ID: 953885686

View in Genome Browser
Species Human (GRCh38)
Location 3:46713260-46713282
Sequence AAGCGAGAGCAGGCCCGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 436}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953885686_953885692 0 Left 953885686 3:46713260-46713282 CCTTGCCGGGCCTGCTCTCGCTT 0: 1
1: 0
2: 5
3: 40
4: 436
Right 953885692 3:46713283-46713305 CCTGCAGTGCCCAGGCCACTGGG 0: 1
1: 0
2: 9
3: 39
4: 348
953885686_953885689 -8 Left 953885686 3:46713260-46713282 CCTTGCCGGGCCTGCTCTCGCTT 0: 1
1: 0
2: 5
3: 40
4: 436
Right 953885689 3:46713275-46713297 TCTCGCTTCCTGCAGTGCCCAGG 0: 1
1: 0
2: 2
3: 13
4: 206
953885686_953885693 1 Left 953885686 3:46713260-46713282 CCTTGCCGGGCCTGCTCTCGCTT 0: 1
1: 0
2: 5
3: 40
4: 436
Right 953885693 3:46713284-46713306 CTGCAGTGCCCAGGCCACTGGGG 0: 1
1: 0
2: 3
3: 47
4: 427
953885686_953885690 -1 Left 953885686 3:46713260-46713282 CCTTGCCGGGCCTGCTCTCGCTT 0: 1
1: 0
2: 5
3: 40
4: 436
Right 953885690 3:46713282-46713304 TCCTGCAGTGCCCAGGCCACTGG 0: 1
1: 0
2: 4
3: 33
4: 369
953885686_953885699 29 Left 953885686 3:46713260-46713282 CCTTGCCGGGCCTGCTCTCGCTT 0: 1
1: 0
2: 5
3: 40
4: 436
Right 953885699 3:46713312-46713334 GACACCACCTCCACCACACTCGG 0: 1
1: 0
2: 3
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953885686 Original CRISPR AAGCGAGAGCAGGCCCGGCA AGG (reversed) Intronic
900162881 1:1232606-1232628 GAGCGGGAGCAGGCGCGGCACGG + Exonic
900209784 1:1449060-1449082 AAGCCAGAGTACGCCCGGCGTGG - Intergenic
900310812 1:2032400-2032422 CAGTGAGAGCCGGCCCTGCAGGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902364724 1:15964823-15964845 AACAGAGAACAGGCCGGGCACGG + Intronic
903235240 1:21946172-21946194 AAGTGGGAGCTGGCCGGGCATGG + Intergenic
903485289 1:23685396-23685418 AAGAGGAAGCAGGCCAGGCAAGG + Intergenic
903515506 1:23908267-23908289 AAGCGATAGTTGGCCAGGCACGG - Intronic
903740053 1:25553559-25553581 AAGTGACAGCAGACCCAGCACGG + Intronic
903979614 1:27176463-27176485 AAGTGAGACCTGGCCAGGCAGGG + Intergenic
904040737 1:27583340-27583362 GAGCCAGAGCATGCCAGGCAGGG - Intronic
904182686 1:28677891-28677913 AAGGGAGAAGAGGCCGGGCATGG + Intronic
904750545 1:32739230-32739252 AGGCAATAGCAGGCCGGGCAAGG - Intergenic
905399606 1:37691989-37692011 GAGACAGAGCAGCCCCGGCAGGG - Intronic
906001260 1:42427769-42427791 AAGCAAAAACAGGCCAGGCACGG + Intergenic
906959138 1:50404980-50405002 AAAAGTGAGCAGGCCAGGCATGG + Intergenic
907023309 1:51089977-51089999 AAGCAGGAGGAGGCCAGGCACGG + Intergenic
907426638 1:54383814-54383836 AAGCAAGAACCGGCCGGGCACGG + Intronic
907833358 1:58086251-58086273 AAGAGAGATCAGGCCGGGCGCGG - Intronic
911526234 1:98990085-98990107 AAGAAAGAGCAGGCCAGGCATGG + Intronic
913060027 1:115196157-115196179 AAACAAAAGCAGGCCAGGCACGG - Intergenic
913145477 1:115985656-115985678 AAGAGAGAGAAGGCCGGGCGCGG + Intronic
913292450 1:117286362-117286384 AAGGAAGAGCTGGCCGGGCAGGG + Intergenic
913599926 1:120413361-120413383 AACCTAAAGCAGGCCAGGCACGG - Intergenic
914087133 1:144463302-144463324 AACCTAAAGCAGGCCAGGCACGG + Intergenic
914192917 1:145426392-145426414 AACCTAAAGCAGGCCAGGCACGG + Intergenic
914311476 1:146470900-146470922 AACCTAAAGCAGGCCAGGCACGG - Intergenic
914590942 1:149105198-149105220 AACCTAAAGCAGGCCAGGCACGG + Intergenic
916973223 1:170047328-170047350 AAGTGAGATCTGGCCGGGCACGG + Intronic
917390833 1:174534484-174534506 TAACTAGAGCAGGCCAGGCAAGG + Intronic
917701471 1:177585942-177585964 AAGCAAGAGCAGGCCCCTCAAGG + Intergenic
917844178 1:179006591-179006613 AAGCAGGACCAGGCCGGGCACGG + Intergenic
919764436 1:201117143-201117165 AAGTGAAACCAGGCCGGGCATGG + Intronic
920007492 1:202844163-202844185 AGGACAGAGCAGGCCGGGCACGG - Intergenic
920505752 1:206514061-206514083 ATGCTAGAACAGGCCCGGCATGG - Intronic
920778421 1:208964082-208964104 AAGTGATAGTAGGCCAGGCATGG - Intergenic
921027728 1:211303094-211303116 AAGGGACAGCAGGGCAGGCAAGG - Intronic
921996811 1:221427857-221427879 AAGAGAAAACAGGCCGGGCATGG - Intergenic
922130282 1:222770961-222770983 AAGCTCGGGCAGGCCGGGCACGG + Intergenic
922772464 1:228193799-228193821 AAGCGAGAGACGGCCAGGCGCGG - Intergenic
923709609 1:236376223-236376245 AAGTGAAAGTAGGCCGGGCATGG - Intronic
923785596 1:237065573-237065595 AAAGGATAGCAGGCCAGGCACGG - Intronic
924621708 1:245667467-245667489 AAACCAAAGCAGGCCAGGCACGG - Intronic
