ID: 953885181

View in Genome Browser
Species Human (GRCh38)
Location 3:46711026-46711048
Sequence CTGAATTAGGATGAGATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953885172_953885181 1 Left 953885172 3:46711002-46711024 CCCCTCCCTGACTCTTCTGCCAG 0: 1
1: 0
2: 3
3: 54
4: 500
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211
953885173_953885181 0 Left 953885173 3:46711003-46711025 CCCTCCCTGACTCTTCTGCCAGC 0: 1
1: 0
2: 7
3: 62
4: 557
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211
953885176_953885181 -5 Left 953885176 3:46711008-46711030 CCTGACTCTTCTGCCAGCCTGAA 0: 1
1: 0
2: 2
3: 16
4: 232
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211
953885175_953885181 -4 Left 953885175 3:46711007-46711029 CCCTGACTCTTCTGCCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 290
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211
953885174_953885181 -1 Left 953885174 3:46711004-46711026 CCTCCCTGACTCTTCTGCCAGCC 0: 1
1: 1
2: 3
3: 41
4: 426
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211
953885170_953885181 13 Left 953885170 3:46710990-46711012 CCAGGCCAAAGTCCCCTCCCTGA 0: 1
1: 0
2: 1
3: 54
4: 370
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211
953885171_953885181 8 Left 953885171 3:46710995-46711017 CCAAAGTCCCCTCCCTGACTCTT 0: 1
1: 0
2: 0
3: 43
4: 496
Right 953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953885181 Original CRISPR CTGAATTAGGATGAGATAGA GGG Intergenic
900954073 1:5876098-5876120 ATGAGTTAGGATGAGAAACAGGG + Intronic
903514595 1:23902079-23902101 TGGAATTCGGATCAGATAGAGGG + Intronic
904424734 1:30415996-30416018 CTGAGTGAGGATCAAATAGAGGG - Intergenic
906726326 1:48047138-48047160 CTGAGTTGAGAGGAGATAGAAGG - Intergenic
907806037 1:57821279-57821301 CTCAATAAGGAAGAGATAGAGGG + Intronic
908411017 1:63865397-63865419 GTATATAAGGATGAGATAGATGG - Intronic
910735584 1:90452212-90452234 CTGAATGAAAATAAGATAGAAGG + Intergenic
911354856 1:96803538-96803560 CTGAATTAAAAAGAGATGGAGGG + Intronic
911803276 1:102172923-102172945 GTGAATTATGATGGCATAGATGG + Intergenic
916968786 1:169985344-169985366 CTGAACTAGGTAGAGATAAAAGG + Intronic
919004854 1:191884172-191884194 CTGAAAGAAAATGAGATAGAAGG - Intergenic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
921582804 1:216914763-216914785 CTGCATTAGGATGGGAGAGATGG - Intronic
923759872 1:236832304-236832326 ATGAAGTAGGATGAGATGGGAGG + Intronic
924166247 1:241286429-241286451 CTGAACTAGGTTTAGATGGAAGG - Intronic
924390308 1:243547995-243548017 CTGAAATAGAATGAAAAAGAGGG - Intronic
1063237608 10:4134747-4134769 CTACAGTAGGATCAGATAGAAGG + Intergenic
1064322085 10:14314840-14314862 GTGAATGAGGAGGAGATAGGAGG - Intronic
1068102337 10:52571160-52571182 CTGAATTAGTCTGACATAAAAGG - Intergenic
1069223528 10:65912402-65912424 CTGAAAGAGGATGAGAGTGAAGG + Intergenic
1069995266 10:72338112-72338134 CTGGATCAGGATGGGAAAGAAGG + Intronic
