ID: 953885548

View in Genome Browser
Species Human (GRCh38)
Location 3:46712692-46712714
Sequence CTGTTGGAGGTGAGAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953885548 Original CRISPR CTGTTGGAGGTGAGAGGAGT GGG (reversed) Intronic
900266314 1:1759067-1759089 CTGTTGGCGGGGAGAGCAGGGGG - Intronic
900607397 1:3529990-3530012 CTTTTGGGGGAGAGAGGAGAAGG - Intronic
902668882 1:17958257-17958279 CCCTTGGGGGAGAGAGGAGTTGG + Intergenic
902969023 1:20033297-20033319 GTGTTGGAAGTGGGAGGAGAGGG + Intronic
903500568 1:23798103-23798125 CTTCTGGAGGTGAGAGGCATGGG - Exonic
904089151 1:27932412-27932434 CTGTTTGAGCTGAGAGCTGTGGG - Intergenic
904316445 1:29669197-29669219 CTGTTAGAGCTGAGTGAAGTTGG - Intergenic
904377660 1:30091907-30091929 CAGTGGGAGGTGGCAGGAGTGGG + Intergenic
906542677 1:46599973-46599995 TTGTGGGAGGGGAGAGGAGTTGG - Intronic
907497560 1:54854942-54854964 CTGTTGGAGGTGGGCAGAGCTGG - Intronic
908149435 1:61284785-61284807 GGGTTGGAGGTGGGGGGAGTGGG - Intronic
909269149 1:73600815-73600837 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
909613881 1:77584347-77584369 CTGGTGGAGGTGGAAGAAGTTGG + Intronic
909780515 1:79540959-79540981 CTGTTGGGGGTGGGGGGAGGGGG - Intergenic
909905795 1:81193083-81193105 CTGTAGGAGGTCAGAGGTGGAGG + Intergenic
909962966 1:81871081-81871103 CTGTTGGGGGTGGGGGGAGGGGG - Intronic
911064791 1:93778627-93778649 CAGTAGGAGGTGTGAGTAGTGGG - Intronic
911744921 1:101430896-101430918 ATGTTGGAGGTGTGGGGAGAGGG - Intergenic
912758056 1:112341279-112341301 CTGTTGTGGGTGGGAGGAGGGGG + Intergenic
913331235 1:117669760-117669782 CTGTTGGAGGTGAGAGACCAGGG + Intergenic
913354045 1:117898623-117898645 CTGTTGTAGGTTGGAGCAGTAGG - Intronic
913705930 1:121423133-121423155 CTGGTGGTGGTGAGAGGATATGG - Intergenic
915468421 1:156111855-156111877 CTGCTGGAGGTGAGAGGTGATGG - Intronic
916376558 1:164160555-164160577 CTGTTGGAGGAGAGGGGGTTTGG - Intergenic
916829287 1:168474615-168474637 CTGGTGGAGCTGTGAGGAGAGGG + Intergenic
917165454 1:172107314-172107336 CTGTTGGGAGTGAGGGGAGTAGG + Intronic
917351966 1:174087757-174087779 CTGTTGAGGGTGGGAGGAGAAGG - Intergenic
917477230 1:175379206-175379228 CTGGAGGAGGTGTGAAGAGTGGG + Intronic
918549526 1:185725712-185725734 CTATGGGAGGTAAGGGGAGTTGG + Intergenic
919168253 1:193921844-193921866 CTGTTGGAGGTAAGACTGGTGGG + Intergenic
919792139 1:201298916-201298938 CTGTTACAGATGAGAGGACTGGG + Intronic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
921029425 1:211324781-211324803 TAGTTGGTGGGGAGAGGAGTAGG + Intergenic
921476147 1:215612975-215612997 CTGTTGGGGGTGAGCGGGGCCGG + Intronic
922132495 1:222794115-222794137 TTGTTGGAGGTAAGAGGAAAAGG - Intergenic
922562631 1:226580198-226580220 CTGGTGCAGGTGATGGGAGTGGG + Intronic
923051859 1:230395338-230395360 GTGTTGGGAGTGAGAGGAGCTGG - Intronic
923420798 1:233813015-233813037 CTGTCTGAGGTGAGATAAGTAGG - Intergenic
923687564 1:236163940-236163962 GTGTGGGAGGTGGGAGGAGATGG - Intronic
923844409 1:237712979-237713001 CTTTTGGAGGTCAGTGGAGTGGG - Intronic
1062820404 10:530478-530500 CTTGAGGGGGTGAGAGGAGTAGG + Intronic
1063611924 10:7570064-7570086 CTTTGAGAGGTGAGAGGAGAAGG + Intronic
1063976688 10:11423400-11423422 GTGTGGGAGGTGTGAGGAATGGG - Intergenic
1064870943 10:19936239-19936261 CTGAGAGAGGTGAGATGAGTGGG - Intronic
1064932387 10:20641778-20641800 CTGATGGAGGTCAGAGGAAATGG + Intergenic
1065758133 10:28953725-28953747 CCTTTGGAGGTGAGAGGTGAGGG + Intergenic
1065855107 10:29823684-29823706 CTGATGGATGAGAGAGGAGATGG + Intergenic
1066199038 10:33128112-33128134 AGGGTGGAGGGGAGAGGAGTGGG - Intergenic
1067031947 10:42884215-42884237 CTGTTGGGAGTGTGGGGAGTGGG + Intergenic
1067095331 10:43295696-43295718 CTGTGAGGGGTGAGAGGAGGCGG - Intergenic
1067498928 10:46785192-46785214 CTGGAGCTGGTGAGAGGAGTGGG + Intergenic
1067595714 10:47555181-47555203 CTGGAGCTGGTGAGAGGAGTGGG - Intergenic
1067739173 10:48881766-48881788 CTGGTGGAGGTGTGAGGGGGAGG - Intronic
1068259265 10:54556885-54556907 GGGTTGGGGGTGGGAGGAGTAGG + Intronic
1068947068 10:62740234-62740256 AGGTTGGAGGTGAGAGGAGATGG + Intergenic
1069224751 10:65929022-65929044 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1069750770 10:70743851-70743873 CCATTGGAGGGGAGAGGAGATGG + Intronic
1071268286 10:83983784-83983806 CTGTGGGAGGTGGGAAGAGAGGG - Intergenic
1072331742 10:94360567-94360589 CAGTTGGAGGAGATAGGAGTAGG + Intronic
1072332214 10:94364782-94364804 CTGATGAAGCTGGGAGGAGTTGG - Intergenic
1072682399 10:97516788-97516810 CTGTAGGAGATGCGAGGAGATGG - Intronic
1073047806 10:100651072-100651094 CTGGTGGAGGTGGTGGGAGTGGG - Intergenic
1073047848 10:100651198-100651220 CTGGTGGAGGTGGTGGGAGTGGG - Intergenic
