ID: 953885433

View in Genome Browser
Species Human (GRCh38)
Location 3:46712249-46712271
Sequence GAGGGCAGCAAGGAGGCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 944
Summary {0: 1, 1: 2, 2: 7, 3: 80, 4: 854}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953885426_953885433 7 Left 953885426 3:46712219-46712241 CCCACAAGTGAGGGAGGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG 0: 1
1: 2
2: 7
3: 80
4: 854
953885427_953885433 6 Left 953885427 3:46712220-46712242 CCACAAGTGAGGGAGGGCACACA 0: 1
1: 0
2: 0
3: 21
4: 174
Right 953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG 0: 1
1: 2
2: 7
3: 80
4: 854
953885420_953885433 30 Left 953885420 3:46712196-46712218 CCTGGGCACGGAGGCAAGGGGGG 0: 1
1: 0
2: 2
3: 25
4: 292
Right 953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG 0: 1
1: 2
2: 7
3: 80
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953885433 Original CRISPR GAGGGCAGCAAGGAGGCTGA GGG Exonic
900085287 1:890819-890841 CAAGGCTGCAAGGTGGCTGAGGG - Intergenic
900101115 1:962509-962531 GAGGGCATGCAGGTGGCTGAGGG + Intronic
900324132 1:2099582-2099604 GGGGGCAGCAAGGACCCTGTGGG + Intronic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
900511114 1:3061653-3061675 GAGGGCAGGCAGGAGGGAGAAGG + Intergenic
900564894 1:3327413-3327435 GAGGGCAGGGCGGGGGCTGAGGG - Intronic
900622914 1:3595627-3595649 GGGGGCAGCATGGAGGCAGCAGG + Intronic
900655406 1:3754401-3754423 CAGGGCAGCAATGAAGCTGGGGG + Intronic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
901055304 1:6446383-6446405 GAGGGCTGGAAGGAGGGTGGGGG + Intronic
901128955 1:6950169-6950191 GGAGGCAGCAAGGAGGGGGACGG + Intronic
901130838 1:6962022-6962044 GGGGACAGCCCGGAGGCTGAGGG - Intronic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901229040 1:7631782-7631804 GAGGGTAGCCAGGAGGCAGGGGG - Intronic
901440213 1:9273223-9273245 GTGGTCAGCAAGGCGGCTGGAGG + Intergenic
901513574 1:9730581-9730603 GAGAGCAGCGAGGAGGAGGAGGG - Exonic
901965651 1:12863757-12863779 GAGTGTAGGAGGGAGGCTGAGGG + Intronic
901981048 1:13034135-13034157 GAGTGTAGGAGGGAGGCTGAGGG + Intronic
902001039 1:13194795-13194817 GAGTGTAGGAGGGAGGCTGAGGG - Intergenic
902020269 1:13340499-13340521 GAGTGTAGGAGGGAGGCTGAGGG - Intergenic
902535833 1:17118943-17118965 GAGGACGGCAGGGAAGCTGAAGG + Intronic
902547246 1:17197779-17197801 GAGGGCAGGAAGGTTGGTGATGG + Intergenic
903209951 1:21812343-21812365 CAGGCCAGCAGGGAGGCTGGTGG - Exonic
903806477 1:26009332-26009354 GAGGGCAGGAAGAAGGCAGTGGG + Intergenic
904035497 1:27556512-27556534 GTGGGCAGGTAGGCGGCTGAAGG - Intronic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904535791 1:31198679-31198701 AAGGGCAGCAGGGAGCCTCAGGG - Intronic
904748920 1:32728742-32728764 TAGGGCAGCACGGAGGATGCTGG + Intergenic
904997483 1:34642250-34642272 GAGGTCAGGAAGGAGGCTCTTGG - Intergenic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
905901550 1:41584754-41584776 AAGGGCACCAAGAAGGCTGAGGG - Exonic
906199881 1:43953134-43953156 ATGGGCACCAAGGAGGCTGTGGG - Intronic
906262914 1:44406954-44406976 TAGGGCAGCCAGGAGGCAGGGGG + Intronic
906330377 1:44879180-44879202 GGGGACAGTAAAGAGGCTGAAGG - Intronic
906902096 1:49846024-49846046 GAGGGGAGCAAGCTGACTGAAGG - Intronic
907276192 1:53317815-53317837 GAGTGCAGGAAGAAGGCAGAAGG + Intronic
907855810 1:58302404-58302426 GAGGGCAGCAAAGAAACAGAGGG + Intronic
909206085 1:72759512-72759534 GAGGGTGGCAGGGAGGCTCAGGG - Intergenic
909543061 1:76812608-76812630 GGAGGCAGGAAGGAGGCTGAAGG + Intergenic
909886162 1:80944830-80944852 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
910067184 1:83167836-83167858 GGGGGCAGCAAGGCGGGGGAAGG + Intergenic
910161220 1:84274896-84274918 GAGGGAAGGAGGGAGGCGGAGGG - Intergenic
910189818 1:84583941-84583963 GAGTGAAGCCAAGAGGCTGAAGG - Intergenic
910259822 1:85284125-85284147 GAGCACAGGAGGGAGGCTGAGGG + Intergenic
910348517 1:86268951-86268973 GAGGCCAGCAGGGTGGCTTAGGG - Intergenic
910449600 1:87331860-87331882 AAGGGCGGGAAGGAGGCTGAGGG - Intronic
910681196 1:89866825-89866847 CAGGGCAGCAAGGAGAGTTAAGG + Intronic
910993544 1:93079816-93079838 GAGGGCAGGAAGGAACCTGGGGG + Intronic
911133724 1:94417985-94418007 GAGCCCAGGAAGGAGGCGGACGG - Intergenic
911193588 1:94972075-94972097 GAGGGCAGGATGGAGCCAGATGG - Intergenic
911226106 1:95307328-95307350 TAGGGAAGGAAGGAGACTGAAGG - Intergenic
911418812 1:97612786-97612808 GGGGGCAGCATAGAGGATGAGGG - Intronic
912002257 1:104849430-104849452 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912490424 1:110059761-110059783 GAGGCCAGCAAGGAAGGGGAAGG - Intronic
912681325 1:111730891-111730913 GAGGGTAGCAAGCAGCCTGGAGG - Intronic
913027016 1:114854117-114854139 GAGGAGAGAAAGGAGGCAGAGGG - Intergenic
914807805 1:151004378-151004400 GAGGGGAGCAAGGAGATTGAAGG - Intronic
915030025 1:152871151-152871173 CAAGGCTGCAAGGAGGCAGAGGG + Intergenic
915239215 1:154507887-154507909 GAATGCAGGAGGGAGGCTGAAGG - Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
915491652 1:156253265-156253287 GAAGGCAGAAAGGAGGCAAATGG + Intronic
915623405 1:157099585-157099607 AAGGGAAGGAAGGAGGCAGAGGG + Exonic
915633995 1:157173822-157173844 GTGGGCAGACTGGAGGCTGACGG + Intergenic
915670565 1:157485704-157485726 GTGGGCAGACTGGAGGCTGATGG - Intergenic
916003372 1:160637259-160637281 GAAAGCAGGAAGGAGGATGAGGG - Exonic
916073486 1:161186175-161186197 GAGGGCAATAAGTAGGCAGATGG + Exonic
917570602 1:176261677-176261699 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
918313399 1:183302886-183302908 GGGGCCAGCAAGGAGGCTCCAGG - Intronic
918423769 1:184387731-184387753 GAGGAGAGCAGGAAGGCTGAGGG - Intronic
920096915 1:203492353-203492375 GAGGGCATCCAGTAGGCAGATGG - Intergenic
920213824 1:204348299-204348321 GAGGGCTGAAGGGTGGCTGATGG - Intronic
920455380 1:206097235-206097257 GAGGGCTGCAGGGAGGCAGGAGG - Intronic
920667127 1:207971367-207971389 GTGGGGAGCAAGGTGTCTGAAGG + Intergenic
920672918 1:208018247-208018269 GAGGGGAGCAAAGAGGCTGGAGG - Intergenic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
923108083 1:230869125-230869147 CAGGGCAGCCCGGAGGCTGGAGG + Intronic
923792785 1:237126552-237126574 GAGGGAAGGAAGGAGGATTATGG - Intronic
923897303 1:238285803-238285825 GAGGGTAGAAAGGAGGATAAAGG - Intergenic
924149911 1:241118890-241118912 AAAGGAGGCAAGGAGGCTGAGGG + Intronic
924688828 1:246325043-246325065 GGGGGCAGGAAGGAGGGAGAAGG + Intronic
1062791216 10:307792-307814 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791236 10:307850-307872 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791258 10:307908-307930 GAGGGCAGCAGGGAGGCTTTGGG + Intronic
1062791279 10:307966-307988 GAGGGCAGCAGGGAGGCTTTGGG + Intronic
1062791299 10:308024-308046 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791319 10:308082-308104 GAGGGCAGCAGGGAGGCTTTGGG + Intronic
1062905710 10:1178282-1178304 AAGGGAAGCGAAGAGGCTGAGGG + Exonic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1062978634 10:1703412-1703434 GTGAGCAGTGAGGAGGCTGAGGG + Intronic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1063420658 10:5910492-5910514 GAGGGCCGCACGCAGGCTGTGGG - Intronic
1064024208 10:11833934-11833956 GAGGGCAGCAGGGAGGCAGTGGG + Intronic
1064435140 10:15304615-15304637 AGGGCCAGCCAGGAGGCTGAGGG - Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1064802710 10:19094183-19094205 AAAGGCAGCAACGAGGCTGGGGG - Intronic
1065189821 10:23198996-23199018 GAGGGCTGAAAGGCGGCAGAAGG - Intergenic
1065926136 10:30434751-30434773 GAGTGCAGCTCGGAGGCTGGAGG + Intronic
1066176466 10:32912592-32912614 CAAGGCAGCAGGGAGGCCGAGGG + Intronic
1067054818 10:43044405-43044427 CCTGGCAGCAAGCAGGCTGAGGG - Intergenic
1067061689 10:43081102-43081124 GAGGGCAGCAGGGAGCATGGGGG - Intronic
1067083765 10:43227629-43227651 CAGGGCAGCAAGGAGCCTGCAGG + Intronic
1067114860 10:43427195-43427217 GAACCCAGCAGGGAGGCTGAGGG + Intergenic
1067459393 10:46446153-46446175 GATGGGAGCAATGAGGCTGCTGG + Intergenic
1067627801 10:47938477-47938499 GATGGGAGCAATGAGGCTGCTGG - Intergenic
1067693756 10:48520770-48520792 GAGAGCAGCAGGAAGGGTGAGGG + Intronic