1070335716 10:75453745-75453767 CTGACTTCTGAGGAGATAGATGG + Intronic
1071367426 10:84913311-84913333 CTGAATTACGCTAAGACAGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1078806738 11:14713365-14713387 GTGTTTTTGGATGAGATAGATGG + Intronic
1079812243 11:25009201-25009223 ATGAATTATGATGAGCTATATGG - Intronic
1080220469 11:29896968-29896990 CTGAATTAGAGAAAGATAGAGGG + Intergenic
1080783357 11:35451637-35451659 CTGAGTTAGGATCCAATAGAAGG + Intronic
1089280634 11:117371909-117371931 CTGAACTATGATGAGGTAGGAGG - Intronic
1090299984 11:125626615-125626637 ATAAATGTGGATGAGATAGAAGG + Intronic
1090673170 11:128965003-128965025 ATGAATTATAATGAGATAGTGGG - Intergenic
1091442387 12:521502-521524 CTGAATTAGGAAGGAAGAGAGGG + Intronic
1093464465 12:19436025-19436047 CTAAGTTAGGATAAGATAGCAGG + Intronic
1095336354 12:41032467-41032489 CTTAATTGAGATGAGAGAGAGGG - Intronic
1095556431 12:43511295-43511317 CTAAATAGGGATGAGATAAAAGG - Intronic
1095589472 12:43887729-43887751 CTTATTTAGGATCAGATAGAGGG + Intronic
1095644669 12:44529474-44529496 CTGAATTAGGGATACATAGACGG + Intronic
1096276532 12:50213621-50213643 ATGAGTTAGAATGAGTTAGAAGG + Intronic
1098563542 12:71904787-71904809 CTGAGTTAGGATGTGGGAGAAGG + Intronic
1098597194 12:72287696-72287718 CTTAGGAAGGATGAGATAGAGGG + Intronic
1098808272 12:75049945-75049967 GTGAATTAGGTTGAGATGCATGG + Intronic
1098927782 12:76371344-76371366 CTGAATTAAGATATGACAGAAGG + Intronic
1104299679 12:127553022-127553044 CTGAACTTGGATGAGAGAGCTGG + Intergenic
1106571817 13:30934354-30934376 CCGAAATAGGATGAGGTTGATGG + Intronic
1107064947 13:36203106-36203128 TTGAATTAGGATATGAGAGATGG - Intronic
1108297319 13:49037473-49037495 TTGGATAAGGAGGAGATAGAAGG + Intronic
1110827381 13:79988462-79988484 CTGTATTGGAATAAGATAGATGG + Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1113045113 13:106147130-106147152 CAGAAGTAGGATTAGACAGAGGG + Intergenic
1114511066 14:23261526-23261548 CTGCATTAGGTGGAGTTAGATGG + Intronic
1115470440 14:33763282-33763304 CTCATTTAGGATGAAATAGAGGG + Intronic
1117568311 14:57019398-57019420 CTGTACTAGGATTAGAAAGAAGG - Intergenic
1119152808 14:72379151-72379173 CTCAATTAAGATGGTATAGAAGG + Intronic
1119522542 14:75296542-75296564 CTGAATTAGGCTTTGAAAGAAGG - Intergenic
1119833929 14:77729990-77730012 CTGGATTTGTATGAGAAAGAAGG - Intronic
1120701711 14:87705561-87705583 CTGAAGCATGATGAGAAAGAGGG + Intergenic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1122054543 14:99084685-99084707 CTGAAAGAGAAAGAGATAGATGG + Intergenic
1125452566 15:39824379-39824401 CTTAGTGAGGATGAGGTAGAGGG - Intronic
1127915438 15:63451240-63451262 GGGCATTAGAATGAGATAGAAGG + Intergenic
1128667747 15:69550902-69550924 CTGCAGTTGGATGAGAGAGAGGG + Intergenic
1130692229 15:86092734-86092756 CTGCATCATGATGTGATAGAAGG + Intergenic
1130874383 15:87999737-87999759 CTGAATTCAGATGAGGAAGATGG + Intronic