1074627724 10:115211758-115211780 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1075157536 10:119990304-119990326 CTGTCAGAGGTGAGAAGAGCAGG + Intergenic
1075352082 10:121733191-121733213 CAGGTGGAAGTGAGAGGAATAGG - Intergenic
1075467620 10:122663456-122663478 CTGAAGGGGGTAAGAGGAGTGGG + Intergenic
1075517174 10:123118360-123118382 CTGGTGGAGGGGAGTGGAGGAGG + Intergenic
1076584578 10:131536778-131536800 ATGTTGCAGGTGAAAGGAGGGGG + Intergenic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1077490514 11:2858849-2858871 CTGTTGTAGGGAAGAGGAGACGG + Intergenic
1077610149 11:3639022-3639044 CTGTTGCAGGGGAGAAGAGGCGG - Exonic
1077721930 11:4638299-4638321 CTGTTAGAGGCAAGATGAGTGGG + Intergenic
1078552729 11:12291483-12291505 GAGATGGAGGTGAAAGGAGTGGG - Intronic
1078754451 11:14195755-14195777 CTGTTGGTGGGGAGTGGATTTGG + Intronic
1078798297 11:14616199-14616221 CTATTGGAGGTGAGAGTTGGAGG + Intronic
1079087836 11:17460028-17460050 CTGTCAGAGGAGAGAGAAGTGGG - Intronic
1079466109 11:20732536-20732558 CTGTTGGAGGTCTGAGGATTTGG + Intronic
1080034268 11:27696005-27696027 CTTTTGCAGGGGAGAGGAGGGGG - Intronic
1081597049 11:44466631-44466653 CTGGTGAAGGTGTGAGGAGGTGG + Intergenic
1082783246 11:57302679-57302701 CTGTTGGAGGAGGAAGGAGCCGG - Exonic
1083496230 11:63056614-63056636 AGGTTGGAGGTGAGAGCATTAGG - Intergenic
1083596210 11:63919282-63919304 CTGTAGCAGGTGGGAGGGGTGGG - Intergenic
1083766297 11:64843127-64843149 CTGTGGGAGGCCAGAGGATTAGG - Intronic
1083951202 11:65957403-65957425 CTGTTAGAAGTGACAGGAGCTGG - Intronic
1084442299 11:69181559-69181581 TTGTTGGTGGAGAGAGGATTGGG + Intergenic
1085076513 11:73597369-73597391 ATGATGGAGGTGGCAGGAGTTGG - Intronic
1085313160 11:75527900-75527922 CTGATGGAGCTGAGAGAAGTTGG - Intergenic
1086104165 11:83131276-83131298 ATGCTGGGGGTGAGAGAAGTGGG + Intergenic
1086294477 11:85349558-85349580 CTGTTGGAGGGTAGAGGGCTGGG - Intronic
1087162047 11:94958669-94958691 CTTTAGGAGGTGAGAGGAGAAGG - Intergenic
1087535465 11:99439220-99439242 CTGTTGGAGGAGAGCAGAGAAGG + Intronic
1088059769 11:105632940-105632962 CTGATGGAGGTGAGAGAAAAGGG + Intronic
1088289744 11:108223107-108223129 CGGGAGGAGGCGAGAGGAGTCGG + Exonic
1088586791 11:111366764-111366786 ATGTTGGAGGTGACAGCAGAGGG + Intronic
1089135343 11:116244880-116244902 CTCTTGGAGCTGAGATGATTGGG + Intergenic
1089425535 11:118370969-118370991 CTGTTGGAGGTGGGGCTAGTGGG - Intronic
1090349882 11:126101192-126101214 CTGGTGGGGTTGAGGGGAGTTGG + Intergenic
1090960010 11:131547776-131547798 CTGTTGGAGTTGCGGGGACTAGG - Intronic
1091396502 12:156852-156874 CTGTGGCAGGTGGGAGGAGATGG + Intronic
1091798606 12:3310926-3310948 CTGCTGGAGGGGTGAGGAGGAGG + Intergenic
1092900167 12:13051774-13051796 AAGTTGGAGCTGAGAAGAGTGGG + Intronic
1094067880 12:26380774-26380796 CTGTTGGAGGGGAGATGTTTGGG - Intronic
1094487515 12:30936809-30936831 TTGTTGGAGGTGGATGGAGTTGG + Intronic
1095556625 12:43513905-43513927 CTGTTGCGGGTGAGGGGAGGGGG + Intronic
1095939130 12:47714563-47714585 CTGATGGAGGAGATGGGAGTAGG + Intronic
1096186985 12:49587880-49587902 GTGTTGGAGGGGAGATGAGGAGG - Intronic
1096289755 12:50331947-50331969 ATGTTGGAGGTGGGTGGAGTAGG - Intronic
1096553398 12:52388951-52388973 CTGGTGGAGGTGAAAGGGGAAGG + Intergenic
1096938814 12:55317763-55317785 CTGTTGTAAGTGTGATGAGTTGG + Intergenic
1097531607 12:60808722-60808744 CTGTTGGAGGTGGTGGGAGGGGG - Intergenic
1097705385 12:62863270-62863292 CTTTGGGAGGTGAGAGCAGGGGG - Intronic
1097736850 12:63191953-63191975 CTGTTGTGGGTGGGAGGAGGTGG + Intergenic
1097889220 12:64760268-64760290 CGGTGGGCGGTGAGAGGAGAGGG - Intergenic
1098145917 12:67497830-67497852 GTGGTGGAGGTGGGAGAAGTGGG - Intergenic
1098737437 12:74124629-74124651 CTGTTGGACCTAAGAGGTGTTGG - Intergenic
1099833550 12:87876841-87876863 CTGTTGGGGGGTAGGGGAGTAGG + Intergenic
1099958987 12:89378923-89378945 CTACTGGAGGTGGGAGGAGTGGG - Intergenic
1100363336 12:93897802-93897824 GGGGTGGAGGTGGGAGGAGTAGG - Intergenic
1100889020 12:99103074-99103096 CTGCTGGAGGTAGGAGGGGTAGG + Intronic
1102453114 12:113056121-113056143 CTGCTCCAGGTGAGAGGGGTGGG - Intergenic
1103077559 12:117996723-117996745 CTTATGGAGGTGAAAGGGGTTGG - Intergenic
1103743610 12:123107566-123107588 CTTGTGGAGGAGAGAGGAGAAGG + Intronic
1104726417 12:131078275-131078297 TTGCTGGAGGTGACAGGAGCTGG - Intronic
1104874903 12:132026982-132027004 CTGTTGCAGTTGTGAGGACTGGG + Intronic
1104889795 12:132134740-132134762 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104889819 12:132134810-132134832 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104889887 12:132135023-132135045 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104889955 12:132135233-132135255 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104890035 12:132135482-132135504 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1106317182 13:28604940-28604962 TTCTTGGAGGGGAGAGGAGAGGG + Intergenic