1063708265 10:8452106-8452128 ATGCCAGAGCAGGCCAGGCTTGG - Intergenic
1064054611 10:12086975-12086997 AAGTAAGACCAGGCCAGGCATGG - Intronic
1064538386 10:16381576-16381598 AAGAAAGAGGAGGCCAGGCATGG + Intergenic
1064724661 10:18266596-18266618 AAGTGTGAGCGGGCCGGGCACGG + Intronic
1064738409 10:18407410-18407432 AAGACAGAACAGGCCGGGCATGG - Intronic
1064954672 10:20894622-20894644 AAGCCAGAATAGGCCGGGCATGG + Intronic
1065313015 10:24434327-24434349 AAGAGAGATGAGGCCAGGCATGG - Intronic
1065510683 10:26475409-26475431 AAGCAAGGGAAGGCCAGGCACGG - Intronic
1066065895 10:31760479-31760501 GAGCGCGAGCAGCCTCGGCAGGG + Intergenic
1066326787 10:34368380-34368402 AGGTGAGAGCAGGCCGGGCGCGG + Intronic
1066402906 10:35092244-35092266 AAGACAGAGGAGGCCAGGCATGG - Intergenic
1067497756 10:46774869-46774891 GGGCGAGGGCAGGCCCAGCATGG + Intergenic
1067596893 10:47565545-47565567 GGGCGAGGGCAGGCCCAGCATGG - Intergenic
1068892870 10:62165710-62165732 AAGGCATATCAGGCCCGGCATGG - Intergenic
1070119336 10:73560362-73560384 AAGTGAGACCAGGCCGGGCATGG + Intronic
1070923328 10:80202753-80202775 AAGAGAGAGGAGGCCGGGCACGG + Intronic
1071816032 10:89233607-89233629 AAGCAATGGCAGGCCGGGCACGG + Intronic
1073082702 10:100869938-100869960 AAGAGAGAGGGGGCCGGGCACGG + Intergenic
1073381491 10:103081110-103081132 AAGCAAGAGCAGGCCAGGGAGGG + Exonic
1074611883 10:115029574-115029596 AAGAAACAGCAGGCCAGGCACGG - Intergenic
1074863195 10:117528724-117528746 AAATGAGAGGAGGCCGGGCATGG - Intergenic
1075124730 10:119690663-119690685 AACAGAGAGTAGGCCAGGCACGG + Intergenic
1075571750 10:123551424-123551446 AGGGGAGAGCATGCCAGGCAGGG + Intergenic
1075694406 10:124422928-124422950 AAACGACCGCAGGCCAGGCATGG - Intergenic
1075779562 10:125008235-125008257 AGGCCAGAGCCGGCCAGGCACGG - Intronic
1075912246 10:126134799-126134821 AAGAGAGAGAAGGCCCTGGAAGG - Intronic
1076192859 10:128495124-128495146 AAGAGAAAGCAGGCCGGACACGG + Intergenic
1077301170 11:1847585-1847607 CAGCGACAGCAGGGCCGGCTGGG - Intergenic
1077847655 11:6043061-6043083 AAGAGAGATCAGGCCAGGCACGG + Intergenic
1078211351 11:9272385-9272407 AAGAGAGAGCAGGCCAGGCATGG + Intergenic
1078592560 11:12657317-12657339 AAGTAAGAACAGGCCGGGCATGG - Intergenic
1080838272 11:35960882-35960904 AAACCAAAGCAGGCCGGGCACGG - Intronic
1081574394 11:44310170-44310192 GAGAGCGAGCAGGCCGGGCAAGG - Intergenic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1082069104 11:47924280-47924302 AAGTGGTAGCAGGCCAGGCACGG - Intergenic
1083701501 11:64481681-64481703 AAGCTACAGTAGGCCAGGCACGG - Intergenic
1083879162 11:65539792-65539814 AGGTGAGGGCAGGCCCGGCCAGG + Exonic
1083897812 11:65628963-65628985 AGGCGGGAGCATGCCCAGCAGGG + Intronic
1083980905 11:66168190-66168212 AAGGAGGAGCAGGCCAGGCATGG - Intronic
1085054196 11:73394536-73394558 GAGCGAGGCCAGGCCCTGCACGG - Exonic
1085080692 11:73631440-73631462 ATGAGACAGCAGGCCCAGCATGG - Intergenic
1086194831 11:84125138-84125160 AAGTGAAAACAGGCCAGGCACGG - Intronic
1089198979 11:116711865-116711887 GAGAGAGAGCAGGCCCAGGAAGG - Intergenic
1090029576 11:123195397-123195419 AAGCGTGAGCTGGCCGGGCAGGG + Intergenic
1091068114 11:132536154-132536176 AATGGAGAGCAGGCCCTGGAGGG - Intronic
1091247337 11:134109250-134109272 TGGTGAGAGCAGGCCGGGCACGG - Intronic
1092227487 12:6757317-6757339 AAGGGAGAGCAGGCCCTGCCAGG + Intronic
1092733758 12:11559353-11559375 AGGAGAGAGCAGGACTGGCATGG + Intergenic
1093382259 12:18507317-18507339 AAGCGAATGAAGGCCAGGCACGG - Intronic
1094123441 12:26998121-26998143 AAAAGGGAGCAGGCCGGGCACGG - Intronic
1095051183 12:37555458-37555480 AAACGAGGGGAGGCCGGGCACGG - Intergenic
1095476273 12:42589897-42589919 AAGCGAGGTCGGGCCCGGCTCGG + Intronic
1096579867 12:52577963-52577985 AAGAGAAAGAAGGCCAGGCATGG + Intergenic
1096689639 12:53312035-53312057 AAGGGAGGACAGGCCGGGCATGG + Intronic
1096768329 12:53913242-53913264 AAGCAAAAGCAGGCCAGGCGCGG - Intergenic
1097247474 12:57614475-57614497 AAGAGAGAGCAGGGTGGGCAAGG - Intronic
1097359041 12:58637565-58637587 AACCCAGAGCTGGCCGGGCACGG + Intronic
1098259095 12:68649330-68649352 AAGAAAGAGCAAGCCAGGCATGG - Intronic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1101836934 12:108302493-108302515 AAGTGGGAGGAGGCCAGGCAGGG + Intronic
1102155943 12:110728107-110728129 ACTCAAGAGCAGGCCAGGCACGG + Intronic
1102394030 12:112573197-112573219 AACAGAGATCAGGCCAGGCATGG - Intronic
1102414483 12:112748623-112748645 GAGTGGGAGCAGGCCAGGCATGG - Intronic