1068394888 10:56447805-56447827 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
1068946074 10:62730030-62730052 GAAGGAAACAAGGAGGCTGTGGG - Intergenic
1069199296 10:65592811-65592833 CAAGGCAGCAGGGAGGCTGGGGG - Intergenic
1069756569 10:70777378-70777400 GAGGGGAGGAAGAGGGCTGAGGG + Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070734917 10:78856772-78856794 GAGGCCAGCTAGGTGACTGAGGG - Intergenic
1070782354 10:79145078-79145100 GAGGGCAGGAAGGAGGGAGGAGG - Intronic
1071305290 10:84294092-84294114 GGGTGCAGCAAGCAGGGTGAAGG - Intergenic
1071328256 10:84537561-84537583 GAGGGCCGGCGGGAGGCTGAAGG + Intergenic
1071450274 10:85787008-85787030 GATGGCAGCTGGGAGGCAGAGGG - Intronic
1071542502 10:86499771-86499793 GGAGGCTGCAAGGAGGGTGATGG + Exonic
1072195687 10:93115846-93115868 GAGTGCAGCATTGAGGCTTATGG - Intergenic
1073369923 10:102978544-102978566 GAGACCAGCAAGGAGGCTAATGG - Intronic
1073515896 10:104075263-104075285 GAGGGTAGCAAGCAGGCAGTGGG - Intronic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074160943 10:110835892-110835914 GAGGGCCTCAAGGAGACCGAGGG + Exonic
1074180580 10:111059455-111059477 GAGGGCAGCATGGAGGCGTGTGG + Intergenic
1074596854 10:114876035-114876057 GAAGGAAGAAAGGAGCCTGAGGG + Intronic
1074759327 10:116654629-116654651 GAGGGCAGCAGAGGGGCTGTGGG + Intergenic
1074936849 10:118190417-118190439 TAAGGCAGCATGGAGGCTGGAGG + Intergenic
1075268319 10:121025560-121025582 GAGGGGAGCAGGGAGGCTCTCGG + Intergenic
1075531887 10:123236696-123236718 GAGGGCAGCATGGAGGCACCTGG - Intergenic
1075857318 10:125640805-125640827 GGTGGCAGCAAAGAGCCTGAAGG + Intronic
1076368897 10:129939241-129939263 GAGGGCAGGAAGGAGGGCCAGGG - Intronic
1076781590 10:132727691-132727713 GGGGCCACCAGGGAGGCTGAGGG - Intronic
1076815993 10:132914852-132914874 GAGCGAAGCCAGGAGGCTCAAGG - Intronic
1076864685 10:133160842-133160864 GGGGGCAGCAAGGAGGACGGAGG + Intronic
1076947860 10:133664599-133664621 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076948850 10:133667909-133667931 GAGGCCACCGAGGAGCCTGAGGG - Exonic
1076949834 10:133671208-133671230 GAGGCCACCGAGGAGCCTGAGGG - Intronic
1076950818 10:133674507-133674529 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076951808 10:133677817-133677839 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076952797 10:133681127-133681149 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076953781 10:133684426-133684448 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076954765 10:133740778-133740800 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076955754 10:133744088-133744110 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076956744 10:133747398-133747420 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076957731 10:133750707-133750729 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076958716 10:133754006-133754028 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076959705 10:133757316-133757338 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1076960689 10:133760615-133760637 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077334355 11:1996871-1996893 TTGCGCAGCAAGGAGGCTGCAGG - Intergenic
1077505449 11:2928028-2928050 GCGGGCAGCCAGAGGGCTGAGGG + Intergenic
1077759467 11:5076451-5076473 GAAGGCAACAATGAGGCTGTAGG + Intergenic
1077953791 11:6991287-6991309 GAGGGAAGCAGGGAGGCTAGGGG - Intergenic
1078023092 11:7671588-7671610 GGGAACAGCAAGGAGGCTCAGGG + Intronic
1078171272 11:8930850-8930872 AAGCACAGGAAGGAGGCTGAGGG - Intronic
1078464668 11:11541425-11541447 GATGGGAGGAATGAGGCTGAAGG - Intronic
1078526411 11:12104886-12104908 GGGGACAGCGAGGAGGCTGAGGG - Intronic
1078528277 11:12117246-12117268 GAGGGCAGCAAGGGGTTGGACGG + Intronic
1079275208 11:19029077-19029099 GGGGGCAGCGGGGAGGCAGAGGG + Intergenic
1080450395 11:32374566-32374588 CAGGGCTGCAAAGTGGCTGAGGG - Intergenic
1080640174 11:34154125-34154147 GAGGGCAGTGTAGAGGCTGAGGG - Intronic
1080711073 11:34748562-34748584 GAGGGCAGGAGGAAGGCTGGAGG + Intergenic
1080712680 11:34764555-34764577 CAAGGCAGCAATGAGGCTGGGGG - Intergenic
1080859329 11:36139701-36139723 GAGGGCAGCAAGAAGGCAGTTGG + Intronic
1081508142 11:43739558-43739580 GAAGGCAGAAAGTTGGCTGAAGG + Intronic
1081643555 11:44774622-44774644 GAGGGAAGAAGGGAGGATGAAGG - Intronic
1081938314 11:46919377-46919399 TGGGGCTGGAAGGAGGCTGAGGG - Intergenic
1082101143 11:48174105-48174127 GGGGGCACCAAGGTGGCTTATGG - Intergenic
1082141765 11:48617465-48617487 CAAGGCAGCAGGGAGGCTGGGGG - Intergenic
1082556196 11:54565842-54565864 CAAGGCAGCAGCGAGGCTGAGGG - Intergenic
1083272161 11:61578041-61578063 GGGGGCAGAAGGGAGGCTGCAGG + Intronic
1083296850 11:61719637-61719659 CAGGGCAGGAGGAAGGCTGAAGG - Intronic
1083452271 11:62753941-62753963 GTGGGCATCAAGGAAGCGGAGGG - Intronic
1083633701 11:64108946-64108968 GTGGGCAGGAAGGAGGCTGAGGG + Intronic
1083940217 11:65891553-65891575 CAGGGCAGCAGGGGGACTGAAGG + Exonic
1084271107 11:68029701-68029723 CAGGACAGGAAGGAGGCAGAGGG - Intergenic
1084396817 11:68916531-68916553 GATGGCAGCAGGGAGGGTGCTGG + Intronic
1084495616 11:69501469-69501491 GAGGGCTGAAAGGAGGAAGATGG + Intergenic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085345779 11:75767507-75767529 GAGGGCAGTGGGGAGGCTGTAGG - Intronic
1085442288 11:76576081-76576103 GAGGGCAGTAAGGAGGGAGAAGG - Intergenic
1085655217 11:78308282-78308304 GAGGGCATACGGGAGGCTGAGGG + Intronic
1086079835 11:82891562-82891584 GAGGACAGAAAGGAGGTTCAGGG - Intronic
1086282766 11:85210023-85210045 GTGGGCAGAAAGGATGATGAGGG - Intronic
1086384990 11:86297969-86297991 GAAGTCAGCTAGGAGTCTGATGG + Intergenic
1087666324 11:101053513-101053535 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666353 11:101053600-101053622 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087673767 11:101135575-101135597 GAAGGGAGCTAGGTGGCTGAGGG - Intergenic
1087722650 11:101684119-101684141 CAAGGCAGCAGTGAGGCTGAGGG - Intronic
1088367111 11:109051307-109051329 GTAGGCAGGAAGGAGGCAGAAGG + Intergenic
1088902952 11:114132548-114132570 GGGGGCAGGATGGAGGCTCAGGG - Intronic
1089531466 11:119132589-119132611 GAGGGCAGGAGGGAGGCTGTGGG - Intronic
1089634214 11:119801988-119802010 GAGAGGAGCAGAGAGGCTGAGGG + Intergenic
1090116646 11:123980145-123980167 GAGGGAAGCCAAGGGGCTGAGGG - Intergenic
1090290261 11:125537021-125537043 CAAGGCAGCAACGAGGCTGGGGG + Intergenic
1090440068 11:126718172-126718194 GAGGGCAGAAATGTGGCTGCAGG - Intronic
1090536414 11:127646416-127646438 GAGGGCAAAAAGGAGGGTCAGGG + Intergenic
1091222601 11:133937994-133938016 CAGGGCAGCGATGTGGCTGATGG - Intronic
1202817338 11_KI270721v1_random:52053-52075 TTGCGCAGCAAGGAGGCTGCAGG - Intergenic
1091400218 12:176760-176782 CAGGGCAGCAAGGACACAGAGGG - Exonic
1091758240 12:3070022-3070044 GAGGATAGCCAGGAGTCTGAAGG + Intergenic
1091832086 12:3557115-3557137 GAGGGCAGCAGATAGGCTGGGGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092001807 12:5038970-5038992 GGGGGCAGGAAGGAGGCGAAGGG - Intergenic
1092040293 12:5378321-5378343 GTGGGGAGGGAGGAGGCTGAAGG - Intergenic
1092906499 12:13104572-13104594 CAGGGCAGCAAGGAGAAGGAAGG - Intronic
1094025916 12:25959211-25959233 GAGGGCAGCTCCGAGGCTGCAGG - Intronic
1095309988 12:40687413-40687435 GAGGGAAAAAAGGAGGGTGAGGG - Intergenic
1095397248 12:41775091-41775113 GAAAGCAGCCAGGAGGATGAAGG - Intergenic
1095737123 12:45569689-45569711 GAGGGCCCCAAGGAGATTGAGGG + Intergenic
1095953919 12:47795937-47795959 GCGGGCAGCAAGGACACTGTCGG + Exonic
1095983476 12:47985496-47985518 GAGGGCTGCTAGGAGGGTGGGGG - Intronic
1096098796 12:48956696-48956718 GAGGGCAGCAAGTGGGGAGAGGG - Intronic
1096656944 12:53097880-53097902 GAGGGCTGCGCGGAAGCTGAGGG + Exonic
1096745825 12:53726286-53726308 GATGGAAGGATGGAGGCTGAGGG - Intronic
1096747446 12:53738132-53738154 TAGAGCAGCAAGAAGGCTGAAGG + Intergenic
1096807209 12:54148234-54148256 CAGGGCAGGAAGATGGCTGAAGG + Intergenic
1096892797 12:54788984-54789006 CAAGGCAGCAACGAGGCTGGGGG + Intergenic
1096922429 12:55101848-55101870 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
