396 14:105137787-105137809 GCCCCTGAATCCACCAGGGCTGG + Intergenic
1122972089 14:105156499-105156521 TCCCCTCAGGCCCCCAAGACAGG + Intronic
1123042286 14:105495347-105495369 ACCCCTAGGTCCCCCTGGGCAGG - Intronic
1123441586 15:20295514-20295536 TCCCCCCAGTCCCCGTGGGGCGG + Intergenic
1124406394 15:29396261-29396283 TCCCCTCTCTCCCCCAGCCCCGG + Intronic
1124512824 15:30341124-30341146 TTTCCTCACTGCCCCAGGGCTGG + Intergenic
1124514281 15:30352990-30353012 TCCTCTCAGAACCCCAGGCCAGG + Intergenic
1124623576 15:31294751-31294773 TCCCCTCTCTGTCCCAGGGCTGG + Intergenic
1124696559 15:31869313-31869335 TCCCCGCCTTCGCCCAGGGCAGG + Intronic
1124728638 15:32177774-32177796 TCCTCTCAGAACCCCAGGCCAGG - Intergenic
1124730091 15:32189626-32189648 TTTCCTCACTGCCCCAGGGCTGG - Intergenic
1125593888 15:40872452-40872474 TGCCCTCAATCCCCAAGGCCAGG - Exonic
1126031574 15:44504619-44504641 TCACCTCAGCCTCCCAGTGCAGG - Intronic
1127727025 15:61760256-61760278 TTCCCTCACTTCCCCAGTGCTGG - Intergenic
1128175119 15:65548480-65548502 CTCCCTCTGTCACCCAGGGCTGG - Intronic
1128241986 15:66107552-66107574 TCCCCACAGAGCCCCAGAGCAGG + Intronic
1128817458 15:70623596-70623618 TCACCTCAGCCCCCCAAAGCAGG + Intergenic
1128891652 15:71337294-71337316 TACCCTCGGTCCCCCTGGACTGG - Intronic
1129331011 15:74827066-74827088 TCCCCCCACTCCCCCTTGGCCGG - Intronic
1129394033 15:75234631-75234653 ACTCCTCAGTCCCCCAGGCTTGG - Intergenic
1129772868 15:78213749-78213771 GCCACTGGGTCCCCCAGGGCTGG + Intronic
1130241839 15:82200911-82200933 TCCACTCTGTCACCCAGGCCAGG + Intronic
1130394796 15:83492716-83492738 TTCCCTCTATCCCCCAGGGTTGG + Intronic
1130458539 15:84139941-84139963 TCCACTCTGTCACCCAGGCCAGG - Intergenic
1130903930 15:88226834-88226856 TCCTCTCAGTCACCCAGTGAAGG + Intronic
1131117169 15:89802676-89802698 TCCTCTCCCTCCCCCAGGGTTGG - Intronic
1131121024 15:89823514-89823536 CCCCAGGAGTCCCCCAGGGCAGG + Intergenic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1132671403 16:1103547-1103569 GCCCCTCAGGCCCCCAGGCTGGG + Intergenic
1132860341 16:2067957-2067979 GACCCTCAGGCCTCCAGGGCTGG - Intronic
1134094726 16:11411801-11411823 TCCCCTCACTCCTCCAGGCCAGG + Intronic
1134250273 16:12569279-12569301 TCCCCTACCTCCCCCATGGCTGG + Exonic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1135464243 16:22671601-22671623 TCCTCCCAGTCCTCTAGGGCAGG + Intergenic
1136402204 16:30025019-30025041 CCCCCTCAGTCCCCGAGAGATGG + Exonic
1136409253 16:30066674-30066696 TCCCCTCAAGATCCCAGGGCTGG - Intronic
1136724650 16:32348396-32348418 TCCCCCCAGTCCCCGTGGGGCGG - Intergenic
1136842977 16:33554436-33554458 TCCCCCCAGTCCCCGTGGGGCGG - Intergenic
1137743661 16:50804786-50804808 GCCCCTCAGCCCCCAAGAGCTGG - Intergenic
1137926639 16:52547107-52547129 TCTCCTCAGTCCGCCCGGGGAGG - Intronic
1138516774 16:57540472-57540494 TCCTCTCAGGCCCCCAGGCAGGG - Intergenic
1138575739 16:57906367-57906389 TCTGTTCAGTTCCCCAGGGCAGG - Intronic
1139957735 16:70701141-70701163 TCCCACCTCTCCCCCAGGGCTGG + Intronic
1141582753 16:85011434-85011456 TCCCCTGGGTCCCGCCGGGCAGG + Exonic