1103267180 12:119640444-119640466 AAGCAAAAACAGGCCAGGCATGG - Intronic
1103610557 12:122121661-122121683 CAGAGAGGGCAGGCCGGGCATGG - Intronic
1104442664 12:128807189-128807211 AAGCGCTAGCAGGCCGGGCACGG - Intronic
1106488135 13:30190715-30190737 AAGCCAGAGCAGGCCAGGGGTGG + Intergenic
1106510431 13:30408351-30408373 AAGCGCGTGCAGTCCCGGCGCGG + Intergenic
1107279450 13:38716796-38716818 AAGAAAGAGCAGGCCAGGCGCGG - Intronic
1107431855 13:40347435-40347457 AAGCCTGGGCAGGCCAGGCACGG + Intergenic
1111222845 13:85227103-85227125 AAGAGAAAGCAGGTCGGGCATGG - Intergenic
1112516285 13:100055850-100055872 AAGGGAGATCAGGCCAGGCGTGG + Intergenic
1113657715 13:112079232-112079254 CAGAAAGAGCAGGCCAGGCAGGG + Intergenic
1113769487 13:112898986-112899008 AAGCGGGGGCAGACCCGGCATGG - Intronic
1113983250 13:114294072-114294094 AAGCTAAACCAGGCCAGGCATGG - Intronic
1117099384 14:52331210-52331232 AAGAGAGAGGAGGCCGGGCGCGG + Intergenic
1117320011 14:54612826-54612848 AAGTGAAAGCCGGCCGGGCATGG + Intronic
1117860976 14:60092242-60092264 AACCGAGAGCTGGCCCGGGCGGG + Exonic
1118280668 14:64425499-64425521 AAGGGAAAACAGGCCGGGCACGG - Intronic
1118742031 14:68746668-68746690 AAGAAAAAGAAGGCCCGGCATGG + Intergenic
1119818509 14:77592817-77592839 AAGTGAGAACAGGCTAGGCACGG + Intronic
1120320875 14:82958463-82958485 AAGAGATAACAGGCCAGGCATGG - Intergenic
1121011548 14:90522988-90523010 AAGAGAGACCACGCCCCGCATGG + Intergenic
1122198613 14:100108412-100108434 GAGAGAAAGCAGGCCCAGCATGG + Intronic
1122349763 14:101082207-101082229 GAGAGAGAGCACGCCCTGCAGGG + Intergenic
1124141705 15:27082851-27082873 AAGCGGGAGCAGGTCCCTCAGGG - Intronic
1124480599 15:30075818-30075840 AAGAGAGAGGAGGCCAGGCGCGG - Intergenic
1124847724 15:33308664-33308686 AAGCTAGAGTATGCCAGGCAAGG - Intergenic
1125595680 15:40884315-40884337 AAGCAACAGCAGGCCAGGCATGG - Intergenic
1125648460 15:41293183-41293205 AAAGGAGAACAGGCCGGGCACGG - Intergenic
1128048376 15:64640165-64640187 AAGAGAGAGGAGGCCAGGCACGG - Intronic
1129493913 15:75958300-75958322 AAGTGAGAGGTGGCCGGGCACGG - Intronic
1129868837 15:78928275-78928297 AAGGGAGAGTTGGCCGGGCACGG + Intronic
1132477201 16:146171-146193 AAGAGAGACCTGGCCGGGCACGG + Intergenic
1132954596 16:2584968-2584990 CAGCAACAGCAGGCCCAGCAGGG - Intronic
1133101211 16:3481373-3481395 AAGAGAGATCAGGCTGGGCACGG - Intronic
1133150554 16:3825929-3825951 AAGCAAGATGAGGCCAGGCATGG + Intronic
1133192846 16:4147139-4147161 AAGGCAGGCCAGGCCCGGCATGG - Intergenic
1133221546 16:4321114-4321136 GGGCAAGAGCAGGCCCAGCAGGG - Intronic
1133296350 16:4754367-4754389 AACTGAGAGGAGGCCGGGCATGG + Intronic
1133429949 16:5727975-5727997 CAGAGAGAGGAGGCCGGGCATGG - Intergenic
1133695298 16:8257380-8257402 AAACCAGAGCAGGCCAAGCATGG - Intergenic
1134655073 16:15942016-15942038 AAGTGGAAGCAGGCCGGGCATGG - Intergenic
1135015432 16:18920845-18920867 AAGAGAGAGGAAGCCAGGCATGG + Intronic
1135265209 16:21019506-21019528 AAGCCACAGAAGGCCAGGCACGG - Intronic
1135605744 16:23823096-23823118 AATTGAGGGCAGGCCAGGCATGG + Intergenic
1136164743 16:28445842-28445864 AAGGGAGGGGAGGCCGGGCATGG + Intergenic
1136175134 16:28511420-28511442 AAGTGAGAGCAGGCTGGGCATGG + Intronic
1136198223 16:28669139-28669161 AAGGGAGGGGAGGCCGGGCATGG - Intergenic
1136214569 16:28783315-28783337 AAGGGAGGGGAGGCCGGGCATGG - Intergenic
1136332532 16:29589773-29589795 AAGAGAGAGGAGGCCAGGCATGG + Intergenic
1136636044 16:31523968-31523990 AGGTGAGAGCAGGCCCTGCAGGG - Intergenic
1136666336 16:31816339-31816361 AGGTGAGAGCAGGCCCTGCAGGG - Intergenic
1136684535 16:31986478-31986500 ACGCCAGAGCAGGCCCGGCAGGG + Intergenic
1136785161 16:32930021-32930043 ACGCCAGAGCAGGCCCGGCAGGG + Intergenic
1136884621 16:33923783-33923805 ACGCCAGAGCAGGCCCGGCAGGG - Intergenic
1137583213 16:49647112-49647134 AAGAGGGAGCAGGTCCAGCAGGG - Intronic
1137734767 16:50715704-50715726 AAGAGGGAACAGGCCGGGCACGG - Intronic
1138841961 16:60521063-60521085 AAAAGTGAGCAGGCCAGGCATGG + Intergenic
1139318528 16:66094063-66094085 AAGCAGAAGCAGGCCAGGCATGG + Intergenic
1139607214 16:68027888-68027910 GAGAGAGAGCAGGCCAGGCTGGG + Intronic
1139682559 16:68576454-68576476 AAGCTCCAGCAGGCCGGGCACGG + Intergenic
1140114352 16:72028700-72028722 AAGAGAAGGCAGGCCGGGCATGG + Intergenic
1140492182 16:75347052-75347074 AAGAAAGAACAGGCCAGGCACGG + Intronic
