ID: 953884576

View in Genome Browser
Species Human (GRCh38)
Location 3:46708034-46708056
Sequence GCATCCAGGCATACACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953884576 Original CRISPR GCATCCAGGCATACACTTGG AGG (reversed) Intronic
907012404 1:50976724-50976746 GAAGCCAGGCTTACACCTGGGGG + Intergenic
907032900 1:51190050-51190072 GCTGCCAGGCATTCATTTGGAGG - Intergenic
911149311 1:94581823-94581845 GCATCCAGGAAGACACTGGAGGG - Intergenic
913675637 1:121137882-121137904 TCATCCAGGCATACCCCTTGGGG - Intergenic
913739747 1:121828565-121828587 GCATCCAGGTGGACATTTGGAGG - Intergenic
913742959 1:121869469-121869491 GCATCCAGGTGGACATTTGGAGG - Intergenic
913754808 1:122061588-122061610 GCATCCAGGTGGACATTTGGAGG + Intergenic
913759082 1:122111082-122111104 GCATCCAGGTGGACATTTGGAGG + Intergenic
914027535 1:143925823-143925845 TCATCCAGGCATACCCCTTGGGG - Intergenic
922195313 1:223354576-223354598 GCATGCCAGCATATACTTGGTGG - Intronic
922285544 1:224167741-224167763 GCTTCAAGGCATACATTTTGCGG - Intergenic
923303279 1:232663310-232663332 GCAGCAAGGCATCCATTTGGTGG + Intergenic
1067904942 10:50281026-50281048 GGTTCCAGGCACAGACTTGGAGG + Intergenic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1071537175 10:86443334-86443356 GCATGCCGGCAAACACATGGAGG - Exonic
1074354408 10:112769524-112769546 GCACCCAGGCATGAACTAGGAGG - Intronic
1076287270 10:129312477-129312499 GCATGCATGCAGACACTAGGAGG + Intergenic
1077141396 11:1026452-1026474 ACAGCCAGGCTCACACTTGGTGG + Exonic
1079514881 11:21255505-21255527 GCATTCAGGCAAACATCTGGGGG + Intronic
1080165723 11:29233917-29233939 GCATCCAGGCATTCATTCTGAGG - Intergenic
1080718469 11:34826298-34826320 GCCTACAGGCCTACAGTTGGGGG + Intergenic
1084679569 11:70658831-70658853 GCATCCAGCCAGCCATTTGGTGG - Intronic
1085583336 11:77675814-77675836 TCATCCTGGCATTCATTTGGAGG - Intronic
1088216591 11:107517294-107517316 GAATCCTGGCATACTGTTGGTGG + Intronic
1088434559 11:109796679-109796701 GGATCCAGGCATTCATATGGTGG - Intergenic
1089510853 11:118996166-118996188 GCCTCCAGGCTTTAACTTGGTGG + Intergenic
1092432857 12:8422742-8422764 GCATCCTTCCATACTCTTGGGGG + Intergenic
1098187980 12:67918779-67918801 GCCTCCAGCCATACACCTGCTGG - Intergenic
1098761573 12:74431843-74431865 GCTTCCAGGCATGCACGTGAAGG - Intergenic
1099802003 12:87469408-87469430 GCATCCATTCATTCAGTTGGGGG - Intergenic
1102689476 12:114749191-114749213 GCTTCCAGGCCCACACTAGGAGG - Intergenic
1104554296 12:129786172-129786194 GCATCCAGCCCTCCACCTGGAGG - Intronic
1108468672 13:50745513-50745535 CCATCAAGCCATACACTTAGAGG + Intronic
1125535238 15:40438557-40438579 GCGGCCAGGCAGGCACTTGGTGG + Intergenic
1130400826 15:83551690-83551712 GCAGACAGGCATACACTCAGGGG - Intronic
1130532717 15:84759690-84759712 GGACCCAGGCAGGCACTTGGGGG + Intronic
1141623173 16:85247866-85247888 GCATCCAAGCATGCACCTGAAGG + Intergenic
1144931967 17:18866915-18866937 GCCTCCAGACCTTCACTTGGTGG - Intronic
1145121072 17:20260515-20260537 GCGTGCAGCCATACATTTGGTGG - Intronic
1149567587 17:57651029-57651051 CCATCCAGGCAGATGCTTGGAGG - Intronic
1151956041 17:77380738-77380760 GCCTCCAGGTGTACAGTTGGAGG + Intronic
1153241498 18:3035226-3035248 GCATTCAGGTATTAACTTGGGGG - Intergenic
1155373100 18:25125064-25125086 GGATCCATGCATACTCTTTGAGG - Intronic
1155400236 18:25430512-25430534 GTATCCTGGCATACACTGTGAGG - Intergenic
1161344282 19:3760207-3760229 GCCTCCAGCCATGGACTTGGAGG - Exonic
1166148321 19:40852171-40852193 CCATCCTCGCATACACCTGGGGG - Intronic
1166152463 19:40883956-40883978 CCATCCTCGCATACACCTGGGGG - Intronic
1166171338 19:41029480-41029502 CCATCCTCGCATACACCTGGGGG - Intergenic
1166177718 19:41086689-41086711 CCATCCTCGCATACACCTGGGGG + Intergenic
926162161 2:10496644-10496666 GTAGCTAGGCATTCACTTGGGGG - Intergenic
926223658 2:10952471-10952493 GCAGGCAGGCATAAGCTTGGTGG + Intergenic
927000400 2:18788794-18788816 GCATCCTGCCAAGCACTTGGAGG - Intergenic