1141930645 16:87200253-87200275 TCCCCTCCATCCCCCAGTGCTGG + Intronic
1142059161 16:88018679-88018701 ACACCCCAGTCCCCCAAGGCGGG - Intronic
1142202254 16:88766831-88766853 TCACCTCAGGCCACGAGGGCCGG + Intronic
1142242485 16:88953934-88953956 TGCCCTCATTTGCCCAGGGCAGG - Intronic
1203001780 16_KI270728v1_random:169359-169381 TCCCCCCAGTCCCCGTGGGGCGG + Intergenic
1203133383 16_KI270728v1_random:1705765-1705787 TCCCCCCAGTCCCCGTGGGGCGG + Intergenic
1203153142 16_KI270728v1_random:1854734-1854756 TCCCCCCAGTCCCCGTGGGGCGG - Intergenic
1142556522 17:782089-782111 TCCCCTCCCTCCGCCAGGGCCGG + Intronic
1142609805 17:1102738-1102760 CTCCCTCTGTCGCCCAGGGCTGG + Intronic
1143180578 17:4981773-4981795 TTTCCACAGTCCTCCAGGGCTGG + Exonic
1143711877 17:8741282-8741304 TCCCCAGTGCCCCCCAGGGCTGG + Intronic
1145057445 17:19712807-19712829 TCCCCTGTGTCCTCCAGGACTGG + Intronic
1145304962 17:21668954-21668976 TCCCTGCAGACCCCCAGGACAGG - Intergenic
1146285838 17:31573681-31573703 TCCCCTCAGACCCCAAGGGCAGG - Intronic
1146638088 17:34520762-34520784 TTCCATAAGTCTCCCAGGGCTGG + Intergenic
1146949579 17:36896595-36896617 TCCCTTTTCTCCCCCAGGGCAGG - Intergenic
1147311828 17:39600035-39600057 TCACCTTAGTTCCCTAGGGCAGG - Intergenic
1147314087 17:39611286-39611308 TCCCCTCAGTCACCCAGAGAAGG + Intergenic
1147378728 17:40039330-40039352 CCACCACAGGCCCCCAGGGCAGG + Intronic
1148054606 17:44786723-44786745 TACACTCAGTCCTCCAGGCCTGG + Intergenic
1148205020 17:45774707-45774729 TCCCATCAGGCCCCCTGGGGTGG + Intergenic
1148387398 17:47244302-47244324 TCTGCACAGCCCCCCAGGGCTGG + Intergenic
1149655822 17:58309103-58309125 TCTCCTGAGTCCTCCAGGGCTGG - Exonic
1150060644 17:62065516-62065538 TCCCCTCCGTCCCCCAGAGAGGG - Intergenic
1150924742 17:69521170-69521192 TACCCCCAGTCCCCCATGGGTGG + Intronic
1151293643 17:73167665-73167687 TCCTCTGAGTCCCCCAGGAAAGG + Intronic
1151569075 17:74917214-74917236 CCTCCTCAGTCTCCCAGGCCTGG - Exonic
1151654525 17:75489693-75489715 TTCCCTCCGACCCGCAGGGCTGG + Intronic
1151669796 17:75565724-75565746 TCCCCGCAGTCCCGCAGGCCAGG + Intronic
1152259785 17:79260689-79260711 TCCCATCAGGCCCCAAGGCCGGG - Intronic
1152274782 17:79349854-79349876 TTCCCTGAGCCCCCCGGGGCAGG + Intronic
1152920954 17:83066420-83066442 TCCACTCAGCCCCACAGTGCGGG + Intergenic
1155396702 18:25393585-25393607 TCCCCTCCCTCCACCATGGCTGG - Intergenic
1156157379 18:34319226-34319248 TTCCCTCACTACCCCTGGGCAGG + Intergenic
1157563025 18:48661950-48661972 CCCCCTGGGTCCCCCAGAGCTGG - Intronic
1160557421 18:79735307-79735329 TGACCACAGTCCCCCAGCGCAGG - Intronic
1160723683 19:608385-608407 TCCCCTCAGACCCCGGGGCCGGG - Intronic
1160887108 19:1355154-1355176 TCCCCTCGGTTCCGCCGGGCGGG + Intronic
1160891255 19:1379843-1379865 TCCCCTCACACTGCCAGGGCGGG - Intergenic
1160939614 19:1614213-1614235 TCCCCTCAGGCCCCTAAGGCAGG - Intronic
1161231448 19:3176927-3176949 TCCCCTCAGACCCCAAGGCAGGG + Intronic
1161261557 19:3340569-3340591 GCCCCTCTGTCCCATAGGGCTGG - Intergenic
1161268883 19:3378565-3378587 CCACCTCTGTCCCCCATGGCCGG + Intronic