1141366003 16:83443777-83443799 GAGCGAGAGCAAGCCAGGCTTGG + Intronic
1141974359 16:87505102-87505124 AAGCCAGAACAGGCCGGGCATGG - Intergenic
1142376086 16:89707819-89707841 AGGCGAGGCCAGGCCCTGCAGGG + Exonic
1203087821 16_KI270728v1_random:1194030-1194052 ACGCCAGAGCAGGCCCGGCAGGG + Intergenic
1143218932 17:5245359-5245381 AAGCCAAAGTAGGCCAGGCATGG + Intergenic
1143363094 17:6387338-6387360 CAGAGAGAGAAGGCCAGGCAGGG - Intergenic
1144476544 17:15593917-15593939 AAATGACAGCAGGCCGGGCATGG - Intronic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1144921708 17:18769484-18769506 AAATGACAGCAGGCCGGGCATGG + Intronic
1146357566 17:32147031-32147053 AAAAAAGAGCAGGCCAGGCATGG - Intronic
1147055706 17:37833247-37833269 AAGAAAGAACAGGCCGGGCATGG - Intergenic
1147145466 17:38482159-38482181 ACGCCAGAGCAGGCCCAGCAGGG + Intronic
1147194527 17:38756781-38756803 AAAAGAGATCAGGCCAGGCATGG - Intronic
1148672848 17:49425011-49425033 CAGCAAGAGCAGGCCAGGCATGG - Intronic
1149490671 17:57083141-57083163 AAGAGAGTCCAGGCCAGGCACGG + Intergenic
1151824710 17:76517804-76517826 AAGCAAGAGCAGCCCCTGCCGGG - Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152706300 17:81845311-81845333 AAGGCAGAGCAGGCCCGGTCCGG + Intronic
1152708063 17:81855637-81855659 AGACGGGAGCAGGCGCGGCAGGG - Intronic
1154240600 18:12650266-12650288 AAGTGACAGCAGGCCAGGCATGG + Intronic
1154244562 18:12684403-12684425 AGGTGACAGCAGGCCAGGCATGG - Intronic
1154434873 18:14335583-14335605 AAGGGAGTGCAGGGCTGGCAGGG - Intergenic
1154930678 18:20991926-20991948 AAGTGGTAGCAGGCCAGGCAAGG - Intronic
1154951534 18:21214942-21214964 AAGCAATAGCAGGCCGGGCCCGG - Intergenic
1155447591 18:25928415-25928437 AAGCAAGAAGAGGCCAGGCATGG + Intergenic
1155452912 18:25981599-25981621 AAGGGAGACAAGGCCGGGCACGG + Intergenic
1155993301 18:32303625-32303647 AAGAGTAAGCAGGCCAGGCATGG + Intronic
1156831414 18:41496483-41496505 AAGTGAGAGCTGGCCAGGCGCGG - Intergenic
1157296985 18:46452568-46452590 AAGCAAAAACAGGCCAGGCATGG - Intronic
1157368451 18:47088150-47088172 TAGCGAGAGCAGGCTTGTCATGG + Intronic
1160191543 18:76718530-76718552 GAGCAAGACCAGGCCGGGCACGG + Intergenic
1160870611 19:1276116-1276138 AAGCCGGAGCATGCCGGGCAGGG + Intronic
1160928545 19:1558800-1558822 AAGCCACAGCAGGCCCCTCAGGG - Intronic
1161015420 19:1980641-1980663 AGGGGAGGGCAGGCCCGGCCTGG + Exonic
1161037645 19:2094420-2094442 AAGCAAGACCAGGCCTGGAAAGG + Intronic
1161324637 19:3657631-3657653 AAGCGAGGGGAGGCCAGGCACGG + Intronic
1161395813 19:4044307-4044329 ATGCCGGAGCAGGCCCGGCCTGG - Intergenic
1161645994 19:5453817-5453839 AAGGGAGAAAAGGCCGGGCATGG - Intergenic
1161695874 19:5767745-5767767 AAGGGAGGGCAGGCCAGGCGCGG - Intronic
1164987860 19:32662020-32662042 AAGATAGAGTAGGCCAGGCACGG + Intronic
1165021631 19:32929309-32929331 AAGAGAGAGAGGGCCGGGCATGG + Intronic
1165106333 19:33471717-33471739 AAGTTTGAGCAGGCCAGGCATGG + Intronic
1165541830 19:36498248-36498270 AAGGCAAAGCAGGCCTGGCATGG + Intergenic
1166548228 19:43647514-43647536 AAGAAAGAGGAGGCCAGGCACGG + Intronic
1166747392 19:45147771-45147793 AGGGGGGAGCAGGCCGGGCATGG + Intronic
1166780189 19:45338138-45338160 AAGCTAGAGTAGGCCGGGCATGG + Intronic
1167040587 19:47020737-47020759 ATGCGGGAGCCGGCCCGGCGCGG + Intronic
1167190489 19:47985542-47985564 AAGAGTAAGTAGGCCCGGCATGG + Intronic
1167338814 19:48903096-48903118 AAAAGAGAGAAGGCCAGGCATGG - Intronic
1167688802 19:50972796-50972818 AAGAGAGAATAGGCCAGGCACGG - Intergenic
1167918879 19:52764805-52764827 AAGGGAGATCAGGCCAGGCACGG - Exonic
925988882 2:9237708-9237730 CAACCAGAGCAGGCCAGGCACGG - Intronic
927246136 2:20958401-20958423 GAGCCAGAGCAGGCCCAGCCGGG + Intergenic
929058557 2:37900465-37900487 AAGCGAGTGCAGGAACGGGAGGG + Intergenic
930673424 2:54175654-54175676 AAGCAAAAACAGGCCAGGCACGG - Intronic
930786682 2:55278064-55278086 AAGAAATAGCAGGCCGGGCATGG - Intergenic
931270431 2:60697162-60697184 AGGAGAGAGCAGGCCGGGCGTGG - Intergenic
932063197 2:68528230-68528252 AAGAGACAGCAGGGCAGGCATGG - Intronic
932184578 2:69682140-69682162 AAGCAAGAACGGGCCAGGCATGG - Intronic
932530910 2:72531693-72531715 ATGCCATAGCAGGCCAGGCACGG + Intronic
933348026 2:81115155-81115177 TATCAAGTGCAGGCCCGGCATGG + Intergenic
934744396 2:96749504-96749526 AAGAGAGAGCGGGCCAGGCGTGG + Intergenic
935854141 2:107256789-107256811 AAAGGACAGCAGGCCCAGCATGG - Intergenic
935924544 2:108052804-108052826 AAGCCAGAGCCAGCCAGGCAGGG + Intergenic