1131966968 15:97854641-97854663 CTGAATCAGGATCTGATATATGG + Intergenic
1140963535 16:79941522-79941544 CTGAATTAGGACCTGAAAGAAGG + Intergenic
1141270468 16:82535577-82535599 CTCAAGTGGGATGAGACAGAAGG - Intergenic
1143270267 17:5670040-5670062 CTGGAGTAGGATGACATAAAGGG - Intergenic
1144353210 17:14419239-14419261 GAGAGTTAGGATGATATAGAAGG + Intergenic
1145775585 17:27525771-27525793 CTGAAAGAGGATGAGGTAGTTGG + Intronic
1203169951 17_GL000205v2_random:139747-139769 CTGAGTTAGGATGAAAAACAGGG + Intergenic
1153598269 18:6751491-6751513 GTGACTTAGGATGATTTAGAAGG + Intronic
1153654233 18:7268291-7268313 ATGAATTAGGAAGATATATACGG + Intergenic
1155485784 18:26340737-26340759 TTGATCTAGGATGAGAAAGAAGG + Intronic
1155635936 18:27955477-27955499 CTGAATTTGGAGGAGAAAAAAGG + Intronic
1158124761 18:54088731-54088753 CTGAACTAGGATGGAAGAGAGGG + Intergenic
1159334557 18:67045294-67045316 CTGTAGGAGGATGAGAGAGAGGG - Intergenic
1160191382 18:76716994-76717016 GAGAATTAGGATGAGATAAGGGG - Intergenic
1160921147 19:1521419-1521441 CTGTTTTAGAATTAGATAGAGGG - Intergenic
1161778243 19:6275512-6275534 CTGAATTAGAATGTAAGAGATGG + Intronic
1164975553 19:32570479-32570501 CTGAAGTGGGAAGAGAAAGATGG + Intergenic
1167204773 19:48093626-48093648 CTGAATGAGGCTGAGAGAGAGGG - Intronic
925289830 2:2740104-2740126 TGGAATGAGGATGAGATAGAAGG + Intergenic
927834775 2:26386102-26386124 CTGAATAAGGATGCTATAGAAGG - Intronic
928356029 2:30615390-30615412 GTGAAATAGGATGAGAATGAAGG + Intronic
928763812 2:34617073-34617095 GTGAATTATGCTGAGATAGCTGG - Intergenic
931140708 2:59454623-59454645 AGAAATTAGGAGGAGATAGAAGG + Intergenic
931978398 2:67668133-67668155 CTGGTTTTGGATGAGAGAGAAGG + Intergenic
933690825 2:85178412-85178434 GTGAATTAAGGGGAGATAGATGG - Intronic
934158915 2:89229756-89229778 TTGAATTAGGATCTAATAGAAGG - Intergenic
939629098 2:144513472-144513494 CTGAATTAGGAGGAGAGAAAAGG - Intronic
940159993 2:150701383-150701405 CTAAATTAATATGAAATAGATGG + Intergenic
940842299 2:158598213-158598235 CTGAATTAGGACAAGATCCAAGG - Intronic
940890620 2:159032098-159032120 GTGACTTAGGAGGAGATAGGGGG + Intronic
941865621 2:170331439-170331461 CTGGACTAGGATGTGAAAGAGGG + Intronic
942058367 2:172205959-172205981 CTGAATTAAGAGGAGAAGGAAGG + Intergenic
942966132 2:181893647-181893669 CTGAAATATGATGACATATATGG + Intronic
944502382 2:200375468-200375490 CCCAATAAGGATGATATAGAAGG + Intronic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945991133 2:216396221-216396243 CTGAAGCAGAATGAGAGAGAGGG + Intergenic
946072605 2:217047509-217047531 CTGAATGAGGAAGAGAGTGAAGG - Intergenic
946489546 2:220134387-220134409 CTGAACTAGGATGTGTCAGAGGG - Intergenic
946813683 2:223553873-223553895 CCGATTTAGGATGTGACAGAAGG + Intergenic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
948898701 2:240944497-240944519 CTGAATCATAAAGAGATAGAAGG - Intronic
948975396 2:241460605-241460627 CTGAATTTGGATTTGAAAGATGG + Intronic