1161389802 19:4015086-4015108 GACCCTGAGTCCCCCAGGACAGG - Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161473449 19:4472589-4472611 GACCCCCAGACCCCCAGGGCGGG - Intronic
1161572819 19:5039786-5039808 CACCCTCAGACCCTCAGGGCAGG - Intronic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162060314 19:8090782-8090804 TCCCCTCAAAACCCCAGGGCAGG - Intronic
1163297310 19:16420784-16420806 ACCCCTCTTTCCCCCAGGGCTGG - Intronic
1163765461 19:19160990-19161012 TCCCCTGAGTCCCTGAGGGCAGG - Intronic
1163835343 19:19570053-19570075 TCCCTCCAGTCCCTCAGAGCCGG + Intronic
1165060248 19:33201607-33201629 TCTCCTCACTCTCCCATGGCTGG - Intronic
1165318991 19:35074495-35074517 TCCCCTCAGAGCCCCAGGGCAGG - Intergenic
1165390179 19:35534276-35534298 TTCCCTCACTTCCCAAGGGCGGG + Intronic
1165486738 19:36101052-36101074 CCCCCTCCTTCCCCCAGGTCAGG - Intronic
1165793904 19:38507508-38507530 CCACCTCTGTTCCCCAGGGCCGG - Intronic
1165889333 19:39101064-39101086 TCCCCACTGTCTCCCAGGGAGGG - Intronic
1165990884 19:39812706-39812728 CCCCCTTGGTCCCCCAGGGTGGG - Intergenic
1166000215 19:39873186-39873208 TGCCTTCAGACCCCCAGGGCAGG + Intronic
1166094909 19:40532330-40532352 TCCCCACAAGCCCCCAAGGCAGG - Intronic
1166649796 19:44563655-44563677 GCCCTTCAGTCCCCCACCGCAGG - Intergenic
1166684755 19:44789777-44789799 TCCCCTCAGACTCCCAAGGTAGG - Intronic
1166709090 19:44925702-44925724 CCACATCCGTCCCCCAGGGCTGG - Intergenic
1166887665 19:45971849-45971871 TTCCCTGAGCCCCCCACGGCAGG + Intronic
1166894718 19:46016233-46016255 TCCCCTCCCTACCGCAGGGCAGG - Intronic
1167010249 19:46802392-46802414 ATCCTTCAGACCCCCAGGGCAGG - Intergenic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1167430663 19:49452598-49452620 CTCCCTCTGTCGCCCAGGGCTGG - Intronic
1167472302 19:49682093-49682115 TCCCCTCCATCCCTCAGGCCCGG - Intronic
1167477743 19:49710706-49710728 TCCTCCCTGTCCCCCAGGACAGG + Exonic
1167566216 19:50258952-50258974 AACTCTCAGTTCCCCAGGGCAGG + Intronic
1167721816 19:51184830-51184852 CCCCCTCCCTCCCCCAGAGCAGG - Intergenic
1167762496 19:51458339-51458361 TCCCCTTTGTCCCCCAGAGCAGG + Exonic
1168103933 19:54155472-54155494 TCCCTCCAGTCTTCCAGGGCAGG - Exonic
1168412362 19:56147739-56147761 TGGCCTGAGTCCCCCGGGGCAGG + Intronic
925606470 2:5665675-5665697 TCCCCTTATGCCCCCAGGGATGG - Intergenic
925750946 2:7090260-7090282 TCCCCGCAGTCCCCGCAGGCTGG + Intergenic
927207901 2:20621548-20621570 TTCCTTGACTCCCCCAGGGCAGG + Intronic
927672766 2:25082713-25082735 TCCCCACTGTGTCCCAGGGCTGG - Intronic
929779718 2:44949797-44949819 TCCTCTCTGTCCCCCAGCGCTGG + Intergenic
929945466 2:46368343-46368365 TCCCCTCAGTTCCCTATGCCTGG - Intronic
930238807 2:48914844-48914866 TCCCCTCAGTCTACAGGGGCTGG - Intergenic
931097074 2:58953280-58953302 TCCCAGAAGTCCCCCAGGGACGG + Intergenic
931245782 2:60491715-60491737 TCCCCTCAGTTCTCCAGGCTGGG + Intronic
932321225 2:70823377-70823399 GCCCATCAGACACCCAGGGCTGG + Intergenic
932462379 2:71891298-71891320 TCCCCACTGTCCCCCAAGGCAGG - Intergenic
934579536 2:95427340-95427362 GCCCCTCCGCCCCGCAGGGCTGG - Intergenic
934599908 2:95649385-95649407 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