1108271890 13:48769979-48770001 CTGGTGCAGGGGTGAGGAGTGGG - Intergenic
1109276141 13:60306392-60306414 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1110072438 13:71194080-71194102 CAATTAGAGGTGATAGGAGTTGG - Intergenic
1110627274 13:77665341-77665363 CTTTAAGAGGTGAGAGGAGGGGG + Intergenic
1112245000 13:97725242-97725264 CTGTTGGAGCAGAGAAGAGCAGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112975190 13:105308973-105308995 CTGTTTCACCTGAGAGGAGTGGG + Intergenic
1113225424 13:108154066-108154088 CTGTTCTGGGTGAGAGGATTTGG + Intergenic
1113583179 13:111443356-111443378 CTGTTGGAGGTGGCAGGAGGCGG + Intergenic
1114288376 14:21267303-21267325 GTGTTGAATGTGAGAGGTGTTGG - Intronic
1114363788 14:22005147-22005169 CTGTTGTGGGTGGGAGGAGGGGG - Intergenic
1117614604 14:57520721-57520743 CTGTTGGGGGTGGGGGGAGATGG - Intergenic
1117889571 14:60404576-60404598 CTGTTGGGGGTGTGAGGAGAAGG - Intronic
1118329052 14:64801625-64801647 CTGCTGAAGGGGAGAGGAGAAGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118801523 14:69194109-69194131 CTGTTCGAGGTGACAGTATTTGG - Intronic
1118880333 14:69820121-69820143 CTGTTAGAGGTGGGAAGAGAAGG + Intergenic
1119314869 14:73684947-73684969 ATGTTGGAGGTTACAGAAGTGGG - Intronic
1119724729 14:76915024-76915046 CTGTTGGAGAGGGGAGGACTTGG - Intergenic
1119725932 14:76921952-76921974 GTGCTGGAGGAGTGAGGAGTGGG - Intergenic
1121334461 14:93069037-93069059 ATGTGGGAGGTGAGAGGGGGAGG - Intronic
1121710004 14:96030679-96030701 GGGCTGGAGGTGAGAGGAGGGGG - Intergenic
1121753630 14:96382013-96382035 CTGTTGGGGGTAAGTGGAGAAGG + Intronic
1121822908 14:96985851-96985873 CAGATGATGGTGAGAGGAGTTGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122557648 14:102590334-102590356 CTGTGGGAGGTGTAAGGAGAGGG + Intergenic
1122777759 14:104129881-104129903 CTTCTGGGGGTGAGAGGAGGAGG - Intergenic
1122976418 14:105172708-105172730 CTCTTGGAGCTGGGAGGGGTGGG - Intergenic
1123786633 15:23681336-23681358 CTGTTGGGGGTGGGGGGAGGGGG + Intergenic
1124031428 15:26015867-26015889 CTGGTGGAGGTGGGAGGCATAGG + Intergenic
1125482654 15:40091163-40091185 CTGCTGGAGGTGGCAGGAGCTGG + Exonic
1125747162 15:42004929-42004951 CTGCTGGAGGAGAGGTGAGTAGG - Exonic
1126161739 15:45620161-45620183 GTGTTGGAGGTGTGAGTGGTGGG - Intronic
1126524018 15:49630178-49630200 TTGTTGATGGTGAGAGGAGAAGG + Intronic
1127261629 15:57330950-57330972 CTTTTTGTGGTGAGAGGGGTGGG - Intergenic
1127899423 15:63330064-63330086 CTGGTGGTGGTGAGCAGAGTAGG - Intronic
1127996475 15:64155896-64155918 CTGTGGAATGTGAGGGGAGTGGG + Exonic
1128392167 15:67189658-67189680 CAGCTGGAGGTGAGAGGTGTGGG - Intronic
1128854842 15:71001313-71001335 TTGTTGGCAGTGAGAGAAGTAGG + Intronic
1129112654 15:73346777-73346799 CTGGAGGAGGTGAGAGGAGTTGG + Intronic
1129603901 15:77015528-77015550 GAGATGGAGGTAAGAGGAGTGGG + Intronic
1130284679 15:82545002-82545024 CTGTAGGAGGTGAGAAGGGCAGG - Intronic
1131139268 15:89963912-89963934 CTGTGGGAGGGCAGAGCAGTGGG - Intergenic
1131173347 15:90193747-90193769 CTGTTCTAGGTGAGTGCAGTAGG + Intronic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1132683905 16:1154310-1154332 GGCTTGGAGGGGAGAGGAGTCGG + Intronic
1133182597 16:4069169-4069191 TTGTTGGTGGTGAGAGGAAAGGG - Intronic
1134479256 16:14603418-14603440 AAGGTGGAGGAGAGAGGAGTGGG - Intronic
1135411254 16:22236296-22236318 CTGCAGGAGGGGAGAGTAGTTGG + Intronic
1135510477 16:23078573-23078595 GTGGTGGAGGTGTGAGCAGTGGG - Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136138881 16:28276158-28276180 TTGTTTGAGGAGAGAGGAGGAGG + Intergenic
1136663633 16:31789172-31789194 CAGTTGGGGGCGTGAGGAGTGGG - Intronic
1138124374 16:54426767-54426789 GTGTTGGTGGAGAGAGAAGTGGG + Intergenic
1138293852 16:55870277-55870299 ATGGAGGAGGTGAGAGGAGGAGG + Intronic
1139242559 16:65408906-65408928 ATGATGGAGGTGGGAGGTGTAGG - Intergenic
1139339297 16:66257546-66257568 GTGTTGGAGGTGGGAGGTGGTGG + Intergenic
1140673500 16:77303145-77303167 CTGGTGGAGATGAGGGGAGATGG - Intronic
1140909386 16:79437958-79437980 CTGTTTGTGGAGACAGGAGTCGG + Intergenic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1142676300 17:1515634-1515656 CTGTTGGAGGAGAGATGTTTTGG - Intronic
1142978737 17:3659602-3659624 CTGCTGGAGCTGTGAGGTGTGGG + Intronic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1146018020 17:29249212-29249234 CTGTTGGATGTGATGGGGGTGGG - Intronic
1147378262 17:40035879-40035901 GGGTTGGAGGAGAGAGGAGCAGG - Intronic