1096985115 12:55751022-55751044 AGGAGCAGTAAGGAGGCTGAAGG + Exonic
1098123968 12:67270236-67270258 GCGGGCAGAGAGGAGGCTGCCGG - Intronic
1098910920 12:76207589-76207611 GAGGGAACTAAGGAGGCTCAAGG + Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100457564 12:94767368-94767390 GAGGGCAGCAAGCAAGAGGAGGG + Intergenic
1100750858 12:97697030-97697052 GCAGGCAGCAGGGAGGCTGAGGG - Intergenic
1100927473 12:99565929-99565951 GAGGGCCTCTAGGAGGCTGAAGG - Intronic
1101009787 12:100437651-100437673 GAGGGCTCCAAAGGGGCTGACGG - Intergenic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1101444434 12:104727447-104727469 GGGGCCAGCAGGAAGGCTGATGG + Intronic
1101745537 12:107538709-107538731 GAGGACAGCGGGGTGGCTGATGG - Intronic
1101745795 12:107540535-107540557 GATGGCAGCAAGGGGTATGATGG - Intronic
1102061558 12:109935992-109936014 GAGGGCAGGAGTGAGGCTGGAGG + Intronic
1102309572 12:111834878-111834900 CAAGGCAGCAGGGAGGCTGGGGG - Intergenic
1102433057 12:112898552-112898574 GATGGCAGCCAGGAAGCTGTTGG - Exonic
1102872705 12:116426490-116426512 GCTGGGGGCAAGGAGGCTGAGGG + Intergenic
1103398038 12:120623006-120623028 AGGGGCAGCAAGGAGACTGCGGG - Intergenic
1103399784 12:120635939-120635961 GTGGGCTGGAAGGAGACTGAAGG - Intergenic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104320192 12:127743398-127743420 AAGGGCAGCTTGAAGGCTGAAGG + Intergenic
1104542353 12:129677781-129677803 GAAGCCAGTAAGGAGGATGAAGG - Intronic
1104769877 12:131354765-131354787 AAGAGCAGAAAGGAGGCTGAGGG + Intergenic
1104844070 12:131838170-131838192 GAGGGCAGAGAGCAGGGTGAGGG - Intronic
1104950825 12:132439156-132439178 GAAGGCAGCCATGAGGCTGGAGG + Intergenic
1104978159 12:132561304-132561326 GAGGGCTGCAAGGAAGGGGAGGG - Intronic
1104984111 12:132587066-132587088 GAGGGCAGCAGTGCGGCTGGAGG + Intergenic
1106391506 13:29339227-29339249 TAGGGCAGGCAGCAGGCTGAGGG + Intronic
1106841329 13:33687813-33687835 GGGGGCACCAAGGAGGGTGCAGG + Intergenic
1106865367 13:33958778-33958800 GAGGGCAGCCAGGATGCTCATGG - Intronic
1107408700 13:40138910-40138932 CAGGGCAGCCAGCAGGGTGAGGG + Intergenic
1107469058 13:40675060-40675082 GAGGACAGCAGGGAGGGAGAGGG - Intergenic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108495476 13:51020397-51020419 GAGGGCAAAAAGGTGGCTGCAGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1113765030 13:112875865-112875887 GACGTCGGGAAGGAGGCTGATGG - Exonic
1113815033 13:113163660-113163682 TGGGGCATCAAGGAGGCAGATGG - Intronic
1113991456 14:16030605-16030627 GAGGCCACCGAGGAGTCTGAGGG + Intergenic
1114240273 14:20860528-20860550 CAAGGCAGCAGCGAGGCTGAGGG + Intergenic
1114453852 14:22843192-22843214 TGGGGAAGCAGGGAGGCTGAGGG + Intronic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114617169 14:24074473-24074495 GAGAGCTGCAAGGAGGGTGGGGG - Intronic
1115028502 14:28767760-28767782 GAGGGCGGCAAGGACGGGGAGGG + Exonic
1115144921 14:30215404-30215426 AAGAGTAGCAAGGAGGCGGATGG - Intergenic
1116515171 14:45796177-45796199 CAAGGCAGCAAGGAGGCTGGGGG + Intergenic
1116721563 14:48503207-48503229 AAAGGCATTAAGGAGGCTGAGGG + Intergenic
1117467524 14:56008190-56008212 GAGGGCAGTAAGGAGCCATATGG - Intergenic
1117533363 14:56680569-56680591 CAGGGTAGCAATGAGGCTCAGGG - Intronic
1117937797 14:60926784-60926806 TAGGGAAGGGAGGAGGCTGAAGG - Intronic
1118259922 14:64236898-64236920 GAGGGCAGAAGGGTGGCTGTGGG - Intronic
1118321828 14:64757892-64757914 GAGAGCAGGAAGAGGGCTGAGGG - Intronic
1118723838 14:68612831-68612853 GAGGGAAGGAAGGAGGGAGAGGG + Intronic
1119194450 14:72706668-72706690 TAGGAAAGCAAGGAGCCTGATGG - Intronic
1119722580 14:76901171-76901193 GAGGGCAGAAAGGAGAGGGAGGG + Intergenic
1120224841 14:81779031-81779053 GAGGGAAGCAAGGAGCATGGTGG - Intergenic
1120314609 14:82875526-82875548 GAGGCCAGCTAGGACTCTGAGGG + Intergenic
1120486352 14:85118454-85118476 GAGGACAGGAATGAGGCTAAGGG - Intergenic
1120585965 14:86312639-86312661 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1120743056 14:88128948-88128970 GATGCCAGCAAGGAGACTGGAGG + Intergenic
1121335868 14:93077144-93077166 GAGTGCAGCTTGGAGGCTGTTGG - Intronic
1121407514 14:93728030-93728052 GAAGCAAACAAGGAGGCTGAGGG + Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121691943 14:95884303-95884325 GAGGGAAGCAAGGGGGCAGGTGG - Intergenic
1122066089 14:99175292-99175314 GAGGGCCTCAAGGCGGCCGACGG - Exonic
1122071779 14:99209665-99209687 CAGGAGAGCTAGGAGGCTGAGGG + Intronic
1122221390 14:100240535-100240557 GCGGGGAGCAAGGAGGCCGGAGG - Intronic
1122772531 14:104103741-104103763 GAGGGCCCCAGGGAGCCTGAGGG - Intronic
1122797384 14:104212804-104212826 CAGGGCAGCAAGGTGGCTGCAGG + Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1123124585 14:105937416-105937438 GAGGGCAGCATGGAGGCACCTGG + Intergenic
1202853682 14_GL000225v1_random:37118-37140 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1202857200 14_GL000225v1_random:58849-58871 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
1202858160 14_GL000225v1_random:64162-64184 GAGGCCACCGAGGAGCCTGAGGG + Intergenic
1202862148 14_GL000225v1_random:89738-89760 GAGGCCACCGAGGAGCCTGAGGG + Intergenic
1123456446 15:20430643-20430665 GAGGGCAGCAGCGAGGCACAGGG - Intergenic
1123661617 15:22569715-22569737 GAGGGCAGCAGCGAGGCACAGGG + Intergenic
1124242100 15:28037263-28037285 GAGGGCAGGAAGGCAGCTGGTGG + Intronic
1124262585 15:28205794-28205816 GAGGGCAGCAGCGAGGCACAGGG - Intronic
1124315416 15:28663948-28663970 GAGGGCAGCAGCGAGGCACAGGG + Intergenic
1124400461 15:29343486-29343508 TAGGGCAGCAGGGAGGCTGGAGG - Intronic
1124886987 15:33696398-33696420 CAGGGCAGCCAGCAGGTTGATGG - Exonic
1124894816 15:33766670-33766692 GAGGGCAGCAAGCACACTGATGG - Intronic
1125029750 15:35064305-35064327 GAGGGCGGCAGGGAGGGGGAAGG - Intergenic
1125243166 15:37600272-37600294 AAGGGCAGCAAAGAGCATGAAGG - Intergenic
1125311219 15:38379889-38379911 CAGGGCACCAATCAGGCTGAGGG - Intergenic
1126293144 15:47105474-47105496 GAAGGCAGCAAGGAAGATCAGGG - Intergenic
1127958498 15:63873263-63873285 GAAGGAAGCAAGGAAGCTGTGGG - Intergenic
1127963812 15:63909047-63909069 CTGGTCAGCAAGGCGGCTGAAGG - Intronic
1129247132 15:74286445-74286467 GAGGGCACCCAGGATGCTGTGGG - Intronic
1129257876 15:74344359-74344381 CAGGTCAGAAAGGAGACTGAGGG + Intronic
1129315725 15:74742547-74742569 GAGGGCAGTATGGAGGCTGTGGG + Intergenic
1129325053 15:74795442-74795464 GAGCCCAGCAAAGAGGCTCATGG + Intronic
1129548813 15:76426320-76426342 CAAGGCAGCAAAGAGGCTGGGGG - Intronic
1129661717 15:77556464-77556486 GAGGGCAGCCAGGGGGCTCTGGG - Intergenic
1129718937 15:77867138-77867160 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1130006860 15:80107871-80107893 GAGGGCAGCGGGGAGGGGGAAGG + Intronic
1130459997 15:84153722-84153744 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic
1130548427 15:84873219-84873241 GAGGGCAGTGAGGGGGTTGATGG + Exonic
1131111552 15:89767783-89767805 GTGGGCAGCCAGGTGGCTGCAGG + Intronic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1132092996 15:98960783-98960805 GAGGGCAGCCTGGAGGGGGAGGG - Exonic
1132147231 15:99436234-99436256 GAGGGCAGCATTGGGGCTGCTGG - Intergenic
1132221795 15:100110718-100110740 AAGAGCAGCAAGGAGGATGAAGG - Intronic
1132284719 15:100654530-100654552 GCTGACAGCAGGGAGGCTGAAGG - Intergenic
1132314791 15:100881692-100881714 CAGTGCAGGAATGAGGCTGAGGG + Intronic
1132482858 16:175251-175273 CAGGGCAGGGAGCAGGCTGAAGG + Intergenic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132709468 16:1259964-1259986 GAGGGCAGGTGGGAGGGTGAAGG + Intergenic
1132855745 16:2043883-2043905 GAGGGCAGCAGGGAGGCCCAAGG + Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133506547 16:6418065-6418087 CATGGCAGTAAGGAGCCTGAGGG - Intronic
1133867415 16:9657248-9657270 GATGGCGGCAATGAGGATGATGG + Intergenic
1135314694 16:21434623-21434645 GAGTGTAGCAGGGAGGATGATGG - Intronic
1135367617 16:21866903-21866925 GAGTGTAGCAGGGAGGATGATGG - Intronic
1135444197 16:22504259-22504281 GAGTGTAGCAGGGAGGATGATGG + Intronic
1136085484 16:27881926-27881948 GAGGCCAACCAGGAGGCTGCAGG - Intronic