1168923546 20:1560693-1560715 CTGAGTTAGGATAAGAGAGCTGG + Intronic
1170938071 20:20826905-20826927 GTGAATTAGGAAGAGAGACAAGG + Intergenic
1176325949 21:5501541-5501563 CTGAGTTAGGATGAAAAACAGGG + Intergenic
1176401808 21:6319410-6319432 CTGAGTTAGGATGAAAAACAGGG - Intergenic
1176435349 21:6669694-6669716 CTGAGTTAGGATGAAAAACAGGG + Intergenic
1176459611 21:6996764-6996786 CTGAGTTAGGATGAAAAACAGGG + Intergenic
1176483172 21:7378542-7378564 CTGAGTTAGGATGAAAAACAGGG + Intergenic
1182164037 22:28154223-28154245 CTAAATTAGAATGAGAAAGAAGG + Intronic
1182213872 22:28699759-28699781 CTGAATTAGGCAGAAATCGAGGG - Intronic
1182220854 22:28757564-28757586 CTTAATTAAGATGATATAAACGG - Intergenic
1183400548 22:37601327-37601349 CTGAATGAGTGTGAGACAGAAGG - Intergenic
949107472 3:217940-217962 TTGAATGAGGATGTGATAAAGGG + Intronic
950162467 3:10770938-10770960 CTGAATTAAAAGGAAATAGATGG - Intergenic
952260669 3:31736996-31737018 CTGGATAATGATGGGATAGAGGG - Intronic
952387882 3:32855947-32855969 CTGACTTAGGCAGAGCTAGAAGG + Intronic
952486475 3:33816670-33816692 CTGAATAAGCATCAGATTGAGGG + Intronic
953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG + Intergenic
953937929 3:47062491-47062513 CTGAATTTGAAAGAGATACAAGG + Intronic
954571575 3:51645350-51645372 TTGAATCAGAATGAGATAGGAGG - Intronic
955049716 3:55398249-55398271 CTGAATTATGATGGAATAGTAGG - Intergenic
957362636 3:79179036-79179058 CTGAGTCAGGCTGAGATAAATGG - Intronic
959507069 3:107168457-107168479 CTGAATTAGGTTGCCATAGATGG - Intergenic
959841157 3:110977301-110977323 CTGAAATAAGTTGACATAGAGGG + Intergenic
960567336 3:119147519-119147541 TTCAATTTGGATGAGATGGAGGG - Exonic
963102152 3:141618123-141618145 CTGAAGCAGGATGAGTGAGAGGG + Intergenic
963300889 3:143596003-143596025 CTGGACCAGGATGAGATGGAGGG + Intronic
963359781 3:144256692-144256714 CTTTATCAGGATGAGATAAAAGG - Intergenic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
965552349 3:169980171-169980193 TTGAATAAGGAAGAGAGAGATGG + Intronic
966439355 3:179926595-179926617 CAGAATTAGCACGAGATAAAGGG - Intronic
966532534 3:180996794-180996816 CTAAATGAGGATGAAATAGCTGG + Intergenic
967032288 3:185619211-185619233 CTGAATAAGGATGAATTCGAAGG - Intronic
967135075 3:186506242-186506264 CTGTACTGGGATGAGAGAGAAGG - Intergenic
968676954 4:1887811-1887833 CTGAATTAGTAACAGATACATGG - Intronic
969938652 4:10708022-10708044 CTGGACTAAGATGAGATAGTGGG + Intergenic
971573646 4:28246259-28246281 CTGAAGGAAGAAGAGATAGAAGG - Intergenic
972366302 4:38378236-38378258 CTGAGTGAGGAAGAGAAAGAAGG + Intergenic
973742313 4:53929990-53930012 CTGAAATGGGATGAGATGGAAGG - Intronic
974667725 4:64986815-64986837 CTGAACTTGGATGAGGAAGAGGG - Intergenic
976148911 4:82073138-82073160 CTGAATTATGATGAGCAAGCAGG + Intergenic
977469199 4:97420758-97420780 CTGAATTGGGCTAAGATAGGTGG - Intronic
977575950 4:98674273-98674295 CTGGTTTAGGATCAGATACAAGG - Intergenic