1147390443 17:40106130-40106152 CTGCTGGTGGTGAGGAGAGTGGG + Intergenic
1147391618 17:40112734-40112756 ATGTTGGAGGAAGGAGGAGTAGG - Intergenic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1147810720 17:43167950-43167972 GTGTTGAAGAGGAGAGGAGTGGG + Intergenic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1148822388 17:50367122-50367144 CTGTTGGAGGTAGGTGGTGTTGG - Intergenic
1148930482 17:51123225-51123247 TCGTTGGAGGGGAGGGGAGTAGG + Intergenic
1149340128 17:55676786-55676808 CTATTTGAGGTGACAGGACTGGG - Intergenic
1149444127 17:56700462-56700484 GGGTTGGATGTGAGAGAAGTTGG - Intergenic
1151039715 17:70844427-70844449 ATGTTGGAGGTGGGATTAGTGGG - Intergenic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1151922745 17:77169847-77169869 CTGTTGGAGTTGACAGGTGGAGG + Intronic
1151972804 17:77467512-77467534 CGGTGGGAGGGGAGTGGAGTGGG - Intronic
1152036904 17:77879320-77879342 CTGCTGGTGGGGAGAGGGGTAGG + Intergenic
1152700442 17:81815779-81815801 CTGGTGGAGTTGGGTGGAGTTGG + Intergenic
1153762907 18:8348900-8348922 GTTTTGGAGCTGAGAGAAGTGGG + Intronic
1154102929 18:11492659-11492681 CTATTGGAGGTGAGAAGATTGGG - Intergenic
1155558851 18:27052916-27052938 CTGTTGGGGGTGAGGGGAAAGGG + Intronic
1155668484 18:28340097-28340119 CTGAGGAAGGTGAGAGAAGTGGG + Intergenic
1156520429 18:37717712-37717734 CTGTAGAAGGTGGCAGGAGTGGG - Intergenic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157520046 18:48339211-48339233 CTCTTGGGGGTGAAAAGAGTAGG + Intronic
1157760039 18:50255280-50255302 ATGATGGGGGTGAGAGTAGTGGG + Intronic
1158573958 18:58620495-58620517 TGGTTGGAGGTGAGGGCAGTGGG + Intronic
1159517449 18:69476039-69476061 CTATTGGAGGTGAGAGGGGTGGG - Intronic
1160468848 18:79108074-79108096 CTGCTGTTGGTGGGAGGAGTTGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162199717 19:9011279-9011301 CTGTTAGAGGCTAGAGGGGTGGG - Intergenic
1162716913 19:12640051-12640073 CCGTCGCAGGTGAGCGGAGTAGG - Intronic
1163088777 19:15003423-15003445 CTGGTGGAGGTGTCAGGAGATGG - Intronic
1163584230 19:18155400-18155422 GTGTTGGGGGTGAGAGGAGTTGG + Intronic
1163884017 19:19950166-19950188 CTGTTGTTGGAGAGAGGAGCTGG - Intergenic
1165666005 19:37629251-37629273 CTGGTGGGGGTGAGGGGGGTAGG - Intronic
1166686661 19:44800528-44800550 CTGTAGGCGGAGAGAGGGGTGGG - Intronic
1167863971 19:52309022-52309044 CTGACAGAGGTGACAGGAGTGGG - Intronic
1168567780 19:57439236-57439258 GTGGTGGAAGTGGGAGGAGTGGG + Intronic
925411031 2:3640431-3640453 CTGTGGGATGTGACAGGGGTGGG - Intronic
925635539 2:5938267-5938289 TTGGGGGCGGTGAGAGGAGTTGG - Intergenic
925881698 2:8358083-8358105 CTCTAGGAGGGAAGAGGAGTAGG + Intergenic
926389229 2:12370496-12370518 CTGTGGGAGGAGAGAAGAGGAGG - Intergenic
926526849 2:13991955-13991977 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
927464720 2:23328602-23328624 CTGCTGGAGCTCAGAGGAGAGGG + Intergenic
928049692 2:27978097-27978119 GTGTTGGAGGTGAGCCTAGTGGG + Intronic
928103397 2:28452472-28452494 TTGATGGAGGTGAGAGGATGTGG + Intergenic
928272361 2:29867897-29867919 CAGTTGGGGATGGGAGGAGTGGG + Intronic
928408202 2:31031575-31031597 GAGTTGGAGGTGAGAGGAAGTGG - Intronic
928571641 2:32615188-32615210 GTGTTGGAGGTGAGAGAAATGGG - Intronic
929647866 2:43647839-43647861 CTGTTGCAGGAAAGAGAAGTTGG - Intronic
929938863 2:46315276-46315298 CTGATGGCCGTGAGAGGAGCAGG + Intronic
930512129 2:52358737-52358759 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
931981031 2:67694489-67694511 GTGGGGGAGGAGAGAGGAGTGGG + Intergenic
931987104 2:67752769-67752791 CTGTGGGAGCTGAGATGAGCTGG - Intergenic
932490805 2:72119040-72119062 CTGTTGGAGGAGGCAGGTGTGGG - Intergenic
933271188 2:80234668-80234690 CTGCTGCAGTTGAGAGGAGCAGG + Intronic
933331441 2:80897274-80897296 CTGTGGTAGGTGAATGGAGTAGG - Intergenic
934579624 2:95427730-95427752 CTGCTGAAGGTGGGAGGAGTAGG - Intergenic
934599821 2:95648995-95649017 CTGCTGAAGGTGGGAGGAGTAGG + Intergenic
934942111 2:98510220-98510242 ATGTGGGATGTGAGAGGAGGAGG + Intronic
935164609 2:100559824-100559846 CTGAGGGAGGTGAGAGGATCTGG + Intergenic
935443567 2:103132228-103132250 CTGTTGGAGATGAGAGGGAGTGG + Intergenic
936533166 2:113291000-113291022 CTGCTGAAGGTGGGAGGAGTAGG + Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936957388 2:118036462-118036484 CTGTTGGAGGGGTGAGGGGAGGG - Intergenic
937025409 2:118693253-118693275 GGGTTGGAGGTGGGAGGCGTGGG + Intergenic
937089796 2:119198551-119198573 CAATTGGAGGTGTGAGGAGAGGG - Intergenic
938520257 2:132063021-132063043 CTGTTGGTGGTGGGGGGAGGGGG - Intergenic
939519172 2:143207965-143207987 ATGGTGGAGGTGAGGAGAGTTGG - Intronic
939749671 2:146027575-146027597 CCATTGGGGGTGAGAGTAGTGGG - Intergenic
940855997 2:158729156-158729178 CTGGTGGAGGTGATGGGAGAGGG + Intergenic