1136193092 16:28630298-28630320 GAGTGTAGCAGGGAGGATGATGG + Intergenic
1136311359 16:29413305-29413327 GAGTGTAGCAGGGAGGATGATGG - Intergenic
1136324806 16:29515098-29515120 GAGTGTAGCAGGGAGGATGATGG - Intergenic
1136439491 16:30255083-30255105 GAGTGTAGCAGGGAGGATGATGG - Intergenic
1136910643 16:34141729-34141751 GAGGCCACCGAGGAGTCTGAGGG + Intergenic
1136930787 16:34416402-34416424 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
1136973786 16:34995406-34995428 CAAGGCAGCAACGAGGCTGGGGG + Intergenic
1137270142 16:46897863-46897885 AAAGGCAGGAAGGAGGCTAAGGG - Intronic
1137833989 16:51572925-51572947 GAGGGCAGCAAGATGGCGAAAGG + Intergenic
1138112560 16:54336571-54336593 GAGGGCAGGAAGGTGGGGGAGGG + Intergenic
1138191507 16:55017500-55017522 GAGGGCAGCATGGAAGCTCCTGG + Intergenic
1139429424 16:66903300-66903322 GTGGTCAGGAAGCAGGCTGACGG - Intergenic
1139504193 16:67390972-67390994 AAGGACTGCAAGGTGGCTGACGG - Exonic
1139508235 16:67410292-67410314 GTGGGCAGCAAGGAGCTTGTGGG - Intronic
1139661199 16:68421994-68422016 GAGGGAAGCAAGACCGCTGAAGG + Intronic
1139690809 16:68640921-68640943 AAGGGAAGCAGGGAGGCTGGTGG - Intronic
1140050895 16:71480116-71480138 GAGGCCAGCAGGGAGGGAGAAGG - Intronic
1140231309 16:73119485-73119507 GAGGGCAACATTGTGGCTGATGG + Intergenic
1140803962 16:78515640-78515662 GAGGCCGGCAAGAAAGCTGACGG - Intronic
1141173216 16:81704175-81704197 GGGGGCAGGGAGGAGGCTGAGGG - Intronic
1141173224 16:81704195-81704217 GGGGGCAGGAAGGAGGGGGAGGG - Intronic
1141173260 16:81704277-81704299 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173285 16:81704338-81704360 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173346 16:81704478-81704500 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173361 16:81704518-81704540 GTGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173423 16:81704676-81704698 GGGGGCAGGGAGGAGGATGAAGG - Intronic
1141173431 16:81704697-81704719 GGGGGCAGGGAGGAGGGTGACGG - Intronic
1141592449 16:85077700-85077722 GGGGGCAGCAGGGAGGGTGCGGG + Intronic
1141734672 16:85844270-85844292 GAAGGAAGGAAGGAGGATGAAGG - Intergenic
1141927625 16:87179462-87179484 AAGGCCAGCAGGGAGGATGAGGG - Intronic
1142009855 16:87708409-87708431 GAGGACAGTGAGGAGGTTGAGGG - Exonic
1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG + Intronic
1142227739 16:88885715-88885737 GAGGACAGGGAGGAGGCTGGTGG - Intronic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1142500077 17:327410-327432 GAGAGGAGCAGGGAGGCAGAAGG + Intronic
1142717491 17:1755044-1755066 GGGGGTAGGATGGAGGCTGATGG - Exonic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1142933769 17:3310444-3310466 GATGGCCGCCAGGATGCTGAGGG - Intergenic
1143544359 17:7587892-7587914 AAGGGAAGCAGGGAGGCTGGAGG - Exonic
1143631177 17:8141174-8141196 GAGGGCTGCGAGGAGGCCCAAGG - Exonic
1144623003 17:16830337-16830359 GAGAGCAGCAGGGGGGCTAAAGG + Intergenic
1144883427 17:18442379-18442401 GAGAGCAGCAGGGGGGCTAAAGG - Intergenic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145148803 17:20502007-20502029 GAGAGCAGCAGGGGGGCTAAAGG + Intergenic
1146910143 17:36643053-36643075 GGAGGCAGGAAGGAAGCTGAGGG - Intergenic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147577327 17:41610273-41610295 GAGAGCAGCAGGGGGGCTAAAGG + Intronic
1147661346 17:42118694-42118716 GAGGGCAGTGAGGGGGCTCAGGG - Intronic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1148217008 17:45838827-45838849 GAGGGCAGCAAGGAGGCCTCAGG + Intergenic
1148386336 17:47237667-47237689 AAGCACAGGAAGGAGGCTGAGGG - Intergenic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1148844080 17:50518493-50518515 GAGGGCAGTAAGAAGGCTCTGGG - Intronic
1148865350 17:50625518-50625540 GAGGGCAGCAGGGACACAGAAGG + Intronic
1149657352 17:58317278-58317300 GGAGGCAGAAAGGAGGCAGAAGG + Intronic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151393602 17:73804307-73804329 GAGGGGAGGAGGCAGGCTGAAGG + Intergenic
1151440014 17:74122461-74122483 GATGGCAGCAATGAGGGTGGTGG - Intergenic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151696317 17:75719875-75719897 GATGACAGCATGGAGGCTCAGGG + Intergenic
1151935168 17:77256879-77256901 GAGGGGAGCAAGGAGGTAGAAGG + Intergenic
1152028165 17:77825099-77825121 GAGGGCACCAGGCAGGCTCATGG - Intergenic
1152285845 17:79412966-79412988 GAGAGCAGAAGGGAGGCTGGAGG - Intronic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1152581287 17:81166483-81166505 GAGGGGGGCACGGAGGCTGGCGG + Intergenic
1152725309 17:81942137-81942159 GAGGGGAGCAAAGAGCATGAGGG + Intronic
1152732390 17:81978655-81978677 GGGCGCAGCCAGGAGGCTGTTGG + Intronic
1153950570 18:10054544-10054566 GAGGGCCACAAGGAGTGTGAGGG - Intergenic
1154166047 18:12015276-12015298 GGAGGCGGCAGGGAGGCTGATGG - Intronic
1154193008 18:12245933-12245955 AAGGGCAGGAAGGAGGTTGGTGG - Intergenic
1155198942 18:23500994-23501016 CAGTGCAGCAAGGATGTTGAAGG + Intergenic
1156378016 18:36532015-36532037 CAGGCCAGCAGTGAGGCTGAGGG - Intronic
1156638391 18:39059299-39059321 GAAGGCAGCAATGTTGCTGAAGG + Intergenic
1156827673 18:41451341-41451363 AAAAGCAGCAGGGAGGCTGAAGG + Intergenic
1157533379 18:48441008-48441030 TAGGACAGCGAGGAGGTTGACGG + Intergenic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157560209 18:48640206-48640228 GAGTGCAGCAAGGAGCCAGCCGG - Intronic
1157598201 18:48876505-48876527 GAGGGAAGCAAGGAGGTTTTTGG - Intergenic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1159594518 18:70370265-70370287 GAGAGCAGTAAGGAGTCTGAGGG - Intergenic
1159629792 18:70736266-70736288 CAAGGCAGCAGCGAGGCTGAGGG + Intergenic
1159973218 18:74678485-74678507 GAGGACAGCCAGCAGGCTGATGG - Intronic
1160136284 18:76274340-76274362 CAGGGCAACCAGGGGGCTGAGGG + Intergenic
1160161897 18:76479773-76479795 CAGGGCAGCCAGGAGGCCAAGGG - Intronic
1160560619 18:79753704-79753726 GAGTCCAGCAACGAGGATGAGGG + Exonic
1160575416 18:79850057-79850079 GAGGGTAGCGGGGAGGCAGAAGG - Intergenic
1161058106 19:2200639-2200661 GAGGGGAGCAGGGAGGATGGCGG - Intronic
1161487991 19:4546142-4546164 GAGGGGAGGGAGGAGGCTGGAGG - Intronic
1161775303 19:6258813-6258835 GAGGGCCCAAAGGAGGTTGAGGG - Intronic
1161984482 19:7646210-7646232 GAGGGCAGCAGGGGGATTGAGGG - Intronic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163664978 19:18598916-18598938 GGGTGCAGGAAGCAGGCTGAGGG + Intronic
1163678319 19:18666527-18666549 GAGGGCAGCGGGGAGGCACACGG - Intronic
1163690708 19:18736813-18736835 GAGGGAAGCAGGCGGGCTGATGG - Intronic
1163738807 19:18998165-18998187 GAGGGCAGATGGGAGGCTGTAGG - Intronic
1164367588 19:27602667-27602689 CAAGGCAGCAACGAGGCTGGGGG - Intergenic
1165187683 19:34036049-34036071 AAGGGCAGTTTGGAGGCTGAAGG + Intergenic
1165261844 19:34625549-34625571 CAAGGCAGCAATGAGGCTGGGGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165739473 19:38196750-38196772 GGGGGGAGCCAGGAGGCCGAGGG + Intronic
1165739482 19:38196770-38196792 GGGGGGAGCAAGGAGGCTGAGGG + Intronic
1165937613 19:39398642-39398664 CAGGGAAGCAGGGAGTCTGAGGG - Exonic
1166096338 19:40541651-40541673 GAGGACAGGAGAGAGGCTGAGGG - Intronic
1166596062 19:44051422-44051444 GATGGCTGAAAGGAGGCTCAGGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166742506 19:45122881-45122903 GGGGTCAGCAAGGAGGCTGGAGG - Intronic
1166856316 19:45784173-45784195 GAGGTCAGCAGGGAGGGTTATGG + Exonic
1166919995 19:46222743-46222765 GAGACCAGGCAGGAGGCTGATGG - Intergenic
1166999752 19:46738893-46738915 GAGGGCAGACAGGAGGCAAAGGG + Intronic
1167272101 19:48511538-48511560 GACGGCCGCAAGGAGGATGAGGG + Exonic
1167330364 19:48852096-48852118 AAGGACAGAAAGGAGGCTAAGGG + Intronic
1167388817 19:49180956-49180978 GAGGGCACCAAGCACCCTGAGGG + Intronic
1167413159 19:49356776-49356798 GATGGCATGGAGGAGGCTGAAGG - Intronic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167497152 19:49826421-49826443 GAGAGCAGGAAGAAGGCTCAGGG + Intronic
1167672121 19:50859381-50859403 GAGGGCAGCAGGGATGTGGAGGG + Intronic
1167728246 19:51233832-51233854 GAGGGCAGCATGGAGGCACCCGG - Intronic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168275772 19:55277532-55277554 GAAGGCAGCAGGGAGGCTGACGG + Intronic