979668924 4:123342093-123342115 CTGTATAAGGAAGGGATAGATGG - Intergenic
980632856 4:135459648-135459670 CTGAATGATGAAGATATAGAAGG + Intergenic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983293331 4:165834202-165834224 CTGAATTGCGATGGGATAGTGGG - Intergenic
986049801 5:4078501-4078523 CTGATATAGGATGAGATAAATGG + Intergenic
987550079 5:19368348-19368370 CTGAATAAGGACGAGAGTGAAGG - Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988191262 5:27938423-27938445 GGGAATAATGATGAGATAGAAGG + Intergenic
988308433 5:29525845-29525867 CTAAATTAGGATTACAAAGAAGG - Intergenic
991024242 5:62012751-62012773 CTGACATAGGATGAAATTGAAGG - Intergenic
991625450 5:68596320-68596342 CTGAATTATGATGTGCTAGCAGG - Intergenic
992204534 5:74418301-74418323 CTGTATTAGGATCAGAGAAAAGG + Intergenic
993543931 5:89187536-89187558 ATGAAGAAGAATGAGATAGAGGG - Intergenic
993698711 5:91093242-91093264 CTGAATGAGGATGAACTCGAGGG - Intronic
995016935 5:107320541-107320563 CTGAACTAGAAACAGATAGATGG - Intergenic
996914205 5:128692942-128692964 CTGAATTAGGATGAGTTCTGGGG - Intronic
996949946 5:129113645-129113667 CTGAAAAGGGATGGGATAGAAGG + Exonic
998733992 5:145113808-145113830 ATGAATAAGGATGAGATGGGAGG - Intergenic
998845410 5:146304259-146304281 TTGAATTAAGATCAGATATAAGG + Intronic
999583568 5:153065724-153065746 CTTAAGTGTGATGAGATAGATGG + Intergenic
1003746754 6:9010419-9010441 TTGAATTAGGCTGAGACAGGTGG - Intergenic
1004878309 6:19978786-19978808 CTGAATGATGATGGGATGGATGG - Intergenic
1005883795 6:30079540-30079562 CTGAATTAGGGTGTGTAAGAAGG + Intergenic
1006954045 6:37850989-37851011 CTGAATTAGGGTGACAGTGATGG - Intronic
1007633132 6:43283702-43283724 CTGAATGGGGCTGAGATAGAGGG + Exonic
1009986923 6:70792601-70792623 CTGAATAAGCATTAGATATAAGG + Intronic
1010850399 6:80768566-80768588 CTAAATTAGGATGAGAAGGTTGG + Intergenic
1011347465 6:86387796-86387818 CTGCTTTAGAATGAAATAGAAGG + Intergenic
1013995781 6:116305972-116305994 CTGAATTATTAAGAGATAAAGGG + Intronic
1014218928 6:118780711-118780733 CTGAACTACGAGCAGATAGAAGG + Intergenic
1015484250 6:133750118-133750140 CAGAATTAGGATTAGGTACATGG - Intergenic
1017275303 6:152560050-152560072 CTGAATCAAGAAGAAATAGAAGG + Intronic
1017395915 6:153999959-153999981 CTGAATTGGGAAGAGAGAGCTGG - Intergenic
1018183678 6:161246142-161246164 CTGAAGTAAGAAGAGAGAGAAGG - Intronic
1019919565 7:4154835-4154857 CAGAATTGGGAGGAGTTAGAAGG + Intronic
1021085124 7:16413566-16413588 TTGAATTAGGCTGAGATAACAGG - Intronic
1022941775 7:35248897-35248919 CTGAATTAGGAAGAGAGGAAGGG + Intronic
1025815235 7:64904622-64904644 GTGAATTAGGATGAGGAAGTTGG - Intronic
1025849422 7:65233784-65233806 TTCTATCAGGATGAGATAGAAGG + Intergenic
1026455658 7:70570485-70570507 CTGAGTAAAGATGAGATTGAAGG - Intronic
1026605218 7:71810134-71810156 CAGAATTTGGAGGAGAAAGATGG + Intronic
1028510334 7:91618354-91618376 CTTAAATAGGAATAGATAGATGG - Intergenic