941157604 2:161998480-161998502 CTTTTGGAGGTGAGGTGAGGTGG - Intronic
941525887 2:166606742-166606764 CAGTTGGATGTGAGGGGAGTTGG - Intergenic
942129668 2:172865728-172865750 CTGATGGAGGTAAGAGGAATGGG - Intronic
942763379 2:179426813-179426835 GTGTTGGAGGGGATGGGAGTGGG - Intergenic
943291558 2:186078636-186078658 CTGTTGTGGGTGGGGGGAGTGGG + Intergenic
943451129 2:188043730-188043752 CTGTTGGGGGTGAGGGGTGAGGG + Intergenic
943591146 2:189798358-189798380 CTGTTGGAGCATAGAGGACTAGG + Intronic
945045454 2:205777514-205777536 CTGTTTAAGTTGAGAGGAGGAGG + Intronic
945909898 2:215636443-215636465 CTGTGGAAGGTGAAATGAGTGGG - Intergenic
947097818 2:226586228-226586250 CTGTTGGAGGTGAGTGTTGTGGG - Intergenic
947327408 2:228993040-228993062 CTCTTGGGGGTGCCAGGAGTAGG - Intronic
947337233 2:229100047-229100069 ATGTTGGAGGTCAGAGAAGGAGG - Intronic
948541625 2:238695085-238695107 GTGTTGGCGGTGCGAGGAGAGGG - Intergenic
1168763886 20:368725-368747 CTGTTGGAGCAGTGAGGACTTGG + Intronic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1169074706 20:2753517-2753539 TTCTTGCAGGTGACAGGAGTGGG - Intronic
1169491582 20:6075893-6075915 TTGTTAGAGGTGGGAGGGGTGGG - Exonic
1169888442 20:10428265-10428287 TTGGTGGAGGAGAGGGGAGTAGG + Intronic
1170158225 20:13287494-13287516 GGCTTGGAGGTGAGAGGTGTGGG - Intronic
1170726209 20:18929379-18929401 CTGTTGGGGGTGGGAGGAAGGGG - Intergenic
1170944555 20:20879517-20879539 CTTTGGGAGGTGAGTGGAGCAGG + Intergenic
1171442783 20:25178858-25178880 CAGTTGGAGCTGACTGGAGTTGG - Intergenic
1172845847 20:37929672-37929694 CTGTTGCAGGTGAGAGAGGATGG + Intronic
1173150595 20:40563555-40563577 GTGCTGGAGGGGAGAGGAGATGG + Intergenic
1173401568 20:42730740-42730762 TTCTTGGAGGTGAGAGGACATGG + Intronic
1175092814 20:56518988-56519010 CTGCTGGAGGAGAGAAGGGTGGG - Intronic
1175893656 20:62326663-62326685 CTGGTGGAGGTGAGGGGAGCTGG - Exonic
1175936133 20:62514895-62514917 CTGGGAGAGGTGAGGGGAGTCGG + Intergenic
1177218015 21:18154293-18154315 CTGTTACAGGTGTGAGGAGTGGG - Intronic
1177836155 21:26188438-26188460 CTGTTTGGGGAGAGAGGATTTGG + Intergenic
1178052752 21:28766148-28766170 CTGTTGGGGGTTGGAGGACTGGG + Intergenic
1179807883 21:43851554-43851576 CTGTTGGAGGTGCAGGCAGTTGG + Intergenic
1181149045 22:20869767-20869789 CGGTTGGGGGTGAGGGGAGATGG - Intronic
1182332649 22:29561863-29561885 CTGTTGGGGGTGAGAGGTATAGG + Intronic
1182892267 22:33829090-33829112 CGGTTGAACGTGGGAGGAGTTGG - Intronic
1183424691 22:37733219-37733241 CTGTTGGAGGTGGGAGCAGAGGG + Intronic
1183777161 22:39973791-39973813 CTGTGGCTGGTGAGAGGAGCTGG - Intergenic
1183783066 22:40011080-40011102 CTGTGGAAGGAGAAAGGAGTGGG - Intronic
1184325807 22:43783416-43783438 CAGTTGGAGGTGAGAGGTTAGGG - Intronic
1184453735 22:44597624-44597646 CTGCGAGAGGTGAGAGGACTTGG - Intergenic
1184639488 22:45861814-45861836 AAGTAGGAGGTGAGAGGAGATGG - Intergenic
1185054838 22:48574233-48574255 CTCCTTTAGGTGAGAGGAGTTGG + Intronic
949202718 3:1398785-1398807 CTCTGGGAGATGAGAAGAGTTGG - Intronic
949510551 3:4763195-4763217 CTGTTGGGGGAGGCAGGAGTTGG + Intronic
949683850 3:6546213-6546235 CTTTTGGATGGGAGAGGAGATGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950800782 3:15550443-15550465 CTGGTGGAGCTGTGAGAAGTGGG + Intergenic
951401976 3:22243791-22243813 GGTTTGGAGGTGAGAGGAGATGG + Intronic
951471995 3:23066315-23066337 TTGGTGGGGGTGAGAGGAATTGG + Intergenic
951532416 3:23710181-23710203 CAGCTGGAGGTGGGAGGAGGGGG - Intergenic
951543474 3:23805552-23805574 CTTTTGGAAAGGAGAGGAGTAGG - Intergenic
952019053 3:28994930-28994952 CTGGTTGTGGGGAGAGGAGTGGG + Intergenic
952466905 3:33598488-33598510 CTGTGGAAGGTGTGAGGAATGGG - Intronic
952819506 3:37473881-37473903 TTGTCTCAGGTGAGAGGAGTTGG - Intronic
953053328 3:39366228-39366250 CTGTTGGGGGTGGGAGGTGGGGG + Intergenic
953885548 3:46712692-46712714 CTGTTGGAGGTGAGAGGAGTGGG - Intronic
953900073 3:46834932-46834954 CTCTTGGAGCTCAGAGGAGTGGG + Intergenic
954146025 3:48634758-48634780 CTGTTGGAGGAGTGTGGAGTGGG + Intronic
954397112 3:50298772-50298794 GTGTGGGAGGTGAGGGGAGGGGG - Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954713895 3:52517685-52517707 CTGCTGGAGGTGAGAAGGGCTGG - Intronic
954791482 3:53136442-53136464 CTGTTGGAGGACCCAGGAGTTGG + Intergenic
954832973 3:53438765-53438787 ATGTTGAGGATGAGAGGAGTTGG + Intergenic
955063108 3:55511353-55511375 CTGTTGTAGGGGTGAAGAGTGGG - Intronic
955153908 3:56396900-56396922 CTGTGGGAGATGAGAAAAGTGGG - Intronic
955455685 3:59118895-59118917 CTGGTGGAGATGAGGGGATTTGG - Intergenic
955748164 3:62160537-62160559 CTGTGGGATGTCAGAGGAGCCGG + Intronic
956841500 3:73144173-73144195 CTGTTTGAGGGGAGAGGACTTGG + Intergenic