935988268 2:108695496-108695518 AAGCGTGAGAAGGCCGGGCGCGG - Intergenic
937608690 2:123834229-123834251 AAGCCAGATCAGGCTGGGCATGG + Intergenic
938317775 2:130341930-130341952 GAGCGAGAGCCAGCCCTGCAGGG + Exonic
938342047 2:130542054-130542076 GAGGGAGAGGAGGCCGGGCACGG + Intronic
938347785 2:130578657-130578679 GAGGGAGAGGAGGCCGGGCACGG - Intronic
938848853 2:135239696-135239718 AAGAAAGAGCGGGCCAGGCATGG + Intronic
938956421 2:136302854-136302876 AAGAGACGGCAGGCCAGGCATGG - Intergenic
941113489 2:161444520-161444542 AATGAAAAGCAGGCCCGGCACGG - Intronic
941777891 2:169412885-169412907 AAGTAAGGGCAGGCCAGGCACGG + Intergenic
941834072 2:169996987-169997009 AATCCAAAGCAGGCCGGGCATGG - Intronic
941951800 2:171163080-171163102 AAGCCAGACAAGGCCTGGCACGG - Intronic
941956639 2:171212128-171212150 AAACGAGAGGAGGCCAGGCATGG - Intronic
942408955 2:175686207-175686229 TGGCCAGAGCAGGCCAGGCAAGG - Intergenic
943650844 2:190456229-190456251 AAAGTAGAGCAGGCCAGGCATGG - Intronic
944958237 2:204837573-204837595 AAGAAAGACCAGGCCAGGCATGG - Intronic
946211531 2:218151266-218151288 AGGCAAGAGGAGGCCGGGCATGG + Intergenic
946388926 2:219404048-219404070 AAGCATGAGCAGGCCAGGCGCGG + Intergenic
946509417 2:220338557-220338579 AAGCAAGTGCTGGCCGGGCACGG + Intergenic
947047794 2:226007922-226007944 AAGAGAGGGCATGCCAGGCATGG + Intergenic
947363851 2:229373872-229373894 AAGTGGGAGCTGGCCAGGCACGG + Intronic
1169043299 20:2514689-2514711 AAGCCAAAGCAGGCCAGGCATGG + Intronic
1169100758 20:2946557-2946579 AAGAAAGAGTAGGCCGGGCATGG + Intronic
1170225011 20:13982734-13982756 AAGCAGCAGCAGGCCAGGCACGG + Intronic
1170634826 20:18095161-18095183 AAGTTAATGCAGGCCCGGCACGG + Intergenic
1171386336 20:24771708-24771730 AAGGGAGAGCGGCCCCGGCAGGG + Intergenic
1171502541 20:25604790-25604812 AGGAGGGAGCAGGGCCGGCAGGG + Intergenic
1172019995 20:31907429-31907451 AAGCCACTGCAGGCCGGGCACGG + Intronic
1172341891 20:34164505-34164527 AAATGAGATCAGGCCAGGCACGG - Intergenic
1172434470 20:34919303-34919325 AAGGGAGAGAAGGCCCTTCAAGG - Intronic
1172461092 20:35119298-35119320 ATCCAAGAGCAGGCCAGGCATGG + Intronic
1172785592 20:37466309-37466331 AAGGGAGAGGAGGTCCGGCCAGG - Intergenic
1173042674 20:39478957-39478979 AAACAAGGGCAGGCCGGGCATGG + Intergenic
1173835214 20:46120610-46120632 AATCAAGAGCAGGCCTGGGAGGG + Intronic
1174228844 20:49027404-49027426 AATGGAGAGCAGGCCAGGCAAGG + Intronic
1174317448 20:49713717-49713739 CTGCGGGAGCAGGCCCGGCCTGG - Exonic
1174466442 20:50721249-50721271 AAAGAAGAGCAGGCCGGGCACGG - Intergenic
1174604860 20:51753960-51753982 ATGAGAGAACAGGCCGGGCATGG - Intronic
1175027023 20:55913445-55913467 AAGGCAGAGAAGGCCAGGCACGG + Intergenic
1175151690 20:56940094-56940116 AACCGAGAGCAGCCCCCACAGGG - Intergenic
1177034394 21:16024005-16024027 AAGCAAGAACAGGCCAGGCGTGG + Intergenic
1177161308 21:17551107-17551129 AAGAATGAGCAGGCCAGGCATGG + Intronic
1177579998 21:23008940-23008962 AAAAGAAAGCAGGCCTGGCACGG - Intergenic
1179208734 21:39308189-39308211 AAGCAAAAGTAGGCCTGGCAAGG + Intronic
1179379747 21:40887442-40887464 AAGCAAAACCAGGCCAGGCACGG + Intergenic
1179450602 21:41465946-41465968 TAGGGAGAGCAGGCTGGGCAGGG + Exonic
1180674198 22:17576061-17576083 AAGGTAGAGGAGGCCGGGCATGG + Intronic
1180907095 22:19421960-19421982 AAGATAGAACAGGCCGGGCATGG - Intronic
1181101513 22:20543500-20543522 ATGCAAGAGGAGGCCGGGCATGG - Intronic
1182361023 22:29746574-29746596 AATCCAGAGCAGGCAGGGCATGG - Intronic
1182457085 22:30458718-30458740 AAGCAAAAACAGGCCAGGCATGG + Intronic
1182975476 22:34620194-34620216 AAAAGAGAACAGGCCGGGCACGG - Intergenic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183165366 22:36143557-36143579 AAGAGAGAACATGCCAGGCAAGG - Intronic
1183345055 22:37302986-37303008 AAGGAAGGGCAGGCCTGGCAGGG + Intronic
1183380562 22:37488665-37488687 CAGGGAGAGCAGCCCAGGCAGGG + Intergenic
1183621273 22:38974288-38974310 AAGCAAGGGCAGGCCGGGCGCGG - Intronic
1183933638 22:41249696-41249718 AAGGAACAGCAGGCCCGGGAGGG - Intronic
1184055828 22:42048464-42048486 AAGCCTCAGCAGGCCGGGCACGG + Intronic
1184159455 22:42689224-42689246 AAACGAGACCAGGCCAGGCACGG + Intergenic
1184227552 22:43137933-43137955 AAGAGAGATCAGGCCGGGCATGG + Intronic
1184279341 22:43428193-43428215 GAGCTGGAGCAGGCCCCGCAAGG + Intronic
1185089654 22:48758642-48758664 AAGCCAGAGCATGCGTGGCAGGG + Intronic