1168647311 19:58068073-58068095 GAGGGGAGCAAGCTGGCTGAAGG - Exonic
1168691910 19:58382385-58382407 GAGGGCGAGCAGGAGGCTGAAGG + Intergenic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
925891568 2:8438953-8438975 GAGGGCTCCTAGGAGCCTGAAGG + Intergenic
926061213 2:9806326-9806348 GTGGGCCCTAAGGAGGCTGAGGG - Intergenic
927184728 2:20474010-20474032 CAGGGCAGCAAGCAGCCTGGTGG - Intergenic
927944029 2:27123906-27123928 GGGGCCAGCCAGGAGCCTGAGGG + Exonic
928135433 2:28684349-28684371 GAGGGTAGCAGGCAGGCAGACGG - Intergenic
928478525 2:31656099-31656121 GAGGGAATCAAGAAGGGTGAAGG + Intergenic
928921675 2:36534142-36534164 GAGGGCAGGAAGGGGGAAGAAGG + Intronic
929446211 2:42003388-42003410 AAAGGCAGCAGTGAGGCTGATGG - Intergenic
929604531 2:43226087-43226109 GAGGGCGGCAAGGAGGGCGCCGG - Intronic
929779824 2:44950297-44950319 GAGGGCAGGTAGGTGCCTGAGGG - Intergenic
929997860 2:46840303-46840325 GAGGCCAGGTAGGAGGCTGTTGG - Intronic
931079987 2:58758190-58758212 GCGGGCAGCCAGGGGGCTCAGGG - Intergenic
932126162 2:69147042-69147064 GAGGGCAGCATGGAGGCCAGAGG + Intronic
932568732 2:72925468-72925490 CAGGGCAGCAGCTAGGCTGAGGG - Intronic
932717705 2:74114308-74114330 GAGGGCTGGAAGGAGGATAAGGG + Intergenic
932776995 2:74534360-74534382 AATGGCACCAAGGTGGCTGAGGG - Exonic
932863901 2:75321730-75321752 AAAGGCTGCAGGGAGGCTGAGGG - Intergenic
932957373 2:76368801-76368823 AATGGCAGCAAGGAGAATGATGG + Intergenic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933839582 2:86275690-86275712 CAGGCCAGTCAGGAGGCTGACGG - Intronic
934713411 2:96529782-96529804 GAGGGCTGCGTGGAGGCTGAAGG - Intergenic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
935331316 2:101979765-101979787 GCGGGCAGCAGGGAGTCTGGAGG + Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935387137 2:102512267-102512289 GAGACAAGTAAGGAGGCTGAGGG + Exonic
936228558 2:110679932-110679954 GAGGGCTCCATGGAGGCTGGGGG + Intergenic
936436265 2:112509406-112509428 CAAGGCAGCAACGAGGCTGGGGG - Intronic
936462605 2:112723828-112723850 GGGGCCAGGAAGGAGGCCGACGG - Intronic
938105364 2:128526358-128526380 GAGGCCAGTCAGGTGGCTGAAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938659552 2:133471538-133471560 GGGGGAAGCAAGCAGGCAGAGGG + Intronic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
940694326 2:156959673-156959695 GAGCACAGGAGGGAGGCTGAGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941764653 2:169283978-169284000 CAGGGAAGCGAGGAGGGTGAAGG - Intronic
942085265 2:172437742-172437764 GAGGGCACCAAGGACGGGGATGG + Intronic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942658199 2:178236894-178236916 GAAGACAGGAAGGAGGCTGGGGG - Intronic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
944192429 2:197017887-197017909 TAGGGCAGCAAGGAGGGGAAGGG - Intronic
945144381 2:206721751-206721773 GAGAGCAGCAAGCAGTCAGAAGG + Intergenic
945550836 2:211219734-211219756 CAAGGCAGCAGGGAGGCTGAGGG + Intergenic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946201326 2:218072510-218072532 CCAGGCAGCAAGAAGGCTGACGG + Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946406213 2:219493278-219493300 GAAGGCAGCGAGGCGGCAGAGGG + Exonic
946877134 2:224140429-224140451 TAGGGCAGAAAGGAGGATGTGGG - Intergenic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947515501 2:230800632-230800654 AAGGACAGCCAGGAGCCTGAGGG + Intronic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947713183 2:232327239-232327261 GCGGGCAGCACTGAGGCTGCAGG - Intronic
947865829 2:233397330-233397352 GAGGGGACCAGGGTGGCTGAGGG + Intronic
947865867 2:233397467-233397489 GAGGGGAGCAGGGTGGCTGGCGG + Intronic
947912417 2:233810145-233810167 GAGGGCAGCAAAGCAGCTCAGGG - Intronic
948162069 2:235833140-235833162 GCAGGCAGCAAGCAGGCTGTTGG + Intronic
948360755 2:237418461-237418483 GAAGGCAGGAAGAAGGATGAGGG - Intergenic
948423222 2:237873120-237873142 GAGGGGAGCAGGGAGGCTTCAGG + Intronic
948456525 2:238107036-238107058 CAAGGCAGGAAGGAGGGTGAAGG + Intronic
948695738 2:239732255-239732277 GAGGGCAGCAAGGATGGTAGAGG - Intergenic
948766131 2:240220474-240220496 GAGGGCGGCCAGAAGGCTCAAGG - Intergenic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
1168789465 20:566519-566541 GAGGGCAGCAAAGAGAATGCAGG - Intergenic
1168885998 20:1256519-1256541 GAGGACAGTAAGGAGGGAGATGG - Intronic
1169479169 20:5962069-5962091 GAGTACAGCAAGGTGGCTGGGGG + Intronic
1169773760 20:9229847-9229869 GAGGGCAGGAAGTAGGGGGAGGG - Intronic
1169867164 20:10214515-10214537 GAGGGCAGAAAGGAGTCTGATGG + Intergenic
1170712635 20:18806260-18806282 GGGGGCAGCAAGGCGGGGGAAGG - Intergenic
1170880266 20:20290823-20290845 GAAGGCATGAAGGAGGCTGCAGG - Intronic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1171401323 20:24874523-24874545 GGGGGCTTCCAGGAGGCTGACGG - Intergenic
1171770420 20:29319082-29319104 GAGGCCACCTAGGAGTCTGAGGG - Intergenic
1172182071 20:33009708-33009730 GAGGGCAGGAAGGCGGCGGAGGG - Intronic
1173170224 20:40717530-40717552 GAGCCCAGCAAGCAGGCAGAAGG + Intergenic
1173249695 20:41358007-41358029 GAGGGCAGAGAAGAGGCTGCTGG - Exonic
1173418596 20:42880542-42880564 GAGGGCATCCTGGGGGCTGAAGG - Intronic
1173724862 20:45290390-45290412 CAGGGAACCAAGAAGGCTGAGGG + Intergenic
1174258553 20:49277417-49277439 GGGGGCAGGGAGCAGGCTGAAGG + Intronic
1174359335 20:50018059-50018081 GAGGGAAGGAAGGAGGGAGAAGG - Intergenic
1174520034 20:51122264-51122286 GAGGCCAGAGAGGAGGCTAAGGG - Intergenic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175423340 20:58849754-58849776 GAAGGAAGCAGGAAGGCTGAAGG - Intronic
1175468486 20:59208953-59208975 GAGCTAAGCAGGGAGGCTGACGG - Intronic
1175922706 20:62457528-62457550 GAGGATAGCAGGGAAGCTGAGGG - Intergenic
1176098763 20:63355743-63355765 CAGGCCAGCAAAGAGGCTGAGGG - Intronic
1176193230 20:63824000-63824022 GAGTGCAGAGAGGAGGCTGTAGG + Intronic
1177723796 21:24941747-24941769 CAGGTCAGCCAGGAGGCAGAGGG + Intergenic
1178108870 21:29350731-29350753 GAGGGGAGCAAAGAGGTTGAGGG + Intronic
1178664387 21:34533922-34533944 AAGCCCAGCAAGGAGGCTCAGGG + Intronic
1179290582 21:40014584-40014606 GAAGGCTGCAGTGAGGCTGATGG - Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179564608 21:42239556-42239578 AAGGGCAGCAATGAGGCTCATGG - Intronic
1179566185 21:42250574-42250596 GAGGCCTGCAGGGAGGCTCATGG - Intronic
1179902388 21:44400914-44400936 GAGGGCTGGATGGAGGCTCAGGG + Intronic
1179913066 21:44460401-44460423 CAGTGCAGCATGGAGGCAGAGGG - Exonic
1180130993 21:45827031-45827053 GGGAGCATCAGGGAGGCTGATGG + Intronic
1180315812 22:11276919-11276941 GAGGCCACCGAGGAGTCTGAGGG - Intergenic
1180339522 22:11606556-11606578 GAGGCCACCGAGGAGTCTGAGGG + Intergenic
1180414260 22:12693915-12693937 GAGGCCACCGAGGAGCCTGAGGG + Intergenic
1180785220 22:18543429-18543451 GCAGGCAGCAAGGAAGATGAAGG + Intergenic
1181083128 22:20427030-20427052 GATAGCAGAAAGGAGCCTGATGG - Intronic
1181128802 22:20717470-20717492 GCAGGCAGCAAGGAAGATGAAGG + Intronic
1181165555 22:20981157-20981179 GAGGGGAGCCAGGTGGCTGAAGG - Exonic
1181242123 22:21482782-21482804 GCAGGCAGCAAGGAAGATGAAGG + Intergenic
1181868194 22:25876094-25876116 GAGGGTAGCAAAGGGGCTGGAGG - Intronic
1182310694 22:29403516-29403538 GAGACCAGCTAGGAGGCTGGTGG + Intronic
1182622885 22:31627475-31627497 GAGGCCAGCATGGAGCCTGGTGG - Intronic
1182690353 22:32157232-32157254 GAGACCAGCTAGGAGGCTGGTGG - Intronic
1183333904 22:37235899-37235921 GAGGCCAGGCAGGGGGCTGAGGG + Intronic
1183511196 22:38236054-38236076 GAGGGCAGCAACCAGCGTGAGGG + Intronic
1183646738 22:39131533-39131555 CAGGGCAGCCAGGTGGCTCATGG - Exonic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1183958715 22:41398012-41398034 GAGGGCACCAAACAGGCAGAGGG - Exonic
1184021083 22:41821938-41821960 GAGGGGAGCACGGAGGCTTGAGG + Intronic
1184116476 22:42425626-42425648 GAGGTCAGCAAAGATGCTGGTGG + Intronic
1184369710 22:44074709-44074731 GTGGGCAGCTGGGAAGCTGAGGG - Intronic
1184481178 22:44748304-44748326 GTGGGCAGCAAGGGTGCTGGGGG + Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1184695498 22:46136821-46136843 GAGGGCAGGAAGGTGGCCTAAGG - Intergenic