957343477 3:78931022-78931044 CAATGGGAGGTGAGAGGAGCAGG - Intronic
958962309 3:100522090-100522112 CTGTTGGGGGTGGGGGTAGTGGG + Intronic
960615080 3:119589143-119589165 CTGTGGGAGGAGTGAGGAGAAGG - Exonic
960884727 3:122382975-122382997 CTGTAGGAGGAGGGAGGAGGGGG - Intronic
961512044 3:127409198-127409220 GTGGTGGAGGTGACAGGGGTAGG - Intergenic
961618437 3:128203583-128203605 CTGCTGCAGGTGACATGAGTAGG + Intronic
962008663 3:131372324-131372346 CTGAAGAAGGTGAGAGGACTGGG - Intergenic
963594431 3:147307497-147307519 CTGTTGGGGGGCAGGGGAGTAGG - Intergenic
964033665 3:152169076-152169098 GTGTTGGGGGTGAGTGGGGTGGG + Intergenic
964712617 3:159687261-159687283 GTCTTGGTGGGGAGAGGAGTGGG - Intronic
965518860 3:169652593-169652615 CAGATGGGGGTTAGAGGAGTGGG + Intronic
966875494 3:184319585-184319607 CTGTGGGTGGTGAGAGGTTTTGG + Intronic
967387461 3:188925708-188925730 GTGTGGGAGGTGGGAGGAGTGGG + Intergenic
968234671 3:197024484-197024506 CTCTAGGAGGGGAGGGGAGTGGG + Exonic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968803272 4:2756507-2756529 CTGTAGGCGGTGGGAGGGGTGGG - Intergenic
968917474 4:3502887-3502909 CTGTTGAAGATGTGAGGAGGTGG + Intergenic
968967290 4:3775580-3775602 CTGTGGGAGGTCAGGGGGGTGGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
971466408 4:26967816-26967838 CTGTTGGAGGAGGGGGGAGGGGG - Intronic
971689943 4:29820882-29820904 CTGTTGGAGGTTGGGGGAGTAGG - Intergenic
974981862 4:68967005-68967027 CTACTGGAGGTGTGAGAAGTGGG - Intergenic
975037629 4:69704316-69704338 CTTCTGGAGGAGAGTGGAGTTGG - Intergenic
975505581 4:75133269-75133291 CTGTTGCAGGTGAGGGGCGATGG - Intergenic
975847596 4:78541436-78541458 CAGATGGAGATGAGAGGACTGGG + Intronic
976178679 4:82379066-82379088 ATCTTGGAGGTGGGAGGAGTTGG - Intergenic
976386661 4:84467516-84467538 CTATAGGAGTTGAGAGCAGTAGG - Intergenic
976857482 4:89622269-89622291 CTAAAGGAGGTGAGAGGAGATGG + Intergenic
977272605 4:94936500-94936522 TTGTTGGGGGTGAGGGGAGTGGG + Intronic
978554546 4:109964883-109964905 TTGCTGGTAGTGAGAGGAGTGGG + Intronic
978999378 4:115199129-115199151 CTGGTGGAGGTGGCAGGGGTGGG + Intergenic
979813303 4:125065854-125065876 ATGTTGGTGGTGACAGCAGTGGG - Intergenic
980285940 4:130778502-130778524 CTGTTGGAGGGTAGGGGAGTAGG + Intergenic
980363322 4:131765412-131765434 CTGTTGGAGGTGGGGCGTGTTGG - Intergenic
982781082 4:159492157-159492179 GTGTTGGAGGTGTGACCAGTTGG - Intergenic
987506200 5:18776331-18776353 CTGTGAGAGGTGTGAGAAGTTGG + Intergenic
988433911 5:31150862-31150884 CTGCTGCAGGAGAGAGGTGTGGG + Intergenic
989135518 5:38150668-38150690 CTGTTGGATGCTGGAGGAGTAGG + Intergenic
989525958 5:42454188-42454210 CTGGTGGAGGTGACAGGATAGGG + Intronic
990237056 5:53779694-53779716 CTGTTGGAAGGGAGAGGAAGTGG + Intergenic
990572017 5:57088328-57088350 CTGTTGGGGGTGAGGGGGCTAGG + Intergenic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
991569354 5:68037996-68038018 CTGCTGAAGGTGTGAGGAGCAGG - Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992156568 5:73960637-73960659 CTGTTGCATGTGAGAGGAAGGGG + Intergenic
992570145 5:78046850-78046872 CTGTTGGGGGTTGGGGGAGTAGG - Intronic
993440767 5:87954281-87954303 CTGTGGCAGGGGTGAGGAGTAGG - Intergenic
997392288 5:133526887-133526909 CTTTTGGAGGTGAAGGAAGTTGG - Intronic
997761737 5:136455322-136455344 CTATTGGATGTGAGAGCATTTGG - Intergenic
997894422 5:137703477-137703499 CTGTTGCAGGTGAGTGGTCTGGG + Intronic
997935089 5:138103458-138103480 CTTTTGGAGGGGTGAGGTGTGGG - Intergenic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
999135795 5:149317932-149317954 ATCTTGGAGGTGAGAGGAGAGGG + Exonic
999980468 5:156952961-156952983 ATGTAGGAGGTGAGTGGTGTTGG - Intronic
1000108147 5:158080356-158080378 CTGTTGGAGGTGAGGGGGTGGGG - Intergenic
1000323397 5:160153314-160153336 TTGTTGGAGTTGAGTTGAGTGGG + Intergenic
1001640090 5:173237857-173237879 GTGTTGCAGGAGAGAGGAGATGG + Intergenic
1001960596 5:175878499-175878521 CTGCTGGAGGAGAAAGGAGATGG - Intronic
1002097311 5:176839166-176839188 ATGATGGAAGTGACAGGAGTGGG - Intronic
1002398563 5:178977027-178977049 CAGATGGAGGTGACAGGAGATGG + Intergenic
1002690915 5:181050065-181050087 CTGGTGGAGGCAGGAGGAGTGGG - Intronic
1003016225 6:2469508-2469530 CTGTGGGACGTGGGAGCAGTGGG + Intergenic
1004190634 6:13460659-13460681 CTGTTGGGGGTGTGGGGAGAGGG + Intronic
1005483449 6:26276599-26276621 CTGTTTCAGGGGAGAAGAGTTGG - Intergenic
1005483464 6:26276690-26276712 CTGTTTCAGGGGAGAAGAGTTGG - Intergenic
1005780192 6:29183102-29183124 ATATTGGAGGTGAAAGGAGCTGG + Intergenic
1006136152 6:31897453-31897475 GTGTGGGAGGTGGGGGGAGTGGG - Intronic
1006305463 6:33215729-33215751 CTGAGAGAGGTGAGAGCAGTGGG - Intergenic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1006693293 6:35909084-35909106 CTAGTGGAGCTGTGAGGAGTGGG + Intronic