1185396669 22:50595083-50595105 AAGTGACAGTAGGCCGGGCACGG - Intronic
949409605 3:3749338-3749360 AAGTCAGATCAGGCCGGGCACGG + Intronic
949547038 3:5081317-5081339 ACCCGAGAGCAAGCCAGGCAGGG - Intergenic
952281404 3:31926817-31926839 AAGGGAAAGTAGGCCGGGCATGG + Intronic
953579504 3:44141104-44141126 AAGTGAGAGTAGGCCAGGCAAGG - Intergenic
953885686 3:46713260-46713282 AAGCGAGAGCAGGCCCGGCAAGG - Intronic
954058998 3:48054333-48054355 CAGCTGGAGCAGGCCAGGCACGG + Intronic
954080115 3:48208585-48208607 AAGTGAGAGTAGGCTGGGCACGG + Intergenic
954487604 3:50868360-50868382 AAACAAAAGCAGGCCGGGCATGG - Intronic
954814523 3:53270208-53270230 CAAGGAAAGCAGGCCCGGCAGGG - Intergenic
956346441 3:68284635-68284657 AAAAAAGAGCAGGCCAGGCATGG + Intronic
957334218 3:78806262-78806284 TAGAGAGAGCAGACCAGGCAAGG - Intronic
957936886 3:86955679-86955701 AAGTGAGATGAGGCCAGGCACGG - Intronic
958868868 3:99533553-99533575 AAGAAAGAGCAGGCCGGGCATGG + Intergenic
959773062 3:110123042-110123064 AAATGATAGCAGGCCAGGCACGG - Intergenic
961376445 3:126469296-126469318 TGGGGAGAGCAGGCCAGGCAGGG - Intronic
961695420 3:128700911-128700933 AAGCAACAACAGGCCAGGCATGG - Intergenic
961835371 3:129653735-129653757 TAGCAAGAACAGGCCGGGCATGG - Intronic
963145338 3:141988234-141988256 AACCAACAGCAGGCCAGGCACGG - Intronic
967266892 3:187699155-187699177 AGGCGAGAGCAGGCCGGCCTTGG - Intronic
967830812 3:193918600-193918622 AAGCTAGAGTCGGCCAGGCACGG + Intergenic
967952936 3:194854700-194854722 AAGCCAGAGGAGGCCAGGCTGGG + Intergenic
968679484 4:1906949-1906971 AAGAGAGATGAGGCCGGGCACGG - Intronic
970347211 4:15163990-15164012 AGGAGAGAGCTGGCCCAGCACGG - Intergenic
972325884 4:38014801-38014823 CAGCGAGCGCAGGCCGGGCTGGG - Exonic
972370917 4:38422429-38422451 AAGTGAGTTCAGGCCAGGCATGG - Intergenic
972434846 4:39023550-39023572 AACCCAGACCAGGCCAGGCATGG + Intronic
972456548 4:39261280-39261302 AAGAGAGACCAGGCCGGGCGCGG - Intronic
972547312 4:40092932-40092954 AAAAAAGAGCAGGCCGGGCACGG - Intronic
974032188 4:56786222-56786244 AAGGAAGATCAGGCCGGGCACGG + Intergenic
975562368 4:75719877-75719899 AAATGAGACCAGGCCGGGCACGG - Intronic
975631857 4:76412320-76412342 AGCCTAGAGCAGGCCAGGCATGG + Intronic
977526486 4:98152224-98152246 AAGAGAGAGCTGGCCGTGCACGG - Intergenic
978764356 4:112389332-112389354 AAGCCAGCACAGGCCAGGCACGG - Intronic
980011210 4:127596652-127596674 AAGCGAGACTTGGCCAGGCATGG - Intergenic
980281828 4:130732931-130732953 AAGCTATTGCAGGCCAGGCATGG + Intergenic
980381115 4:132018879-132018901 AAGGAAGGGCAGGCCAGGCATGG + Intergenic
980932181 4:139192518-139192540 AAGGGAGAGTAGGCCGGGCGCGG - Intergenic
984250059 4:177320755-177320777 AAATGACAGCAGGCCCGGCGCGG - Intronic
985504420 5:271000-271022 AAGCAAAAGCAGGCCGGGCGCGG - Intergenic
985575039 5:670044-670066 AAGCAAGTCCAGGCCCCGCAGGG - Intronic
985880522 5:2635711-2635733 AAGGGAGAGCAAGCCCGGGGTGG + Intergenic
986219152 5:5751940-5751962 AAGCATGAGCAGGCCAGGAAAGG + Intergenic
987133588 5:14881308-14881330 AAGGTAAAGCAGGCCGGGCACGG + Intergenic
987329153 5:16840120-16840142 AAGAAAGAACAGGCCGGGCATGG + Intronic
988665836 5:33326470-33326492 AAGAGAGAGCAGGCAGAGCAAGG - Intergenic
988712463 5:33792284-33792306 AAGTGAAAGCAGGCTGGGCATGG - Intronic
990409776 5:55530681-55530703 AAGAGAGAGCATGCCCTGAACGG - Intronic
990874084 5:60464809-60464831 AAGCAAGGCCAGGCCAGGCATGG + Intronic
991370987 5:65919584-65919606 AAGTCAGAGTAGGCCAGGCACGG - Intergenic
991675632 5:69087600-69087622 AACCGAGCTCAGGCCAGGCACGG + Intergenic
991733830 5:69613788-69613810 AAGTGAATGGAGGCCCGGCATGG + Intergenic
991810264 5:70468930-70468952 AAGTGAATGGAGGCCCGGCATGG + Intergenic
991860437 5:71008358-71008380 AAGTGAATGGAGGCCCGGCATGG - Intronic
991902201 5:71472168-71472190 AAGTGAGAGTAGGCTGGGCATGG + Intronic
999183742 5:149690147-149690169 AAAAGAGAGCAGGCCTGGGATGG + Intergenic
999279142 5:150353488-150353510 AAGGGAGGGCAGGGCAGGCAAGG - Intergenic
999396922 5:151235384-151235406 AAGGAAGACCAGGCCGGGCATGG + Intronic
999413840 5:151377635-151377657 AAGAGACAGCAGGCCGGGCGCGG - Intergenic
1001499645 5:172220343-172220365 AAGCTATAGCTGGCCGGGCACGG + Intronic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001996615 5:176165749-176165771 AAGAGATAACAGGCCAGGCATGG - Intergenic
1002041166 5:176515370-176515392 AAGAAAAAGCAGGCCGGGCACGG - Intergenic
1002569606 5:180132678-180132700 AAGCAAGACCAGGCCGGGCGCGG + Intronic