1184730305 22:46367988-46368010 GAAGGGAGCAAGGTGGATGATGG - Intronic
1184938461 22:47741989-47742011 GAGAGCAGCAGAGTGGCTGAGGG - Intergenic
1185088275 22:48752445-48752467 GTGGGCAGCAAGGAGGCTCTGGG - Intronic
1185131398 22:49041115-49041137 GAGGGCTGCAAGGAGGCACTTGG + Intergenic
1185205608 22:49536104-49536126 GAAGGCTACAAGGAGGCTAAGGG + Intronic
1185340077 22:50287232-50287254 CAGGGCAGGGAGGGGGCTGACGG + Exonic
1185404981 22:50642575-50642597 GAGGGCCTCAAGGTGGTTGATGG - Intergenic
950197143 3:11017221-11017243 AACGGCAGCAAGGTGGCCGACGG + Exonic
952156007 3:30644303-30644325 GAGGGCAGCACAGAGGATGTGGG - Intronic
952830070 3:37557310-37557332 GAAGTCACCAAGGAGGCTGGTGG - Intronic
952969691 3:38643179-38643201 GTGGGGTACAAGGAGGCTGAGGG - Intronic
953000978 3:38932646-38932668 CAAGGCAGCAGGGAGGCTGGGGG + Intronic
953010292 3:39018938-39018960 GAGGGCAGCTTGAAGGCTAAAGG - Intergenic
953044224 3:39280992-39281014 GTGGGCAGCAAGGGGCCAGAGGG - Intronic
953670418 3:44957641-44957663 GAGGACAGGAAGGAGGCAGAGGG - Intronic
953810674 3:46109720-46109742 GTGGGCAGCAAGAAGCCTGCTGG - Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
953904376 3:46861149-46861171 GAGGGGGGCAAGGAGGCAGGAGG - Intronic
954100630 3:48369892-48369914 AAGGGCAGTCAGGAGGCAGAAGG + Intergenic
954154493 3:48677915-48677937 GAGGGCATCAGGGAGGCAGTGGG - Intronic
954172934 3:48819792-48819814 GAAGGCAGTGGGGAGGCTGAAGG + Intronic
954375025 3:50189547-50189569 GAGTCCAGCCAGGAGGCTCAGGG + Intergenic
954689805 3:52389652-52389674 CAGGGTAGGAAGGAGGCAGAAGG - Intronic
955000989 3:54927922-54927944 GAGGTCAGCAAGGACGCCCAAGG - Exonic
956129358 3:66039271-66039293 GAGGGCGGTTAGGAGGCTTAGGG - Intergenic
956368717 3:68534830-68534852 GAGGGCAGAGAGCAGCCTGAAGG + Intronic
956465594 3:69517748-69517770 GAAGGCAGTAAGGAGGCTCAAGG - Intronic
957417821 3:79929220-79929242 GAGCACAGGAAGGAGGCTGAGGG + Intergenic
957462819 3:80544225-80544247 AAGGGCAGCCAGGATGATGAAGG - Intergenic
957509517 3:81169436-81169458 AAGGGCAGTTTGGAGGCTGAAGG + Intergenic
958488772 3:94745882-94745904 CAAGGCAGCAACGAGGCTGGGGG + Intergenic
958696273 3:97531355-97531377 CAGGGCAGCAAGGAGACAGAAGG - Intronic
958835539 3:99140763-99140785 GAAGGCAGCAGCGAGGCTGGGGG - Intergenic
959504690 3:107144502-107144524 CAAGGCAGCAATGAGGCTGGGGG + Intergenic
959977926 3:112482956-112482978 AAGGGAAGTTAGGAGGCTGAGGG - Intronic
960618797 3:119619940-119619962 GAGTGCAGAAAGGAGGCAGCCGG - Intronic
960995057 3:123335247-123335269 CAGGGCAGTCAGGAGGCCGAGGG - Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961451345 3:127003682-127003704 GGAGGCAGCAATGAGGCTGTGGG - Intronic
961656854 3:128447407-128447429 GAAGGAAGTGAGGAGGCTGATGG - Intergenic
961845241 3:129757342-129757364 GAGTGCAGAAAGGTTGCTGAGGG - Intronic
962406663 3:135106468-135106490 AAGGCCAGCCAGGAAGCTGAAGG + Exonic
962749670 3:138424592-138424614 AAGAACAGCCAGGAGGCTGAGGG + Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963769827 3:149378573-149378595 GAGGGAAGGAAGGAGGGAGAGGG + Intergenic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
964647357 3:158972577-158972599 TAGGGAATCATGGAGGCTGAGGG + Intronic
964758912 3:160115086-160115108 GAGAGCACCAAGGAGGCTCCTGG + Intergenic
965445607 3:168770039-168770061 CAAGGCAGCAGGGAGGCTGGGGG - Intergenic
966174030 3:177115810-177115832 TATGTTAGCAAGGAGGCTGAAGG - Intronic
966484158 3:180448887-180448909 GAAGGCAGCAGTGAGGCTGGGGG + Intergenic
967232501 3:187353541-187353563 GTGGGGAGCAGGGAGGCTAATGG + Intergenic
967821850 3:193845997-193846019 CAGGGCAGCAAGGATGGTGGTGG - Intergenic
967894203 3:194383684-194383706 GAGGGCAGTAGGGATGCTCACGG + Intergenic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968603199 4:1520134-1520156 GCGGAGAGGAAGGAGGCTGAGGG - Intergenic
968622911 4:1611710-1611732 GGGGCCAGCATGGAGGGTGAGGG + Intergenic
968663663 4:1809506-1809528 GAGGACAGCAAAGAGGGTGGTGG - Intergenic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969247614 4:5945684-5945706 GATGGCAACAAGGAGGTTGATGG - Intronic
969315912 4:6381214-6381236 GGAGGCAGCAGGGAGCCTGAGGG + Intronic
969700236 4:8764013-8764035 CAGAGCAGCAAGGAGGCCGTGGG + Intergenic
970418816 4:15885341-15885363 GAGGGCAGGAAGGAAGAAGATGG - Intergenic
970972147 4:21997057-21997079 CAAGGCAGCAATGAGGCTGGGGG + Intergenic
971256027 4:25014180-25014202 GAGTGCAGTAGGGAGGCTAATGG - Intronic
971262497 4:25069839-25069861 GAGGGCAGAAAGGAAGCCCAGGG + Intergenic
971263412 4:25077016-25077038 GAGGGCTGGAAGGAGGTTGGGGG - Intergenic
971823991 4:31597487-31597509 GAGGTCAGCAAGGAAACAGAAGG - Intergenic
971869436 4:32216376-32216398 GAGCACAGGACGGAGGCTGAAGG - Intergenic
972804826 4:42518478-42518500 GAGGGCAAGGTGGAGGCTGAGGG + Intronic
973326749 4:48870297-48870319 GAAGGCAGCAGTGAGGCTGGGGG - Intergenic
973566267 4:52190926-52190948 GAGGCCAGAAATGAGACTGAAGG - Intergenic
974228440 4:59079258-59079280 CAAGGCAGCAACGAGGCTGGGGG + Intergenic
975729851 4:77327329-77327351 CAAGGCAGCAATGAGGCTGGGGG - Intronic
977357215 4:95962054-95962076 GAGGGCAGGAAGAAGGTAGAAGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978061410 4:104344783-104344805 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
978301468 4:107273007-107273029 GAGGCCAGTTAGGAGGCTTATGG - Intronic
978889555 4:113807627-113807649 GATTGCAGCAAGGAAGTTGATGG + Intergenic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
980189425 4:129504449-129504471 GAGGTAAGCAAAGAGGCTGCAGG + Intergenic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
981188493 4:141834037-141834059 CAAGGCAGCAGCGAGGCTGAGGG + Intergenic
981207956 4:142066752-142066774 CAAGGCAGCAGCGAGGCTGAGGG + Intronic
981822436 4:148901539-148901561 GAAGGAAGCAGGGAGGCTGTAGG - Intergenic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
982793050 4:159615123-159615145 CAAGGCAGCAATGAGGCTGGAGG - Intergenic
983057231 4:163112537-163112559 GAGGGCAGCATAAAGGCTGGAGG - Intronic
985110990 4:186546344-186546366 GAGGGGAGCAGTGAGGCCGACGG - Intronic
985446068 4:190021885-190021907 GAGGCCACCGAGGAGCCTGAGGG + Intergenic
985451314 4:190065400-190065422 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
985452304 4:190068693-190068715 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
985453289 4:190071990-190072012 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985454279 4:190075283-190075305 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985455267 4:190078576-190078598 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985456255 4:190081876-190081898 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985457239 4:190085170-190085192 GAGGCCACCGAGGAGCCTGAGGG - Intergenic
985458226 4:190088463-190088485 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985459215 4:190091763-190091785 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985463467 4:190174532-190174554 GAGGCCACCGAGGAGCCTGAGGG - Exonic
985646392 5:1086681-1086703 GAGGGCAGCAATGGTGCTCAAGG + Intronic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985680377 5:1252873-1252895 AAGGGCAGCAGGGATGCTGGGGG - Intergenic
985783194 5:1881445-1881467 GAGGGAGGCCAGGAGCCTGAAGG + Intronic
985783975 5:1884816-1884838 GAGGGGAGGAAGGAGGGTGGGGG - Intronic
985807114 5:2054037-2054059 GAGAGCAGCTGTGAGGCTGAAGG + Intergenic
985962638 5:3314358-3314380 GAGGGCTGCAAGGAGGATGAGGG - Intergenic
986244278 5:5991181-5991203 CAGGTCAGCAAAGAGACTGACGG + Intergenic
987257199 5:16168238-16168260 GAGGGCAGCAAGTAGACAGGAGG + Intronic
988266204 5:28953758-28953780 CAAGGCAGCAGGGAGGCTGGGGG - Intergenic
988607339 5:32690180-32690202 GAGGGCAGGAAGGAGGGATAAGG - Intronic
988792313 5:34620015-34620037 GAGGGCAGGGAAGAGGCTGCTGG + Intergenic
990736752 5:58872814-58872836 CAGGACAGCAATGAGGCTAATGG + Intergenic
990759440 5:59112226-59112248 AAGATCAGCAAGGAGGCTAATGG + Intronic
991015838 5:61931445-61931467 GAGGGCTGCTAGGTGGCTGATGG - Intergenic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
991617792 5:68515325-68515347 GATGGCAGCAAGGATGGTGGTGG - Intergenic