1007236865 6:40396760-40396782 GTGTTGGCGGTAGGAGGAGTTGG + Intronic
1007259772 6:40555375-40555397 CTTGTGGAGGGGAGAGGAGGAGG - Intronic
1007370862 6:41426557-41426579 CTGGAGGAGGTCAGAGGAGAGGG + Intergenic
1007371954 6:41431953-41431975 CTGGGAGAGGTGAGAGGAGATGG + Intergenic
1008336693 6:50314671-50314693 CTGTGGGAGGAGAAAGCAGTGGG + Intergenic
1009314530 6:62201079-62201101 CTGTTTGGGGTGAGGGGAGCAGG + Intronic
1010625275 6:78131106-78131128 CTGCTTGAGGAGAGAGGAGTAGG + Intergenic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1014280719 6:119440756-119440778 TTGTTGTAGGGGAGAGGGGTGGG - Intergenic
1014847545 6:126296980-126297002 CTGTTGTAGGTGAGGGGAGAAGG - Intergenic
1014883034 6:126746404-126746426 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1015104840 6:129523609-129523631 CTGGGGGATGTGAGTGGAGTAGG + Intergenic
1018219836 6:161566774-161566796 CTGGTGGAGGGGAGGGGAGGAGG - Intronic
1018635222 6:165854614-165854636 TTGCTGGAGGTGAGGGGAGCGGG + Intronic
1018672155 6:166188123-166188145 CTGTTGGGGGTGGGGGTAGTGGG + Intergenic
1018998257 6:168726422-168726444 CTGGTGGATGGGAGAGGAGGAGG + Intergenic
1019112980 6:169732435-169732457 CTGTTGGGGGTGAGAGTGGAGGG - Intergenic
1019231881 6:170573097-170573119 CTGTTGGAGGTGAGGAGATAAGG + Intergenic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1020938702 7:14502896-14502918 GTGTTGAAGATGAGAGGAGTAGG - Intronic
1021292681 7:18865416-18865438 GTGTTGGTGGTGTGAAGAGTTGG + Intronic
1021402385 7:20224198-20224220 CTGTTGGAGCAGAGAGCAGCAGG + Intergenic
1021541147 7:21760117-21760139 CTGGTGGGGGTGGGAGGAGAAGG + Intronic
1021901847 7:25293339-25293361 CAGTTGGAGGTCATAGGAGGAGG - Intergenic
1021990614 7:26137934-26137956 TTGTTGGGGGTGGGAGGAGAAGG + Intergenic
1022230460 7:28408751-28408773 CTGGAGGAGGTGAGATGAGGGGG + Intronic
1023034629 7:36119725-36119747 TTGTTGGAGGTCAGAGTGGTGGG + Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023346716 7:39278359-39278381 GTGTTGGGGGTAAGGGGAGTTGG + Intronic
1026555893 7:71408359-71408381 CTGCTGGTGGGGAGAGGTGTTGG + Intronic
1026832038 7:73616178-73616200 CTGTCAAAGGGGAGAGGAGTAGG + Intronic
1027197470 7:76040496-76040518 CTGCTGGAAGTCAAAGGAGTTGG - Intronic
1027759344 7:82258278-82258300 CTGTCTGAGGAGAAAGGAGTAGG - Intronic
1028352936 7:89871463-89871485 CTGGTGGGGCTGAGAGGAGTGGG - Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1029226272 7:99030769-99030791 ATGTGGGAGGGGAGAGGAATGGG + Intronic
1029587659 7:101485751-101485773 GTGTTGGGGGTGGGAGCAGTGGG + Intronic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1030104410 7:105974860-105974882 CTGTAGCAGGTAAGAGGATTAGG - Exonic
1030327057 7:108230806-108230828 CAGTGGGAGGAGATAGGAGTGGG - Intronic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1032227648 7:130046140-130046162 CTGTTGGAGGTGGGAGTTGGGGG + Intronic
1032290262 7:130583341-130583363 CTGTGGGGGGTGGGGGGAGTGGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1035023207 7:155810600-155810622 CTGTCGGAAGGGAGAGGAATGGG - Intronic
1035163634 7:156969892-156969914 ATCTTGGGGGTGAGAGGAGAAGG + Exonic
1035332360 7:158104696-158104718 TTGATGGAGCTGAGTGGAGTTGG - Intronic
1035332370 7:158104750-158104772 TTGATGGAGCTGAGTGGAGTTGG - Intronic
1035332451 7:158105208-158105230 TTGATGGAGCTGAGTGGAGTTGG - Intronic
1035332462 7:158105262-158105284 TTGATGGAGCTGAGTGGAGTTGG - Intronic
1036630531 8:10511145-10511167 GTGTAGGAGGTGGGAGGAGGGGG - Intergenic
1037340205 8:17836392-17836414 CTTCTGGAGGTGGGAGGAGGGGG - Intergenic
1037492361 8:19408401-19408423 CTTTGGGAGGTTAGAGGAGGGGG - Intronic
1037583282 8:20259422-20259444 GAGATGGAGGTGAGAGGAGATGG - Intronic
1038150593 8:24939929-24939951 CTGCTGAAGGTGGGGGGAGTTGG - Intergenic
1038459877 8:27706759-27706781 GGCTTGGAGGTGGGAGGAGTCGG + Intergenic
1038512899 8:28157024-28157046 TTCTTGGAGGCGAGAGGAGATGG - Intronic
1038852225 8:31290756-31290778 CTGTTGGGGGAAAGGGGAGTTGG - Intergenic
1039005783 8:33035507-33035529 CTGATGGAGGTCAGAGGGGATGG + Intergenic
1039365761 8:36926422-36926444 CTGATGGAGGGGAGAGATGTGGG - Intronic
1039674045 8:39640179-39640201 CTGTTGGAGGTTGGAGGAGTGGG - Intronic
1040007043 8:42629497-42629519 CTGCTGGAGGGGAGGGGAGCTGG + Intergenic
1040545734 8:48396836-48396858 CCGGTGGAGGTGAGAGCAGGGGG - Intergenic
1041224667 8:55686558-55686580 CTGTTTGTGGTGGGAGGAGTGGG - Intergenic
1042679870 8:71371056-71371078 ATGTTGGGGATGGGAGGAGTTGG - Intergenic
1043492020 8:80759397-80759419 CTGTAGGAGGTGAGATCATTGGG - Intronic
1044273129 8:90270085-90270107 CTGTTGTGGGTGGGGGGAGTGGG + Intergenic
1045611481 8:103847875-103847897 CTTATGGAGGTGGGTGGAGTTGG + Intronic