934769999 2:96901515-96901537 TCCCCTCAGTCCCCAGGGTTAGG - Intronic
934950099 2:98570314-98570336 TCCTCGCTGTCCCCCAGAGCAGG - Intronic
935580913 2:104755291-104755313 TCCCATCAGTGCCCTGGGGCTGG - Intergenic
936066368 2:109335440-109335462 TCCTCTCTGCCCCTCAGGGCTGG + Intronic
936444408 2:112584902-112584924 TGCCCCCAGTACCCCAGGTCCGG + Intronic
936533251 2:113291389-113291411 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
938074350 2:128323750-128323772 TCCCCACAGTGCCACAGGGGCGG - Intergenic
943723894 2:191233152-191233174 GCCACTAACTCCCCCAGGGCTGG - Intergenic
944418763 2:199505931-199505953 TCCTCTCACTGCCCGAGGGCTGG - Intergenic
945833169 2:214809855-214809877 TCCCCTAAGTCCCACACGCCGGG - Intergenic
946409495 2:219509114-219509136 TCCCTCCAGTCCCCTAGGCCAGG + Intergenic
947102584 2:226637302-226637324 ACCCCTCACTGGCCCAGGGCTGG - Intergenic
947239088 2:227974811-227974833 TACTCTCAGTTCCGCAGGGCTGG - Intergenic
947480636 2:230496743-230496765 TTCCCTCAGTCTCCCAGCTCTGG + Intronic
948024655 2:234767409-234767431 TCCTCCCAGCCCCACAGGGCAGG - Intergenic
948247957 2:236502327-236502349 CCACCTCAGTCACCCAGTGCTGG - Intronic
948587673 2:239029401-239029423 TCCCCTGGGTCCTCCAGGGCTGG - Intergenic
948645061 2:239399590-239399612 TCCCCCCAGTCCTGCTGGGCTGG + Intronic
1169205735 20:3739589-3739611 TCTCCTCAGGCAGCCAGGGCAGG - Intronic
1169422513 20:5471570-5471592 TCCTCCCTGTCCCCCAGGGCCGG + Intergenic
1169509657 20:6249816-6249838 TGCCCTCATCACCCCAGGGCTGG - Intergenic
1171185601 20:23121958-23121980 TCTGCTCAGTTCCCCAGGACAGG - Intergenic
1171522479 20:25786425-25786447 TCCCTGCAGGCCCCCAGGACAGG - Intronic
1171554348 20:26069458-26069480 TCCCTGCAGGCCCCCAGGACAGG + Intergenic
1172202025 20:33133373-33133395 TCCCCTCAGGGTTCCAGGGCAGG + Intergenic
1172363992 20:34334906-34334928 TTTCCTCCCTCCCCCAGGGCAGG - Intergenic
1172705347 20:36878619-36878641 TGGCCTCAGTTCCCAAGGGCTGG - Intronic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1174396684 20:50251065-50251087 TCTCCTCAAACCTCCAGGGCAGG - Intergenic
1174804613 20:53594236-53594258 ACCCAACAGTCCCCCAGCGCCGG - Intronic
1175242081 20:57557100-57557122 TCCTCTGGGTCCCCCAGGCCAGG - Intergenic
1175907116 20:62386451-62386473 ACCAGTCAGACCCCCAGGGCAGG - Intergenic
1175939278 20:62530505-62530527 TCCCCTCAAACCTCCAGGGGGGG + Intergenic
1175957498 20:62618811-62618833 TCCCCTCAGAGCCCCGGGGAGGG - Intergenic
1176254901 20:64146748-64146770 TCCCCTCAAGACCCCAGGCCTGG + Intergenic
1176267572 20:64218622-64218644 TCTCCTCAGTCCCCTAGAGGAGG + Intronic
1177200729 21:17952819-17952841 GCCTCTCAGTCCCGCATGGCTGG + Intronic
1178404991 21:32316616-32316638 GCCCCTCAGCCCCACAGAGCCGG + Exonic
1180172924 21:46069891-46069913 TCCCCTCAGACCCTCAGCGATGG + Intergenic
1180309752 22:11159199-11159221 TCCCCCCAGTCCCCGTGGGGCGG + Intergenic
1180548229 22:16521009-16521031 TCCCCCCAGTCCCCGTGGGGCGG + Intergenic
1180800423 22:18629252-18629274 CCCCCTCTGTCCCCCAGGTGCGG - Intergenic
1180851657 22:19024808-19024830 CCCCCTCTGTCCCCCAGGTGCGG - Intergenic