1003250425 6:4424857-4424879 AAGGGAAAGAAGGCCGGGCACGG + Intergenic
1003648411 6:7935475-7935497 ATGAAAGAGCAGGCCGGGCATGG + Intronic
1004718932 6:18247960-18247982 AAGTGAGGGCAGGCCGGGCATGG - Intronic
1005345351 6:24884116-24884138 AAATCAAAGCAGGCCCGGCACGG + Intronic
1005392768 6:25350130-25350152 AAGAGAGAGCTGGGCAGGCATGG + Intronic
1006902376 6:37511552-37511574 CAGCGAGAGCTGGCCGGGAAGGG - Intergenic
1007624788 6:43238835-43238857 AAGCAAAAACAGGCCGGGCATGG - Intergenic
1007655161 6:43447281-43447303 GCCCGAGAGCAGGCCCGTCAGGG - Exonic
1008769221 6:54959257-54959279 AACAGATAGCAGGCCCGGCGCGG + Intergenic
1010329292 6:74603508-74603530 AGGCGAGAGCAGGACTGGGAGGG + Intergenic
1010526957 6:76912629-76912651 AATTGAGACCAGGCCTGGCACGG - Intergenic
1011893948 6:92200938-92200960 AAGTTAGAGCAGGCCGGGCGCGG + Intergenic
1012274987 6:97262352-97262374 AAAAGATAGCAGGCCAGGCATGG + Intronic
1013050056 6:106524270-106524292 AAGCGGGATTAGGCCGGGCACGG + Intronic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1014249799 6:119103635-119103657 GAGAGAGAGGAGGCCAGGCACGG + Intronic
1016043363 6:139455759-139455781 AAGCTAGTGTAGGCCGGGCACGG - Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1018093246 6:160363270-160363292 AAGCGAGACTAGGCCCAGCAGGG - Intronic
1018185546 6:161262971-161262993 AAGCGAGGGAAGGCCCACCAAGG + Intronic
1018195004 6:161347904-161347926 AAGTTAGAGCAGGCCGGGCGCGG - Exonic
1018910556 6:168098826-168098848 ACGGGAGAGCAGCCCAGGCAGGG + Intergenic
1019229832 6:170550844-170550866 AAAGGAGAGGAGGCCGGGCACGG + Intronic
1019603497 7:1897076-1897098 AACGCAGAGCAAGCCCGGCACGG + Intronic
1020063655 7:5171019-5171041 AAGAGAAATCAGGCCAGGCAAGG + Intergenic
1020172602 7:5856749-5856771 AAGTGTGAGCAGGCCTGGCCAGG + Intergenic
1020262344 7:6537251-6537273 AACTGAGAGCAGGCCGGGCACGG + Intronic
1020656782 7:10937571-10937593 AACCAAGGGCAGGCCAGGCACGG - Intronic
1022314336 7:29230629-29230651 AAGAAAGAGGAGGCCTGGCATGG - Intronic
1025003775 7:55339784-55339806 AAGCAAGAGTAGGCCCAGAAGGG + Intergenic
1025732421 7:64118390-64118412 AAATGAGAACAGGCCGGGCACGG - Intronic
1026634949 7:72073983-72074005 AAGAGGGACCAGGCCAGGCATGG - Intronic
1026662011 7:72310611-72310633 ACGTAAGAGCAGGCCAGGCATGG + Intronic
1027129020 7:75577707-75577729 AAACCAGAGCAGGCTGGGCACGG + Intronic
1027134153 7:75612218-75612240 AAGGCAGAGGAGGCCGGGCACGG + Intronic
1027211009 7:76148965-76148987 AAAAGAGAGAGGGCCCGGCACGG - Intergenic
1027388730 7:77683696-77683718 AAGCAATAGGAGGCCAGGCATGG - Intergenic
1028397421 7:90386537-90386559 TAGCAAGTGCAGGCCAGGCATGG + Exonic
1029086180 7:98013498-98013520 AAGTGTGAGCAGGCCTGGCCAGG - Intergenic
1029522318 7:101071099-101071121 AATCAATAGCAGGCCAGGCATGG + Intergenic
1029647302 7:101866032-101866054 AAACTAGAGGAGGCCAGGCATGG + Intronic
1029662385 7:101971355-101971377 AAGTGAGAGGAGGCTGGGCATGG + Intronic
1030536067 7:110768637-110768659 AAGCGGAAGCTGGCCCGGGAGGG - Intronic
1030789627 7:113707851-113707873 AAGTCAGAACAGGCCAGGCACGG + Intergenic
1032165417 7:129541130-129541152 GAGCAAGACCAGGCCAGGCATGG - Intergenic
1032314238 7:130819958-130819980 AAGCTAGAGTGGGCCGGGCACGG - Intergenic
1032727484 7:134604411-134604433 GAGAGAGAGAAGGCCGGGCACGG + Intergenic
1033686888 7:143648205-143648227 AAGAAAGACCAGGCCGGGCATGG - Intronic
1033688846 7:143719111-143719133 AAGAAAGACCAGGCCGGGCATGG + Intronic
1033697723 7:143809418-143809440 AAGAAAGACCAGGCCGGGCATGG + Intergenic
1034081091 7:148278274-148278296 AAGCCTGAGTAGGCCCGGCTCGG + Intronic
1034441408 7:151087578-151087600 AAGCGGGAGCGGGCCGGGCCTGG + Intronic
1034442679 7:151094802-151094824 AAGGGAGGGGAGGCCAGGCATGG - Intronic
1034724174 7:153319936-153319958 CAGAGAGGGCAGGCCCTGCAAGG - Intergenic
1035476608 7:159148648-159148670 AAGCCAGGCCAGGCCCAGCATGG - Intergenic
1036181886 8:6592955-6592977 AAACAAGAGCCGGCCTGGCACGG - Intronic
1036512059 8:9409784-9409806 AAGTGAAAGCCGGCCGGGCACGG + Intergenic
1036800560 8:11787889-11787911 AAGACAGAGGAGGCCGGGCATGG - Intergenic
1037708639 8:21337640-21337662 AAGAAAGGGCAGGCCGGGCACGG + Intergenic
1038065756 8:23962195-23962217 AAGGAGGAGCAGGCCAGGCATGG - Intergenic
1040513816 8:48118256-48118278 AAGCCAGTGCTGGCCAGGCATGG - Intergenic
1040696629 8:50007296-50007318 AAGAGAAAGCAGGCCAGGTAGGG - Intronic
1041282774 8:56228318-56228340 AAGAGAGAAGAGGCCAGGCACGG + Intergenic