1046015493 8:108599646-108599668 AAGTTGGAGGTGGGAGGAGTGGG - Intergenic
1047025362 8:120817795-120817817 CTGCTGGAGCAGAGAGGAGTGGG - Intergenic
1047416264 8:124667076-124667098 CAGGTGGAGGGGAGAGGAGATGG + Intronic
1048049670 8:130805527-130805549 CTGCTGGAGGTTGGAGAAGTGGG + Intronic
1048482216 8:134808985-134809007 CTGTTAGAGGTGACAGAAGTAGG - Intergenic
1048489294 8:134877613-134877635 GGGCTGGAGGGGAGAGGAGTAGG + Intergenic
1048509511 8:135049603-135049625 ATGTTGGAGGTGAGTCTAGTGGG - Intergenic
1048739941 8:137545333-137545355 CAGTAGGAGGTGAGAGTAGAGGG + Intergenic
1048879538 8:138861112-138861134 ATGTTGGTAGTGTGAGGAGTTGG - Intronic
1048938961 8:139380219-139380241 ATGTTGGAGCTGGGAGGAGCAGG + Intergenic
1049353801 8:142177918-142177940 CTGTTGGAGGAGGAAGGAGGAGG + Intergenic
1050310155 9:4344475-4344497 CACTTAGAGGTGAGAGGAGGAGG - Intronic
1050446616 9:5729210-5729232 CTGGTGGAGGTGGTAGGGGTGGG + Intronic
1051270562 9:15351173-15351195 CTGTTGGAGGAGAGAGGATGTGG + Intergenic
1052026441 9:23578104-23578126 CTTTTGGAGGAGAGGGGAGGTGG - Intergenic
1052501872 9:29302065-29302087 CTGTTGGGGGAGGGCGGAGTGGG + Intergenic
1052538011 9:29772724-29772746 CATCTGGAGGTGAGAGGAATAGG + Intergenic
1052814589 9:33091400-33091422 CTGTTGGGGGTGGGGGGAGGGGG + Intergenic
1052844250 9:33321152-33321174 CTGTTGGTGATGAGAGAAGAAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054151704 9:61611110-61611132 CTATTGGAGCTGTGAGGAGAGGG - Intergenic
1054798829 9:69326470-69326492 CGGTTGGAGGAGGGAGGAGTGGG - Intronic
1055836865 9:80454105-80454127 CTGTTGGGGGTGAGTGGTGAGGG + Intergenic
1056672247 9:88640181-88640203 CAGCTGGAGGAGAGAGGAGGAGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058123473 9:101164936-101164958 GGGTTGGAGGTGAGAGGAGAGGG + Intronic
1059122494 9:111654686-111654708 CTGTTGGAGGAGTGTGGAGAAGG + Intronic
1059635171 9:116163294-116163316 ATGCAGGAGGAGAGAGGAGTGGG + Intronic
1060062527 9:120473917-120473939 CTTTTCAAGGTGTGAGGAGTTGG + Intronic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1060974365 9:127755538-127755560 CTGTTAGAGGTGCGGCGAGTGGG - Intronic
1061084299 9:128390278-128390300 CTGCTGGCGGTGGGGGGAGTCGG - Exonic
1061385212 9:130285580-130285602 TTGATGGGGGTGAAAGGAGTAGG - Intronic
1061664007 9:132149788-132149810 CTGGTGGAGGTGTGAGGAGGGGG + Intergenic
1062303557 9:135889277-135889299 CTGTTGGAGGCCTGAGGTGTTGG - Intronic
1062483943 9:136764959-136764981 ATGTTGGGGGTGAGAGAAGGGGG - Intronic
1062711522 9:137977718-137977740 CTGAGGGAGGAGGGAGGAGTGGG + Intronic
1185663417 X:1745048-1745070 GTGTTGGAGGTGGGGGTAGTGGG + Intergenic
1185673089 X:1826954-1826976 CTGTTGGAGGTGAGGCCAGTCGG - Intergenic
1187135917 X:16547176-16547198 CTTTGAGAGGTGAGATGAGTGGG - Intergenic
1187754560 X:22508195-22508217 CTGTTGGAAGTGACAGGAGAGGG - Intergenic
1187793949 X:22980802-22980824 CTCTTGGAGCTGGGAGGTGTGGG - Intergenic
1188274655 X:28184942-28184964 TTCTGGGAGGTGAGAGGAGTTGG - Intergenic
1188314336 X:28655002-28655024 CCGTTGGGGGTGGGAGGAGTCGG + Intronic
1188339255 X:28978394-28978416 GTGTTGGAGGTGTGAGGAAAGGG + Intronic
1189589179 X:42493768-42493790 ATGTTGGAGGTGGGCGCAGTGGG + Intergenic
1189861966 X:45281962-45281984 CTGTTGGGGGTGAGGGGTGAGGG - Intergenic
1190014565 X:46815743-46815765 CTGTTGGAGGTTAGAGTGGGAGG - Intergenic
1190330402 X:49231830-49231852 CTGTGGAAGGTGAAAGCAGTGGG - Exonic
1190789559 X:53686369-53686391 CTGGGGGAGGGGAGAGGAGGCGG + Intronic
1190916698 X:54816542-54816564 CTGGAGGAGGTGAGAGGAGTTGG + Intergenic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191760925 X:64647336-64647358 CTGTTGGAGCAGTGAGGAGAGGG + Intergenic
1191870023 X:65737988-65738010 CTGTTGGAGGTGGGAATAGAGGG + Intronic
1193454511 X:81713695-81713717 CTGTTGTGGGTGGGAGGAGGGGG + Intergenic
1193830536 X:86283720-86283742 CTGTTGGGGGTGGGGGGACTGGG + Intronic
1193862836 X:86692183-86692205 TTGGTGGAGGTGGGAGGAGATGG + Intronic
1194500200 X:94672902-94672924 CTATTGGAGCTGTGAGAAGTGGG - Intergenic
1196029161 X:111076294-111076316 ATGTTGGAGGTGAGACCTGTTGG + Intronic
1196515658 X:116606968-116606990 CTGTGGGAGGTGAGATTAGGGGG + Intergenic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1198440752 X:136660821-136660843 CTGTTGGAGGTGACAAGAAATGG - Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199880753 X:151972981-151973003 CTGTTGGTGGTGTGAGAAGTGGG + Intronic
1199928458 X:152494251-152494273 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
1200603869 Y:5239419-5239441 CTGTTGGGGGTCGGGGGAGTGGG + Intronic
1202340921 Y:23866518-23866540 CTGTTGGAAATGACAGGAATAGG - Intergenic
1202529845 Y:25803568-25803590 CTGTTGGAAATGACAGGAATAGG + Intergenic