1181068174 22:20316363-20316385 ACCCCACTGTCACCCAGGGCCGG + Intronic
1181165508 22:20980975-20980997 TCCCCTCACTCCTGCAGGACTGG + Exonic
1181221296 22:21366010-21366032 CCCCCTCTGTCCCCCAGGTGCGG + Intergenic
1181514324 22:23402586-23402608 TCCGCCCAGTTCCCCTGGGCCGG + Intergenic
1181518880 22:23433972-23433994 CCACCTCAGGCCTCCAGGGCCGG + Intergenic
1181553904 22:23656486-23656508 TCTCCTCAGTGCCCAAGGGGAGG - Intergenic
1182703496 22:32260057-32260079 GCCCCTGAGTCCCCCAGCCCAGG - Intergenic
1183354407 22:37350668-37350690 TCCCATCAGCACCCCAGGGTGGG + Intergenic
1183427745 22:37748500-37748522 TTCCTACAGTCCACCAGGGCAGG + Intronic
1183535607 22:38398843-38398865 ACCCAACAGTCCCCCAGCGCCGG - Intergenic
1183823672 22:40368248-40368270 TACACTCAATCCCCCAGGTCAGG + Intronic
1184033122 22:41906266-41906288 TCCCACCAGCCTCCCAGGGCTGG - Exonic
1184212329 22:43043444-43043466 CCCCCTCAGTCCTCCAGCACAGG + Intronic
1184796038 22:46733176-46733198 CCCACTCTGTCGCCCAGGGCTGG - Intronic
1184820728 22:46907688-46907710 TGCCCTCAGTCCTGCACGGCCGG - Intronic
1185016489 22:48346217-48346239 GCCCCCCAGGCCCCCAAGGCAGG + Intergenic
1185275519 22:49948874-49948896 TCCCCGCTGTCCCCCAGCCCTGG + Intergenic
950161437 3:10764048-10764070 TCCCCTCACTCACCCAGGACTGG + Intergenic
950469456 3:13175426-13175448 TGCCCTCAGTCACACAGAGCAGG - Intergenic
950492784 3:13316373-13316395 TCCCTTCAGTCCTTCAGGGCTGG - Exonic
951294587 3:20918094-20918116 TCTCCTCTTTCCCCCAGGGATGG - Intergenic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
953914059 3:46906677-46906699 TCCCCTCAGACCCCCAGAGCAGG - Intergenic
953982940 3:47421773-47421795 GCCCGTCTTTCCCCCAGGGCTGG - Intronic
954147477 3:48641470-48641492 GCCTCGCACTCCCCCAGGGCTGG + Exonic
954263245 3:49455103-49455125 TCCCAGCAGTCCCCAAGGACCGG - Intergenic
954332640 3:49899041-49899063 TCCCCACAGTCCCCTAGCCCTGG - Intronic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954613042 3:51956258-51956280 TGCCCTGAGGCCCCCACGGCCGG + Exonic
955856516 3:63278658-63278680 TCGCCTCATTCCCCCAAAGCTGG + Exonic
958692119 3:97481566-97481588 ACCCAACAGTCCCCCAGCGCCGG - Intronic
960938557 3:122918710-122918732 TCCCCTCAGGCTGCCAGGGAAGG - Intronic
961537722 3:127580158-127580180 GGCTCTCACTCCCCCAGGGCTGG - Exonic
961637851 3:128344183-128344205 TCTCCTCTGGGCCCCAGGGCAGG + Intronic
963586163 3:147192050-147192072 TCCCATCAGTACCCCAAGTCAGG + Intergenic
968001773 3:195211422-195211444 TCCCCTCAGTCTGCCAGAGCTGG - Intronic
968522391 4:1039888-1039910 GCCCCTCACTCCCACTGGGCCGG - Intergenic
968526363 4:1059615-1059637 TCCCCAGAGACCCCCAGGGAGGG - Intronic
968949340 4:3682470-3682492 TCCCCTCCGGCCTTCAGGGCTGG + Intergenic
968953855 4:3708380-3708402 AGCCCCCAGTCCCCTAGGGCGGG - Intergenic
969153875 4:5193097-5193119 TGCCCTCATTCCCCCAGGCATGG - Intronic
969343836 4:6558949-6558971 TCCCATCAGAGCCGCAGGGCTGG - Intronic
969683446 4:8656023-8656045 TCTCCTCACTTCCCCAGGACGGG + Intergenic
972757496 4:42063562-42063584 TCCTCCCATTCCCCCAGTGCAGG - Intronic
973579941 4:52333330-52333352 TTTCCTCAGTCTCCCAGGGAAGG + Intergenic