1041331117 8:56725982-56726004 AAGTGAGATCAGGCCAGGCGCGG - Intergenic
1041411855 8:57564916-57564938 AAGCAGGAGGAAGCCCGGCAAGG + Intergenic
1041498349 8:58511908-58511930 AAGAGAGAACAGGCCAGGCGCGG - Intergenic
1042260702 8:66856355-66856377 GAGTGAGAGCGGGCCAGGCACGG - Intronic
1042289944 8:67159810-67159832 AAGAGAGAGAAGGCCGGGCGTGG - Intronic
1042619603 8:70690637-70690659 AAGTGGGAGCTGGCCAGGCACGG - Intronic
1043691411 8:83157838-83157860 AATAGAGAGTAGGCCAGGCATGG - Intergenic
1044531829 8:93316211-93316233 AAGTGAGAGCTGGCCAGGCACGG - Intergenic
1044844084 8:96363171-96363193 AAGTGAAAACAGGCCAGGCATGG - Intergenic
1045124773 8:99077458-99077480 ATGAAAGAGCAGGCCAGGCACGG - Intronic
1045325767 8:101116617-101116639 AAGAGAGGGCAGGCCATGCATGG + Intergenic
1045693829 8:104786048-104786070 AAGCAAGAAGAGGCCAGGCATGG + Intronic
1045893471 8:107185388-107185410 AAGCATGGGCAGGCCGGGCATGG - Intergenic
1046569018 8:115939038-115939060 AAGAGAGAGCAGGTCCTGGAAGG - Intergenic
1049431236 8:142566248-142566270 GAGCCAGAGCTGGCCGGGCAGGG - Intergenic
1051777398 9:20650853-20650875 AATTGAGAGTAGGCCAGGCACGG - Intergenic
1052287163 9:26799329-26799351 AAGAGACAACAGGCCAGGCATGG + Intergenic
1052851315 9:33380186-33380208 ATGGGAGAGCAGGCCAGGCAAGG + Intergenic
1052974855 9:34402780-34402802 CAGCGGGAGCTGGCCCGGAAGGG - Exonic
1053171363 9:35887909-35887931 AAGTGAGAAGAGGCCGGGCATGG - Intergenic
1053199404 9:36142510-36142532 AGGAGAAAGCAGGCCCGGGATGG + Intronic
1053318189 9:37070864-37070886 AAACCAGTGCAGGCCAGGCATGG - Intergenic
1053798192 9:41745259-41745281 AAGCAAGATCAGGCCATGCACGG - Intergenic
1054147007 9:61569688-61569710 AAGCAAGATCAGGCCATGCACGG + Intergenic
1054186606 9:61957309-61957331 AAGCAAGATCAGGCCATGCACGG - Intergenic
1054466741 9:65500747-65500769 AAGCAAGATCAGGCCATGCACGG + Intergenic
1054651899 9:67631211-67631233 AAGCAAGATCAGGCCATGCACGG + Intergenic
1055386096 9:75763552-75763574 AAGTGAGGTCAGGCCAGGCATGG + Intergenic
1056360927 9:85856779-85856801 AAGAGAGAGCTGGCCGAGCACGG + Intergenic
1056583506 9:87913234-87913256 ATAAGACAGCAGGCCCGGCACGG + Intergenic
1056584000 9:87916705-87916727 ATAAGACAGCAGGCCCGGCACGG + Intergenic
1056612869 9:88136221-88136243 ATAAGACAGCAGGCCCGGCACGG - Intergenic
1056613369 9:88139711-88139733 ATAAGACAGCAGGCCCGGCACGG - Intergenic
1057149768 9:92785911-92785933 CAGCCAGAGAAGGCCAGGCATGG - Intergenic
1058685966 9:107479998-107480020 AAACAAAAGCAGGCCCGGCACGG + Intergenic
1058770924 9:108230975-108230997 AAACAAGAACAGGCCAGGCACGG + Intergenic
1061740854 9:132705017-132705039 AAAACAGAGCAGGCCGGGCATGG + Intergenic
1062287721 9:135780537-135780559 AAGCGAGAGGAGGCCGGGCTGGG + Intronic
1062562698 9:137148828-137148850 AGGCGAGGCCAGGCCAGGCAAGG + Intronic
1062575235 9:137203642-137203664 AAGCAAAAGCAGGCCAGGCGTGG - Intronic
1062714287 9:137998318-137998340 AAGCCAGTGTAGGCCGGGCACGG + Intronic
1185509068 X:649326-649348 AAGAGAGAGGAGGCCGGGCGCGG - Intronic
1186767586 X:12786809-12786831 AAGTGAAAGAAGGCCGGGCATGG - Intergenic
1187500995 X:19838596-19838618 ATGGGAGAGCTGGCCGGGCACGG + Intronic
1188234808 X:27715100-27715122 AACTGAGAGTAGGCCGGGCACGG + Intronic
1188707113 X:33348211-33348233 AAGCAGGAGTAGGCCAGGCATGG - Intergenic
1189706860 X:43767544-43767566 CAGCCTGAGCAGGCCTGGCACGG + Exonic
1190010671 X:46781911-46781933 AAGTGAGAGTAGGCCAGGCGTGG + Intergenic
1190707108 X:53038472-53038494 AACCAGGAGCAGGCCAGGCATGG - Intergenic
1190833892 X:54082825-54082847 AAGCAAGAATAGGCCGGGCATGG + Intronic
1192346989 X:70318166-70318188 AAGCAAGGGGAGGCCGGGCATGG - Intronic
1194657726 X:96593619-96593641 AAGCTAGACCAGGCTGGGCATGG - Intergenic
1194737089 X:97525327-97525349 AAGGGAGGGCAGTCCAGGCAGGG - Intronic
1195430631 X:104785304-104785326 AAGAGAGGCCAGGCACGGCATGG - Intronic
1196403375 X:115339217-115339239 ATGAGAGATCAGGCCAGGCATGG + Intergenic
1196645215 X:118110665-118110687 GAGCAAGAGAAGGCCGGGCATGG - Intronic
1198446682 X:136724366-136724388 AAGTGTGAACAGGCCAGGCATGG - Intronic
1199774605 X:150999994-151000016 AAGTGAGTCCAGGCCGGGCATGG + Intergenic
1200211382 X:154348190-154348212 AATCAACAGCAGGCCCGGCCGGG - Intergenic
1200764362 Y:7068009-7068031 AAACTAGAGCAGGCCAGGCGCGG + Intronic
1202115132 Y:21464985-21465007 AACAGAGAGGAGGCCAGGCAAGG - Intergenic
1202381825 Y:24280531-24280553 AAGCGGCACCAGGCCTGGCAGGG - Intergenic