992088044 5:73295776-73295798 AAGGACAGCAATGTGGCTGACGG + Intergenic
992485378 5:77189643-77189665 TGGTGCAGCAAGGAGGCTGCTGG + Intergenic
992700208 5:79334320-79334342 GAGGGCAGCCAGGAGTCTCACGG - Intergenic
994300483 5:98141227-98141249 GAGGGCAACAAGGAGGGTAGTGG - Intergenic
995061148 5:107812945-107812967 GAAGGGATCAAGCAGGCTGAGGG + Intergenic
995205361 5:109473549-109473571 GAGGGAAGCAAGGAGAGAGAGGG - Intergenic
996082299 5:119269207-119269229 GAGGGAAGGAATGAGGCTCACGG - Intronic
996548565 5:124706916-124706938 AGGGGGAGCAGGGAGGCTGAAGG + Intronic
997601517 5:135141761-135141783 GAGGGCACCTGGGATGCTGAGGG + Intronic
997819355 5:137050232-137050254 CAAGGCAGCAACGAGGCTGGGGG - Intronic
998488611 5:142526036-142526058 GATGGGAGAAAGGAGGCTGGTGG + Intergenic
998621213 5:143796195-143796217 GAGGGCAGCAGGGAGGGAGGAGG - Intergenic
999182940 5:149682834-149682856 CAGAGCAGGAGGGAGGCTGAGGG + Intergenic
999231488 5:150064744-150064766 GAGGGGATCAAGGAGGATGGAGG + Intronic
999281873 5:150371447-150371469 CAGGGCCGCAAGGGGTCTGATGG + Intronic
1000390162 5:160715206-160715228 CAAGGCAGCAACGAGGCTGGGGG - Intronic
1001089402 5:168726378-168726400 GAGGGAGGCAGGGAGGCAGAGGG + Intronic
1001089408 5:168726396-168726418 GAGGGAGGCAGGGAGGCAGAGGG + Intronic
1001432102 5:171670514-171670536 GAGGGAAGAATGAAGGCTGAGGG - Intergenic
1001629692 5:173165478-173165500 AAGGGCAGTGTGGAGGCTGAAGG + Intergenic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001924315 5:175625326-175625348 GTGAGCAGCAAGGACGCTGTTGG - Intergenic
1001928298 5:175655374-175655396 GAGAGCAGCACTGAGGCTAATGG - Intergenic
1001997558 5:176174480-176174502 GAGGGCTCCATGGAGGCTGGGGG + Intergenic
1002028912 5:176414063-176414085 GAGGGCAGCCAGATGCCTGAGGG - Intronic
1002050011 5:176565372-176565394 GAGGGCAGGAAGGAGGAAGCAGG - Exonic
1002065532 5:176649923-176649945 GAGGGCAGAAGGGAGGGTGGGGG - Intronic
1002168610 5:177362951-177362973 GAGGGCAGGACAGAGGCTCAGGG + Intronic
1002168934 5:177364519-177364541 GAGGGCAGGACAGAGGCTCAGGG - Intronic
1002169764 5:177368396-177368418 GAGACAAGTAAGGAGGCTGAAGG - Intronic
1002553829 5:180018838-180018860 GAGGGAAGCCAAGAGGGTGAGGG - Intronic
1003116852 6:3289081-3289103 GAGGTCACCAAGGTGGCGGAGGG - Intronic
1004148782 6:13094643-13094665 GAGCCCAGGAACGAGGCTGAAGG + Intronic
1004330586 6:14717046-14717068 GACAGCAGCAAGTAGGCAGAAGG + Intergenic
1004765231 6:18719361-18719383 AAGGGCAGCAAATAGGGTGAGGG - Intergenic
1005109864 6:22268881-22268903 GAGGTGAGCCAGGAGGGTGAGGG + Intergenic
1006367574 6:33624586-33624608 GAGTTCAGAAAGGAGGCAGAAGG - Intronic
1006375622 6:33670269-33670291 GATGGCAGCCGGGAGGCTGCTGG - Intronic
1006386176 6:33732270-33732292 GATGGCATCAGGGAGGATGATGG - Intronic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1006796499 6:36735617-36735639 CAGGGCAGCAACGTGCCTGAGGG - Intergenic
1007227000 6:40322020-40322042 GATGGAAGCGGGGAGGCTGAAGG + Intergenic
1007974404 6:46085960-46085982 GAAGGCAGCAGCGAGGCTGGGGG - Intergenic
1008249715 6:49225211-49225233 GAGGCTAGCAAGGGGGCTGTGGG - Intergenic
1008798779 6:55340953-55340975 CAAGGCAGCAGCGAGGCTGAGGG + Intronic
1009684273 6:66936336-66936358 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
1009820186 6:68790241-68790263 CAAGGCAGCAGGGAGGCTGGGGG + Intronic
1013122677 6:107155073-107155095 GATGGCAGTAAGAAGGCGGAGGG + Intronic
1013883091 6:114928925-114928947 TAAGGCAGCAGTGAGGCTGAGGG - Intergenic
1014154959 6:118099620-118099642 CAGAGCAACAAGGGGGCTGAAGG + Intronic
1014547644 6:122751864-122751886 GAGGAAAGCAAGGAGGGAGATGG - Intergenic
1016386221 6:143533262-143533284 GAGGGTAACAAGGAAGCAGAGGG + Intergenic
1016924911 6:149335018-149335040 GAGGGAAGGAGGGAGGCGGAAGG - Intronic
1016986440 6:149899163-149899185 AAGACCAGCAAGGAGGCCGAGGG - Intergenic
1017017437 6:150113206-150113228 GGGGGAAGAAAGGAGGCTGGGGG - Intergenic
1017627344 6:156361665-156361687 CAAGGCAGCAACGAGGCTGGGGG + Intergenic
1017643450 6:156516631-156516653 GAGGGCACCAAGGTGGGAGAGGG - Intergenic
1017687479 6:156928009-156928031 GAGGACAGTAAGGAGGAGGAAGG + Intronic
1017711023 6:157168114-157168136 GAGGCCAGAAAGGAGGTGGAAGG - Intronic
1018170987 6:161142856-161142878 AAGGGCAGCAGGGAGCCTCAAGG - Intronic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018350632 6:162955705-162955727 TTTGGCAGAAAGGAGGCTGAAGG + Intronic
1018735491 6:166684634-166684656 GAGGGCAGAGAGCAGGGTGAAGG - Intronic
1018759971 6:166885198-166885220 CAAGGCAGCAGGGAGGCTGGGGG + Intronic
1018910997 6:168101017-168101039 GAGGGCAGACAGGAGGCTAGGGG + Intergenic
1019338598 7:496706-496728 CAGGGCAGCCTGGAGGCTGGAGG - Intergenic
1019446117 7:1072187-1072209 GTGGGCAGCCAGGATGCTTACGG - Intronic
1019710437 7:2515955-2515977 GGTGGCAGGAAGGAGGGTGATGG - Intronic
1019757966 7:2787446-2787468 GAGTGCAGCAGGGAGGCTGACGG - Intronic
1019881239 7:3863122-3863144 GAGGACAGGAACCAGGCTGAGGG - Intronic
1020065229 7:5183259-5183281 GAGAGCAGGAAGGATGCTCAGGG - Intergenic
1021313360 7:19117861-19117883 GAGGGCGGCTAGGAGGCGGGTGG - Intergenic
1021999880 7:26216431-26216453 GAGTCCAGCTAGGAGCCTGAGGG - Intergenic
1022101191 7:27170004-27170026 GCGGGCAGCTAGGAGGGAGAGGG - Intronic
1022494637 7:30845116-30845138 GAGGCCAGGAGGAAGGCTGAGGG + Intronic
1022523540 7:31022925-31022947 GGTGGGATCAAGGAGGCTGAGGG + Intergenic
1022923113 7:35036500-35036522 AAGGGCAGCAGGGAGGATTAAGG + Intronic
1022977785 7:35574909-35574931 GAGTGTGGCAGGGAGGCTGAGGG - Intergenic
1023221898 7:37928103-37928125 CAGGAGAGTAAGGAGGCTGATGG + Intronic
1023394561 7:39740725-39740747 GAGGGCACAAAGGAGGCTTAAGG - Intergenic
1023595821 7:41828593-41828615 GAGGGCATCAAGGATTCTGGAGG - Intergenic
1023759431 7:43450222-43450244 GAGGGGAGCCAAGGGGCTGAGGG - Intronic
1023965320 7:44960989-44961011 GAGGGGCTCAAGGAGGCTGAGGG + Intergenic
1023965621 7:44961908-44961930 GAGGGGCTGAAGGAGGCTGAGGG + Intergenic
1024027522 7:45425325-45425347 GAGCTCAGCTAGGAGGTTGAGGG + Intergenic
1024238991 7:47419450-47419472 AAGGGCAGCTAGGAGGTTAAAGG - Intronic
1024374123 7:48618567-48618589 CAGGTCAGCCAGGAGGCAGAGGG + Intronic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1026286603 7:68969014-68969036 CATGGCTGCAAGGAGGCTCATGG + Intergenic
1026927533 7:74204446-74204468 GAGGGAAGGAAGGAGGGAGAGGG + Intronic
1027233959 7:76287015-76287037 GAGGGGAGGAAAGAGACTGAGGG + Exonic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1027728244 7:81834949-81834971 GTGAGCAGCATGGAGGTTGATGG - Intergenic
1028052308 7:86203035-86203057 GAGCACAAGAAGGAGGCTGAGGG - Intergenic
1028053132 7:86208938-86208960 CAGCACAGGAAGGAGGCTGAGGG - Intergenic
1028163167 7:87508789-87508811 GAGAGCTGCAAGGAGGAAGAAGG + Intronic
1028364624 7:90013018-90013040 GGGAGCAGCAAGGGGGCTGCAGG + Intergenic
1028418892 7:90610440-90610462 GAGGGTCGCAAGAAGGCTTAGGG - Intronic
1028677387 7:93481336-93481358 GGGGGCAGCCAGGAAGTTGAAGG + Intronic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029706335 7:102278218-102278240 GAGGGCAGCTAGCAGGCAGGTGG - Intronic
1029806726 7:103005328-103005350 GAGGTAAGAAAGAAGGCTGAAGG + Intronic
1030089330 7:105843514-105843536 AGGGGCAGCAAAGTGGCTGAAGG + Intronic
1030466106 7:109905842-109905864 CAGGGCGGCAGGGAGGCTGGGGG + Intergenic
1031136260 7:117887503-117887525 GAGGGTAACAGGGAGGTTGAAGG - Intergenic
1032498957 7:132385347-132385369 GAGGGGAATAAGGAGGCTTATGG - Intronic
1032761509 7:134947530-134947552 GTGGACACCAAGGAGGCTGAGGG + Exonic
1033288234 7:140060796-140060818 GAGGCCTGAAAAGAGGCTGAGGG - Intronic
1034413292 7:150952400-150952422 GGGGTCAGCAAGGAGGCAGGTGG - Intronic
1034515974 7:151579834-151579856 AAGGGTAACAAGCAGGCTGACGG + Intronic
1034966032 7:155391598-155391620 CTGGGCAGCAAGGAGGCTCACGG - Intronic
1035247390 7:157572683-157572705 GAGGGCACCACGGGAGCTGAAGG + Intronic
1035299247 7:157886723-157886745 GTAAGCAGCAAGCAGGCTGATGG + Intronic
1035323566 7:158050568-158050590 GAGGGAAGCCGGGAGGCTGTGGG - Intronic
1035763207 8:2085202-2085224 GTGGGCTGCAGCGAGGCTGATGG + Intronic
1036234826 8:7029460-7029482 AATGGCAGCGAGGAGGGTGAGGG + Intergenic
1037999507 8:23379647-23379669 GGAGGCAGCAAGGCGGCTGGGGG - Intronic