928172101 2:29010509-29010531 GCATCCAGGCAGGCACTGAGGGG + Intronic
930768499 2:55109247-55109269 CCATGCAGGCATCCACTTGCTGG - Intronic
931892187 2:66685499-66685521 GAATCCAGGAATACATGTGGAGG + Intergenic
932816156 2:74863907-74863929 GCATGCAGCCGTAAACTTGGAGG - Intronic
944194134 2:197034718-197034740 GAATCCTGGCAAACACATGGTGG - Intronic
946550888 2:220800967-220800989 GCATCCTGGCATAAAATTAGGGG - Intergenic
946868124 2:224060401-224060423 GCATTCAGGATTACACTTGTAGG - Intergenic
948019744 2:234720700-234720722 ACATCCAGGCACTCACATGGGGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1174270489 20:49364850-49364872 GCATCCAGTCATCCACTCAGAGG + Exonic
1178902039 21:36605984-36606006 GCATCCAGGCATCATCTTGGAGG - Intergenic
1181139371 22:20792800-20792822 GCTTCCAGGCCTGCACTTGTGGG + Intronic
1181587630 22:23862276-23862298 TCAGCCAGGCATCCACTAGGTGG + Intronic
1181713495 22:24706827-24706849 ACTTCCAGGCATATACATGGGGG + Intergenic
1183394163 22:37561811-37561833 GCACCCTGGCATTCACCTGGGGG - Intronic
952594379 3:34998279-34998301 GCATCCTGACTTACACTTGGAGG + Intergenic
952992605 3:38844673-38844695 GCATACAGTCATGCACCTGGTGG - Intergenic
953884576 3:46708034-46708056 GCATCCAGGCATACACTTGGAGG - Intronic
955558029 3:60158961-60158983 ACCTCCAGGAACACACTTGGAGG - Intronic
959617191 3:108361677-108361699 GGTTTCAGGCATCCACTTGGGGG + Intronic
966226402 3:177602844-177602866 CCATCCTGGCATACAATTGTTGG - Intergenic
966227204 3:177610619-177610641 GAATCCCTGCATTCACTTGGAGG + Intergenic
967503974 3:190232224-190232246 GCCTCAAGGCATCCACTTGAAGG + Intergenic
971958907 4:33458935-33458957 GCCTCCAAGTATACTCTTGGAGG + Intergenic
976409619 4:84698596-84698618 GCATCCTTGGATACACATGGAGG - Intronic
978524993 4:109656129-109656151 GAATCCAGGAATCCAGTTGGAGG - Intronic
985733939 5:1566390-1566412 GCCTCCAGACACACACTTTGGGG + Intergenic
986570352 5:9157617-9157639 GGCTCCAGGCATGCACATGGTGG + Intronic
988364111 5:30273403-30273425 GTATCCAGACACACATTTGGAGG + Intergenic
990026588 5:51198908-51198930 GCATCCAGGCATCCAAGTGAGGG + Intergenic
993509385 5:88753006-88753028 GCATTAAGGCATTCCCTTGGGGG + Intronic
996814803 5:127562979-127563001 GGATACATGCAAACACTTGGTGG + Intergenic
997472830 5:134126233-134126255 GCAGCCAGGCACGCACTCGGTGG - Intronic
999241308 5:150129239-150129261 GCATACAGACATACACTGTGGGG + Intronic
1001384074 5:171324025-171324047 GCATCCAGGCAAGCAACTGGGGG + Intergenic
1006371071 6:33643779-33643801 GCATCCAGTCATGCAAATGGAGG - Intronic
1010232721 6:73549551-73549573 GGATCCAGGCAGTCACTTGTGGG - Intergenic
1011442693 6:87403949-87403971 GCCTCCAGGCAGAAATTTGGGGG - Intergenic
1015699668 6:136022097-136022119 GCAACCAGGCAGAGATTTGGCGG - Intronic
1022841371 7:34167188-34167210 GCATCCCTGCCTACTCTTGGTGG + Intergenic
1024667937 7:51564625-51564647 GCCTCCAGGCATAAGTTTGGGGG + Intergenic
1024698630 7:51883340-51883362 GCATCCAGGCAGACAGTTGTGGG - Intergenic
1035160434 7:156946124-156946146 GCACCGAGGCATACACATGCTGG + Intergenic
1036163711 8:6411797-6411819 GGATTCAGGCATCCACTGGGAGG + Intronic
1039622388 8:39010161-39010183 CAATCCAGGCAGATACTTGGGGG + Intronic
1040328323 8:46373562-46373584 GCAGCCAGGCAGAAACTTAGGGG - Intergenic
1041954106 8:63538075-63538097 GGTTTCAGGCATCCACTTGGGGG - Intergenic
1045102863 8:98862908-98862930 AGATTCAGGCATTCACTTGGTGG + Intronic
1048691470 8:136969409-136969431 GCATCCATGCACAAACATGGAGG - Intergenic
1049755804 8:144310876-144310898 CCATCCTGGCAAACACCTGGAGG - Intronic
1049964055 9:762567-762589 GCCACCTGGCATACACTTGCAGG - Intergenic
1056703651 9:88933038-88933060 GCATCCATGCAAACACTCGCGGG + Intergenic
1057461691 9:95268834-95268856 GCTGCCAGGCACACACCTGGAGG - Intronic
1058536808 9:105969323-105969345 GCATTCAGTCATAGACTTGCAGG - Intergenic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1199775734 X:151009782-151009804 GTATCCATGCATGCGCTTGGTGG - Intergenic