975361730 4:73477920-73477942 TCATCTCAGTCCCTCAGGGAAGG + Intergenic
975790440 4:77944094-77944116 TCCCCTCCTTCCCCTAGGGATGG + Intronic
977359221 4:95981954-95981976 TCCACACAGTCCCCCTTGGCAGG + Intergenic
979253458 4:118588750-118588772 TCCCCTCAGACCACCAGGGATGG + Intergenic
980724377 4:136739801-136739823 CTCACTCTGTCCCCCAGGGCTGG + Intergenic
981169570 4:141605645-141605667 GCCCCTCACTGCCCCGGGGCCGG + Intergenic
981442447 4:144798797-144798819 TCCCCTCCTTCCCCTAGGGATGG + Intergenic
983163188 4:164442863-164442885 TCCACTCAGCTCCCCAGTGCTGG - Intergenic
984864862 4:184272704-184272726 TCCCCTTGGTCCCCTAAGGCAGG + Intergenic
986913439 5:12585930-12585952 TCTCCTCTGTGGCCCAGGGCTGG + Intergenic
990498225 5:56369756-56369778 TCCCTTCAGTCCCCCAGCTCTGG + Intergenic
996747100 5:126854778-126854800 GCCCCTCACTGCCCCCGGGCTGG + Intergenic
997663112 5:135604454-135604476 ATCCCTCAGTGCCCCAGGACTGG - Intergenic
1000054683 5:157594880-157594902 TCAGCTCAGGCACCCAGGGCTGG + Intergenic
1001562353 5:172677867-172677889 TGCCCTCCCTCCCTCAGGGCAGG + Intronic
1001630121 5:173168705-173168727 TCCCTTCAGTCCCCAACAGCAGG + Intergenic
1001642570 5:173254943-173254965 TCCCCCCCATCCCCCGGGGCTGG - Intergenic
1002460391 5:179370385-179370407 CCCCCAAAGTCCCCCAAGGCAGG - Intergenic
1003423771 6:5982763-5982785 TCCCCTCTGTCACCCAGGCTAGG - Intergenic
1004519310 6:16346992-16347014 GCCCCTCACTGCCCTAGGGCCGG - Intronic
1005971225 6:30763463-30763485 TCCCCTCTCTCCTCCAAGGCAGG - Intergenic
1006459187 6:34148478-34148500 TCCCCTAGCTCCCCCAGGGCAGG - Intronic
1007096344 6:39215500-39215522 TCCTCTCATGCCCCCAGTGCGGG - Intronic
1007284119 6:40735579-40735601 GACCCTCAGTCCACCAGGGCTGG - Intergenic
1007582839 6:42969450-42969472 TAACCTCTGTCCTCCAGGGCTGG - Intronic
1007699618 6:43759023-43759045 GGGCCACAGTCCCCCAGGGCTGG - Intergenic
1007848129 6:44777840-44777862 TTCCTTGTGTCCCCCAGGGCGGG + Intergenic
1008639367 6:53445806-53445828 TTCCCACAGTCTCCCAGGACTGG - Intergenic
1011226339 6:85111701-85111723 TCCCATTAAACCCCCAGGGCCGG + Intergenic
1012494016 6:99814298-99814320 TTCCCACAGTCCACCAGAGCAGG - Intergenic
1014866525 6:126538175-126538197 TCCCCACCCTCCCCCAAGGCAGG + Intergenic
1015600933 6:134909825-134909847 TACCTTCAGTCCCCCAGGGAAGG - Intergenic
1016328259 6:142927103-142927125 TCCCCGCGGAGCCCCAGGGCTGG - Intronic
1016756513 6:147693448-147693470 GCCCCTTATTGCCCCAGGGCAGG - Intronic
1017672554 6:156779731-156779753 TCCCCCCCCTCCCCCAGGCCCGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018185857 6:161264878-161264900 CCCCTAGAGTCCCCCAGGGCTGG + Intronic
1018232895 6:161692655-161692677 CCCCCTCAGCCTCCCAGTGCTGG - Intronic
1018384596 6:163291217-163291239 TCCCCTCTGCCCGCCAGAGCTGG + Intronic
1018652358 6:166002878-166002900 ACACCTCATTCACCCAGGGCTGG + Intergenic
1018723048 6:166588434-166588456 TCCCCTAAGACCCCCAGTTCAGG - Intronic
1019305501 7:332626-332648 TAGCCTCAGACCGCCAGGGCTGG + Intergenic
1019592408 7:1842353-1842375 CCACCTCAGGCCTCCAGGGCCGG - Intronic
1020079834 7:5281523-5281545 CACTCCCAGTCCCCCAGGGCTGG + Intronic
1020223569 7:6261268-6261290 TCCCCTCAGTCCCCTAAGACTGG - Intronic
1022691174 7:32656772-32656794 TCCCTACTGTCCCCCAGGTCTGG + Intergenic
1023091891 7:36625154-36625176 CCTCCCCTGTCCCCCAGGGCAGG - Intronic
1023864786 7:44233511-44233533 TCCCCTGAGAACCCCAGGCCAGG - Intronic
1024544502 7:50505950-50505972 TCCTCACAGTCCCCAAGGGGAGG + Intronic
1025007314 7:55364632-55364654 TCCCCCCAACCCCACAGGGCTGG - Intergenic
1025941329 7:66077917-66077939 TCTCCTCAGTGCCCAAGGGGAGG + Intronic
1026437565 7:70413062-70413084 TCCTCCCAGTTCCCCAGTGCTGG - Intronic
1026935990 7:74255657-74255679 TTCACTCTGTCCCCCGGGGCTGG - Intergenic
1029594253 7:101528436-101528458 TTCCCTCAGGCCCCAAGGGTGGG + Intronic
1029649232 7:101879587-101879609 TGGCCTCAGGCCTCCAGGGCAGG - Intronic
1030047793 7:105512974-105512996 TCCTCTCAGTTCCCCAGGGATGG - Intronic
1031131065 7:117833695-117833717 TCCTCTCTGTCCTCCAAGGCTGG + Intronic
1032002737 7:128275883-128275905 CCCCCACACTCTCCCAGGGCAGG - Intergenic
1033450319 7:141456539-141456561 CCGCATCACTCCCCCAGGGCTGG - Intronic
1034335425 7:150320140-150320162 TCACCCCAGACCCCAAGGGCAGG + Intronic
1034438893 7:151076730-151076752 CCCCTTCAGGCCCCCAGCGCAGG + Exonic
1034888896 7:154822082-154822104 TGCCCTCAGAGCCCCAGGGAAGG - Intronic
1034967486 7:155400189-155400211 GCCCCTCAGTCACCCAGGTGAGG - Intergenic
1035237445 7:157508121-157508143 TCCTCCCAGCCCACCAGGGCTGG - Intergenic
1035657932 8:1325152-1325174 TTCCCCCAGTCCCCCAGAGCTGG + Intergenic
1035737447 8:1898741-1898763 TCCCCTCTGTCCCCCAAGGCTGG - Intronic
1036145069 8:6247489-6247511 TCCACTGAGTTCTCCAGGGCAGG + Intergenic
1036706400 8:11050120-11050142 TCCCCTCCTACTCCCAGGGCCGG + Intronic
1037107545 8:15128126-15128148 TCCCCTCATTCCACAAGAGCTGG + Intronic
1037816799 8:22116773-22116795 TCCCCTCAATACCCAAGAGCCGG - Intronic
1037821136 8:22135087-22135109 TCCCCTGACTTCCCCAGGGTGGG - Intergenic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1038034506 8:23675824-23675846 TCCACTGAGTCCCCCTGTGCAGG + Intergenic
1039474582 8:37833066-37833088 TCACCTCAGTGCCCCTGGGCGGG + Exonic
1042776457 8:72437295-72437317 TACCCTCAATCCCCCAGCTCAGG - Intergenic
1042885051 8:73539811-73539833 TTCACTCTGTCGCCCAGGGCTGG - Intronic
1045576068 8:103421595-103421617 TCCCCTCAGTCCCCAACCCCTGG + Intronic
1045600271 8:103707529-103707551 TTCCCCAAGTCCACCAGGGCTGG - Intronic
1045779640 8:105848387-105848409 TCCCATCAGTGCCCTAAGGCAGG - Intergenic
1047756984 8:127926488-127926510 ACCCCTGAGTCAGCCAGGGCTGG - Intergenic
1048951827 8:139502679-139502701 TCCCCACAGTCCCCCTGGTTTGG - Intergenic
1049220016 8:141424870-141424892 TCCCCTCAGTCCCCTGGGGCAGG - Intronic
1049227942 8:141466602-141466624 TGCCTTCAGGCTCCCAGGGCAGG - Intergenic
1049275841 8:141719749-141719771 TCCCCTGTGTGTCCCAGGGCTGG - Intergenic
1049478267 8:142806898-142806920 ACCCCACAGTCCCCCAGGCCTGG - Intergenic
1049654827 8:143792854-143792876 TCCCCCCAGCCCCCCACGCCTGG - Exonic
1049725224 8:144142658-144142680 TCACCTCTGCCGCCCAGGGCTGG - Intergenic
1049797413 8:144503053-144503075 GCCCCTCTGGCCCCCAGGCCGGG - Intronic
1049850074 8:144826322-144826344 GCCCTCCAGACCCCCAGGGCTGG - Intergenic
1051136882 9:13932814-13932836 TTCCCTCACTCCCTCAGGGTTGG + Intergenic
1051459313 9:17294763-17294785 TCCCCTCACTCCCCCCGCGGTGG - Intronic
1055488723 9:76782740-76782762 TCTCCTCAGTGACACAGGGCTGG + Intronic
1056706719 9:88958328-88958350 TCCCCTCACTCTTCCAGGTCTGG + Intergenic
1057199079 9:93130881-93130903 ACCCCCCAGGCACCCAGGGCAGG - Intronic
1059433118 9:114261492-114261514 TCTCCCCAGCCCCACAGGGCAGG - Intronic
1060995271 9:127872222-127872244 GCCCCTGAGCTCCCCAGGGCAGG - Intronic
1061328511 9:129878468-129878490 TCCCAGGAGGCCCCCAGGGCAGG - Intronic
1061404488 9:130385816-130385838 TCCCCGCAGCTCGCCAGGGCTGG - Intronic
1061954489 9:133954548-133954570 TCCCCCCAGCCTCCCATGGCTGG - Intronic
1061957395 9:133970689-133970711 TCTCCTCAGGCCCCAGGGGCAGG + Intronic
1062109030 9:134772104-134772126 TCCCCTCCATCCCCGAGGCCAGG + Intronic
1062237956 9:135521706-135521728 TCCCACCATTCCCTCAGGGCAGG - Intronic
1062377277 9:136267845-136267867 CCCCCTCTGTCACCCAGGGCGGG + Intergenic
1062385022 9:136305849-136305871 GCTCCGCTGTCCCCCAGGGCAGG - Intronic
1062431760 9:136529520-136529542 CCTCCTCCATCCCCCAGGGCTGG - Intronic
1186720752 X:12301021-12301043 TCCACTCAGTTGCCCTGGGCTGG + Intronic
1187306444 X:18099257-18099279 AACCCTCAGTTCTCCAGGGCTGG - Intergenic
1189214768 X:39313616-39313638 GCTCCTCAGTCCCTCAGGGATGG + Intergenic
1189900065 X:45697207-45697229 TCCCCTCAGTCCTCCAAACCAGG + Intergenic
1190329329 X:49226112-49226134 CCACCTGAGCCCCCCAGGGCAGG - Intronic
1191090280 X:56613446-56613468 TCCTGTCAGTCCTCCAAGGCTGG - Intergenic
1191711112 X:64150900-64150922 TCAACTCAGTTCCCCATGGCTGG + Intergenic
1196950979 X:120875434-120875456 TGGCCGCAGTCCCCCAGGGCGGG - Exonic
1196951809 X:120931806-120931828 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196952493 X:120936667-120936689 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196953178 X:120941528-120941550 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196953863 X:120946388-120946410 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196954548 X:120951249-120951271 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196955231 X:120956109-120956131 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196955918 X:120960992-120961014 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196956600 X:120965853-120965875 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196957282 X:120970713-120970735 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196957964 X:120975573-120975595 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196958646 X:120980433-120980455 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1196959327 X:120985293-120985315 TGGCCGCAGTCCCCCGGGGCGGG - Exonic
1199712203 X:150477407-150477429 TCCTCTCTGACCCCCAGGGGTGG + Intronic
1199849721 X:151716786-151716808 TTCCCTCAATTTCCCAGGGCTGG + Intronic
1200102333 X:153694327-153694349 TGGGCTCTGTCCCCCAGGGCGGG + Exonic
1201188980 Y:11430366-11430388 TCCCCCCAGTCCCCGTGGGTCGG + Intergenic