1029904634 7:104079106-104079128 CAGAATTAGGAAGAGAGACAAGG + Intergenic
1030318408 7:108139746-108139768 CTGACTTAGGATAAGAAACAGGG - Intergenic
1031202083 7:118701004-118701026 CTGAATGAGGATGAGAACTATGG + Intergenic
1031243895 7:119281972-119281994 TTGAATGATGATGAAATAGAAGG + Intergenic
1032581246 7:133105361-133105383 CTGAGCTAGGAAAAGATAGATGG + Intergenic
1033159762 7:138984742-138984764 CTGGATAAGGATGGGACAGAGGG + Intergenic
1033161968 7:139005846-139005868 AAGAAATAGGATGAGATAGGAGG + Intergenic
1033430283 7:141282847-141282869 CTGCATTGGGATGAAAAAGAAGG + Intronic
1034760144 7:153664732-153664754 CTGAATCACGATGAGAAAGAAGG + Intergenic
1038085681 8:24193701-24193723 ATGAAAAAGGAGGAGATAGATGG + Intergenic
1038119558 8:24597412-24597434 GTGAATTAGGAGGAGTTGGATGG + Intergenic
1038542346 8:28400548-28400570 CTAAATTAGGATGTCATAGCTGG - Intronic
1039227653 8:35406081-35406103 CTGAAATATGATAAAATAGAAGG - Intronic
1039695064 8:39901997-39902019 CTGAATTAGACTGAAATAGAAGG - Intergenic
1039859266 8:41442604-41442626 CTGAATAAAGCTGACATAGAAGG - Intergenic
1042021478 8:64374147-64374169 CTGAATGAGGGTGGGAGAGAGGG + Intergenic
1044232623 8:89796969-89796991 CTTAGTCAGGATGAGACAGAAGG + Intergenic
1045852885 8:106724141-106724163 CTCAAATAGGAAGAGATATAAGG + Intronic
1046716227 8:117570680-117570702 CTCAATTAGAATGAGTTAGAAGG + Intergenic
1049701130 8:144013252-144013274 CTCAATTAAGATGAGCCAGAGGG - Intronic
1050361590 9:4836008-4836030 CCGAGTTAGGATGGGATTGAGGG + Intronic
1051551971 9:18339881-18339903 CTGAATATGGAAGAGAGAGATGG - Intergenic
1055064423 9:72104474-72104496 CATAATTAGGATTAGAGAGAAGG - Intergenic
1056650020 9:88451233-88451255 CTGACTTGGGAAGAGACAGAAGG - Intronic
1058503001 9:105640630-105640652 CTGTATTAGGTTGGGTTAGAAGG - Exonic
1059254499 9:112917052-112917074 TTGAAAGAGGATGAGATATATGG - Intergenic
1059824198 9:118008940-118008962 CAGAGTTAGGATGAGAATGAAGG + Intergenic
1203436183 Un_GL000195v1:138946-138968 CTGAGTTAGGATGAAAAACAGGG - Intergenic
1203488782 Un_GL000224v1:84046-84068 CTGAATTGGGATTAGAAATATGG + Intergenic
1203501403 Un_KI270741v1:25941-25963 CTGAATTGGGATTAGAAATATGG + Intergenic
1188369230 X:29348581-29348603 CTGATTTAGGAGGGGAGAGAGGG + Intronic
1191867493 X:65716800-65716822 CTGATCTAGGATGAGATCAAAGG - Exonic
1192800032 X:74457031-74457053 CTGAAATTGGTGGAGATAGAAGG - Intronic
1193572888 X:83165361-83165383 CTGAATCAAGAAGAAATAGAAGG - Intergenic
1194474217 X:94337843-94337865 CTTAATAAGGATGAGTTAAAAGG - Intergenic
1196145081 X:112307645-112307667 CTGAATTTGGGTGAGATGAATGG - Intergenic
1196411241 X:115421791-115421813 CTGAGCTAGAATGAGGTAGATGG - Intergenic
1200706047 Y:6443415-6443437 CTGAACTAGGGTGGGATAAAAGG + Intergenic
1200861235 Y:7994911-7994933 CAGAAGTAGGATTAGTTAGATGG + Intergenic
1201028063 Y:9721293-9721315 CTGAACTAGGGTGGGATAAAAGG - Intergenic
1201055170 Y:9981356-9981378 CTTTATTAGGATGAGATTGTTGG - Intergenic