1039045541 8:33446010-33446032 GAGGACAGGAAGGAGAATGAAGG - Intronic
1039429499 8:37514860-37514882 GGGGGCAGCAAGTGGGCTGTTGG - Intergenic
1039845262 8:41321438-41321460 GAGGGCAGCCTGGAGGCTAGGGG - Intergenic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1039990612 8:42484755-42484777 GAGGGCAGCCAGGCAGCTAAAGG + Intronic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1040926503 8:52689421-52689443 GAAGGCAGCATGGAGGTTGACGG - Intronic
1041104045 8:54424521-54424543 GCTGCCAGCAAGGAGGGTGAGGG - Intergenic
1041460155 8:58102679-58102701 GAAGGGAGAATGGAGGCTGAGGG - Intronic
1043411670 8:80003916-80003938 CAAGGCAGCAACGAGGCTGGGGG + Intronic
1043602036 8:81952521-81952543 GAGGGAAGAAGGGAGGATGATGG - Intergenic
1043737789 8:83768989-83769011 GAGCACAGGAAGGAGGCCGAGGG - Intergenic
1044060068 8:87625220-87625242 CAAGGCAGCAGGGAGGCTGGGGG + Intergenic
1044143675 8:88686119-88686141 CAGGGCGGCAACGAGGCTGGGGG + Intergenic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1045308030 8:100975553-100975575 AAAGGCAGCAAAGAGGCTGGAGG + Intergenic
1046879493 8:119292449-119292471 CAAGGCAGCAGGGAGGCTGGGGG + Intergenic
1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG + Intergenic
1047683733 8:127282171-127282193 ATGGGCAGCAAGGAGGCAGGAGG + Intergenic
1048010155 8:130448867-130448889 GTGGGCAGGAGGGAGGCAGAGGG + Intergenic
1048267867 8:133003744-133003766 GGGGGCAGCAAAGAGGCAGGAGG - Intronic
1048317914 8:133375563-133375585 GAGGGCAGTGGGAAGGCTGAAGG + Intergenic
1048337355 8:133512965-133512987 GAGGGGAGGAAGGGGCCTGATGG + Intronic
1048579485 8:135719361-135719383 GAGGATGGCATGGAGGCTGAGGG + Intergenic
1048783466 8:138025909-138025931 GAGTGCTGCAAGGAGCCTGTGGG - Intergenic
1049163481 8:141112252-141112274 GAGGACAGAGCGGAGGCTGAGGG + Intergenic
1049196068 8:141316329-141316351 AACTGCAGCAAGGTGGCTGAGGG - Intergenic
1049641767 8:143719182-143719204 GAGGGCAGCAGGGAGGTGGAGGG - Intronic
1049841284 8:144774410-144774432 GAGAGCAGCAGGGAGTCTGGGGG - Exonic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1053159208 9:35801895-35801917 AAGGGCAACATGGAGGCGGAAGG - Intronic
1053275902 9:36783173-36783195 AAGGGCAGCAGGGAGCCTGAAGG - Intergenic
1053886216 9:42646479-42646501 GTGGGCACCACGGAGGCTCAGGG + Intergenic
1054225236 9:62453928-62453950 GTGGGCACCACGGAGGCTCAGGG + Intergenic
1054728294 9:68674861-68674883 GAAGGAAGGAAGGAGGCTCAAGG - Intergenic
1055102250 9:72478179-72478201 GAGAGCAGCAGGAAAGCTGAGGG - Intergenic
1055508139 9:76968933-76968955 GAGGGCAGGAAGCTGGGTGATGG - Intergenic
1056040808 9:82664752-82664774 GAGGGCAGAAAAGAGACAGAGGG + Intergenic
1056318557 9:85415191-85415213 GGGGGCAGCACGGAAGCTGAAGG + Intergenic
1056839693 9:89988379-89988401 GAAGGGAGCAGGGAGGTTGAGGG - Intergenic
1057139748 9:92719212-92719234 AAGGGCCGCTATGAGGCTGAGGG - Exonic
1057518410 9:95740461-95740483 GTGGGAGGCAAGGAGGTTGAAGG + Intergenic
1057574708 9:96232933-96232955 GAAGGCTGCAAGGACGCAGAGGG + Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1058116057 9:101085413-101085435 GAGGTCAGTAAGGAAGATGAAGG + Intronic
1058945165 9:109849075-109849097 GATGGAAGCAAGGAGGGAGAAGG + Intronic
1059405705 9:114097441-114097463 GAGGGGAGGGAGGAGGGTGAGGG + Intronic
1060232831 9:121838350-121838372 GAGACCAGCGAGGAGGCTGTGGG - Intronic
1060288891 9:122281843-122281865 AGGGGCAGGAATGAGGCTGAGGG + Intronic
1060335694 9:122719561-122719583 TGGGTCAGCAAGGAGGCTGAAGG + Intergenic
1060337895 9:122743862-122743884 TGGGTCAGCAAGGAGGCTGAAGG + Intergenic
1060403225 9:123360429-123360451 GAGGGCAGCAGGGCGGAGGAGGG - Intronic
1060719358 9:125964919-125964941 GGGGGCAGCATGGCGGCAGAGGG + Intronic
1060879648 9:127109059-127109081 GAGTTCAGCAAGGGGGCTGCGGG - Intronic
1061091434 9:128428664-128428686 GGGGGCAGGAATGAGGCTGGGGG + Intronic
1061133381 9:128720527-128720549 GCGGGCAGTGAGGAGGCTGTGGG - Exonic
1061499044 9:130991794-130991816 GAGGGCAGAAAGCAGGCAGAAGG - Intergenic
1061677149 9:132223916-132223938 GAGGTCTGCAATGAGGCTGGGGG - Intronic
1061728905 9:132598051-132598073 GTGGTCAGCAAGCAGGCAGAGGG + Intronic
1061754581 9:132803765-132803787 GGGGGCAGCATGCAGCCTGAAGG - Intronic
1062036824 9:134386190-134386212 GCGGGCAGGAAGGGGCCTGAGGG - Intronic
1062147409 9:134997287-134997309 CAGGGCAGTGTGGAGGCTGAGGG + Intergenic
1062174143 9:135151645-135151667 GAGGGCGGCCTGGAGGCTGGGGG - Intergenic
1062191345 9:135249443-135249465 GGTGGCAGCAAGGAGGGCGAGGG - Intergenic
1062413909 9:136438631-136438653 GATGGGCGCCAGGAGGCTGAAGG + Exonic
1062469637 9:136696878-136696900 GAGGGCAGGGAGGAGGGGGAGGG - Intergenic
1062534107 9:137014080-137014102 GAGGGCAGCCAGTAGGGAGAGGG - Intronic
1203740095 Un_GL000216v2:171221-171243 GAGGCCACCAAGGAGCCTGAGGG - Intergenic
1203444979 Un_GL000219v1:45872-45894 GAGGCCACCGAGGAGTCTGAGGG + Intergenic
1203364107 Un_KI270442v1:242874-242896 GAGGCCACCGAGGAGTCTGAGGG - Intergenic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1186402611 X:9273665-9273687 GAAGGCAGGAAGGAGGAAGAAGG + Intergenic
1187175067 X:16888806-16888828 GAGGTCAGCAAGGTGGGTGTGGG + Intergenic
1187216532 X:17282417-17282439 GAAGGCAGCAAGCAGGGTGGCGG - Intergenic
1187309723 X:18130219-18130241 GAGGCCATCATGGAAGCTGATGG + Intergenic
1187480291 X:19648869-19648891 GAGGGAAGCTGGAAGGCTGACGG - Intronic
1188350590 X:29125908-29125930 GAGTCAAGCAAGGTGGCTGAGGG + Intronic
1188890143 X:35600403-35600425 GAAGGCAGAAAGAAGGCTTAAGG + Intergenic
1189148965 X:38685043-38685065 GAGGCCAGACAGGAGGGTGAGGG - Intronic
1189847508 X:45150648-45150670 GAGTGCAGCAGGGATGCTAACGG + Exonic
1190282389 X:48939637-48939659 GAGGCCAGGAAGGAGGTTGGTGG - Intronic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1190708813 X:53050760-53050782 GAGGGCAGCAAGTGGGCAAATGG + Intronic
1191072944 X:56421346-56421368 AAGGGCAGCAGTGAGGCTGGGGG - Intergenic
1191250664 X:58258671-58258693 AAAAGCAGCAACGAGGCTGAGGG + Intergenic
1192162267 X:68797321-68797343 GAGGGCACCAAGTGGGCTGGAGG + Intergenic
1192231378 X:69267468-69267490 GAGGGCAGCAAGGAAGGGCAAGG + Intergenic
1192315209 X:70045852-70045874 GAGGGCAGCAAGCAGGGCCAGGG + Intronic
1192352526 X:70368960-70368982 CAAGGCAGCAATGAGGCTGTGGG - Intronic
1193052392 X:77115238-77115260 AAGGGCATCAAGCAGGCTGTTGG - Intergenic
1193819416 X:86144083-86144105 GAGGGGAGAAGGGAGGCGGAGGG + Intergenic
1194986550 X:100495867-100495889 GGGCAAAGCAAGGAGGCTGAGGG + Intergenic
1195136442 X:101911685-101911707 GAGGGGAGCAAGCTGGCTGAAGG - Intronic
1195147481 X:102031862-102031884 CAAGGCAGCATGGAGGCTGGGGG + Intergenic
1196031897 X:111100787-111100809 GAATGCAGCAAGGTGGCTGGGGG + Intronic
1197817967 X:130517789-130517811 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1197984131 X:132249738-132249760 CAAGGCAGCAATGAGGCTGGGGG - Intergenic
1198615675 X:138456260-138456282 CAAGGCAGCAGGGAGGCTGGGGG + Intergenic
1199086245 X:143633800-143633822 GCGGGCGGCGAGGAGGCTGGAGG + Intronic
1199721215 X:150543863-150543885 GAGTGAAGCACGGAGGTTGAGGG + Intergenic
1200153016 X:153960435-153960457 GAGGTCAGCAAGGAGGATGGAGG + Intronic
1200168879 X:154057588-154057610 GAGGGCAACACTGAGGCTCAAGG + Intronic
1200848617 Y:7859099-7859121 GAGGGCAGCATCCAGGCAGAAGG + Intergenic
1200897338 Y:8389693-8389715 GTGGGCAGAAACCAGGCTGAGGG + Intergenic
1201177039 Y:11315679-11315701 GAGGCCACCGAGGAGACTGAGGG - Intergenic
1201180039 Y:11334108-11334130 GGGGGCAGCTGGGAGGCTGCAGG - Intergenic
1201690783 Y:16762470-16762492 CAAGGCAGCAGTGAGGCTGAGGG + Intergenic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic
1201953005 Y:19586167-19586189 CAAGGCAGCAGGGAGGCTGGGGG - Intergenic
1201969855 Y:19780078-19780100 GAAGGCAGCAGCAAGGCTGAGGG + Intergenic
1202268364 Y:23044606-23044628 GAGAGCAGCATGCAGGCAGAAGG - Intergenic
1202379249 Y:24261451-24261473 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1202421356 Y:24678350-24678372 GAGAGCAGCATGCAGGCAGAAGG - Intergenic
1202449430 Y:24991732-24991754 GAGAGCAGCATGCAGGCAGAAGG + Intergenic
1202491533 Y:25408670-25408692 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic