ID: 953888355

View in Genome Browser
Species Human (GRCh38)
Location 3:46732903-46732925
Sequence ACGTGGACAACTCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 115}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953888355_953888360 -10 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888360 3:46732916-46732938 TTGTCCACGTTTGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 59
953888355_953888363 -6 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888363 3:46732920-46732942 CCACGTTTGCTAAGGTGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 83
953888355_953888361 -7 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888361 3:46732919-46732941 TCCACGTTTGCTAAGGTGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 71
953888355_953888364 -3 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888364 3:46732923-46732945 CGTTTGCTAAGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 171
953888355_953888367 10 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888367 3:46732936-46732958 GGGAGGGAGGGCCATTTCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 284
953888355_953888371 27 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888371 3:46732953-46732975 CCTGGGATGGTGATTGATAAAGG 0: 1
1: 0
2: 1
3: 16
4: 153
953888355_953888368 14 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888368 3:46732940-46732962 GGGAGGGCCATTTCCTGGGATGG 0: 1
1: 0
2: 0
3: 37
4: 283
953888355_953888366 9 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888366 3:46732935-46732957 TGGGAGGGAGGGCCATTTCCTGG 0: 1
1: 0
2: 0
3: 23
4: 280
953888355_953888365 -2 Left 953888355 3:46732903-46732925 CCCCATCACAGAGTTGTCCACGT 0: 1
1: 0
2: 0
3: 14
4: 115
Right 953888365 3:46732924-46732946 GTTTGCTAAGGTGGGAGGGAGGG 0: 1
1: 0
2: 5
3: 29
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953888355 Original CRISPR ACGTGGACAACTCTGTGATG GGG (reversed) Intronic
900642829 1:3695513-3695535 ACGTGGCCACCCCTGTGCTGAGG + Intronic
903502329 1:23807959-23807981 AAGTGTACAGCTCTGTGTTGGGG - Intronic
903954891 1:27018557-27018579 ACCTGAACAACACTGTGATGGGG + Intergenic
904022003 1:27473968-27473990 ACACGAACAATTCTGTGATGCGG + Intronic
913547777 1:119886415-119886437 ATGTGGACGACTGTGTCATGGGG + Intergenic
916919434 1:169448103-169448125 ACTGGGACAACTCTGTTATTAGG - Intronic
918609746 1:186475060-186475082 ACTTGCACATCTTTGTGATGTGG - Intergenic
919701818 1:200638880-200638902 ACGTGCACACCTTTGGGATGTGG - Intronic
924250041 1:242123571-242123593 ACTTGCACAGCTCTGAGATGTGG + Intronic
1062889948 10:1050752-1050774 ACGTGCACACCTCTGGGATGTGG + Intronic
1066353433 10:34658886-34658908 ACGTGGTGAACTCTGTGAATGGG - Intronic
1074701790 10:116098723-116098745 AACTGAACAACACTGTGATGAGG + Intronic
1075396403 10:122130894-122130916 TTGTGGAAAACTCTGTGGTGTGG - Intronic
1075847070 10:125553448-125553470 ACTGGGACAACTCTGAGATGTGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078605034 11:12767590-12767612 AAAAGGACAACTCTATGATGAGG + Intronic
1079781534 11:24612227-24612249 ACTTGGACAAATTAGTGATGGGG + Intronic
1082701596 11:56438655-56438677 ACGTGCACATCTCTGGGATGTGG + Intergenic
1092970755 12:13692537-13692559 ACGTGCACAGCTTTGAGATGTGG - Intronic
1098863606 12:75737030-75737052 ACGTGCACATCTCTGGAATGTGG + Intergenic
1101986626 12:109452154-109452176 ACATGTACAACTCTGTGTGGTGG - Intronic
1108522673 13:51259737-51259759 AGGTGGCCAAGCCTGTGATGTGG - Intronic
1109825523 13:67716137-67716159 AATAGGACAACTCTGTGATCAGG + Intergenic
1109886125 13:68547544-68547566 ACGTGTACATCTTTGGGATGTGG - Intergenic
1110641360 13:77828434-77828456 TTATGGACAACTCTCTGATGAGG + Intergenic
1115268949 14:31530219-31530241 ATGAGGATAAATCTGTGATGAGG + Intronic
1115283470 14:31690979-31691001 ACATGGACACTTCTATGATGCGG + Intronic
1119599127 14:75963056-75963078 ATGAGGAAAACTCTGTGAGGAGG - Intronic
1121154734 14:91672084-91672106 ACATGGGAAACTCAGTGATGAGG - Intronic
1131686396 15:94772629-94772651 ACGTGCACAGCTTTGGGATGTGG - Intergenic
1134033663 16:11013066-11013088 ACATGTACATCTCTGGGATGAGG + Intronic
1135991961 16:27223776-27223798 ACGTGGACACCTGTGAGGTGGGG - Intergenic
1136568010 16:31081418-31081440 ACGGGTACAACCCTGTGGTGTGG - Exonic
1140447038 16:75037907-75037929 ATGTGGAAAAGTCTATGATGAGG + Intronic
1141291313 16:82720564-82720586 ACATGCACAACTTTGGGATGTGG + Intronic
1144270581 17:13611604-13611626 AAGCAGAAAACTCTGTGATGGGG + Intergenic
1146647456 17:34584637-34584659 AGGAGGACAACTCTGTATTGAGG + Intronic
1153757163 18:8295644-8295666 ATGTGGTCAACTATGTGAGGAGG - Intronic
1165561105 19:36680787-36680809 AGGTGGAAATCTCAGTGATGGGG - Intergenic
1168309582 19:55453623-55453645 GGGTGGACAGCTCTGTGCTGGGG + Intronic
925002632 2:418055-418077 ACGTGGAAAACTCACTCATGTGG - Intergenic
926005813 2:9372858-9372880 ACGTGCACAGCTTTGGGATGTGG + Intronic
926170898 2:10552042-10552064 GCGGGGCCAAGTCTGTGATGGGG + Intergenic
926390997 2:12392772-12392794 ACTGGGACAGCTCAGTGATGTGG - Intergenic
926961407 2:18362281-18362303 AAGTGGCCACCTCTGTGTTGGGG + Intergenic
927810388 2:26177303-26177325 ACGGGGACGTCTCTGGGATGGGG - Intronic
928948261 2:36791493-36791515 AAGTTAACAACTCTGAGATGGGG + Intronic
931895404 2:66723544-66723566 ACATGCACATCTCTGAGATGTGG - Intergenic
932289855 2:70567649-70567671 ACATGCACATCTCTGGGATGTGG + Intergenic
932556704 2:72831041-72831063 ACGTGAACATCTTTGGGATGTGG + Intergenic
937238803 2:120447092-120447114 ACGTGCAGAATTCTGAGATGTGG - Intergenic
939355109 2:141091519-141091541 ACGTGCACAACTTTGGAATGTGG - Intronic
939478368 2:142715744-142715766 ACGTGGACATCTTAGGGATGGGG + Intergenic
939805147 2:146766634-146766656 ATGTGCACATCTCTGTGATGAGG - Intergenic
942332824 2:174846038-174846060 AGTTAGACAACTTTGTGATGCGG - Intronic
943724227 2:191236561-191236583 ACCTGGACATCTCAGTGATAGGG + Intergenic
948186160 2:236023179-236023201 ACCTGGAGAACTGTGTGAAGAGG + Intronic
1173603272 20:44311019-44311041 ACGGGGACAACTCCTTGAGGAGG + Exonic
1173739743 20:45390667-45390689 ATGTGCACATCTCTGGGATGTGG - Intronic
1174246365 20:49184446-49184468 ACGTGCACAGCTTTGGGATGTGG + Intronic
1174905933 20:54551362-54551384 ATGTGAAAAACTCTGTGAAGAGG - Intronic
1182551136 22:31101242-31101264 AGGTGGGCAGCACTGTGATGGGG + Intronic
1183006965 22:34911617-34911639 ATGTTGACAACTCTTTGACGTGG + Intergenic
1184558216 22:45245204-45245226 ACGTGGGCAAGCCTGAGATGTGG + Intergenic
949214160 3:1545274-1545296 ACGTGCACAGCTTTGGGATGTGG - Intergenic
951123435 3:18956354-18956376 CCCTTGACAGCTCTGTGATGTGG - Intergenic
952446133 3:33382844-33382866 ACCTACACAACTCTGTGATCTGG + Intronic
953813341 3:46132943-46132965 ACCTGGCCAGCTCTGTGAGGGGG + Intergenic
953888355 3:46732903-46732925 ACGTGGACAACTCTGTGATGGGG - Intronic
955512878 3:59698768-59698790 ACATGGACACCACTCTGATGGGG + Intergenic
956088134 3:65635462-65635484 ATTTGGACAACTTTATGATGTGG - Intronic
957162665 3:76630199-76630221 ACATGCACATCTTTGTGATGTGG - Intronic
960089377 3:113623666-113623688 TCGTGGCCACCGCTGTGATGTGG + Exonic
960971968 3:123146158-123146180 ACGTAGGAAACTCTGAGATGTGG - Exonic
961401845 3:126652612-126652634 ACATGGACATCTTTGGGATGTGG - Intronic
962436706 3:135373625-135373647 AAGTGGTCAACTCTGTCATATGG - Intergenic
964290052 3:155168327-155168349 GCTTTGCCAACTCTGTGATGAGG + Intronic
965135977 3:164768721-164768743 ATGTGGTCAAGTCTGTGAAGTGG + Intergenic
975411439 4:74055868-74055890 AAGAGGACAACTCTGGTATGAGG + Intergenic
976499759 4:85774127-85774149 ACATGGCCACCTCTCTGATGTGG + Intronic
978378604 4:108102499-108102521 AGTTGGACAAGTCTGTGATGAGG + Intronic
983252459 4:165360236-165360258 ACATGCACATCTCTGGGATGTGG + Intergenic
983685773 4:170407082-170407104 ACGTGCACAGCTTTGGGATGTGG - Intergenic
986290588 5:6396283-6396305 CCGGGGACCACTCTGTGCTGTGG - Intergenic
987785637 5:22494831-22494853 ACAAGGAGTACTCTGTGATGAGG + Intronic
998050766 5:139032034-139032056 ACATGGACAACTGTGTCATCTGG + Intronic
998058547 5:139100434-139100456 GCCTGCACAGCTCTGTGATGCGG - Intronic
998531689 5:142890896-142890918 ACTTGGGCAGCTCTCTGATGTGG + Intronic
999739918 5:154542297-154542319 ACAAGGTCAACTGTGTGATGCGG - Intergenic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1003197496 6:3928168-3928190 ACCTGGATAACTCTGTTGTGGGG + Intergenic
1004845938 6:19642159-19642181 ATGTGGACAACTTTAAGATGAGG - Intergenic
1005510136 6:26505288-26505310 AAGTAGACAACTCTGCCATGAGG - Intronic
1006148539 6:31973460-31973482 AAGTGGTTAATTCTGTGATGTGG + Intronic
1010986932 6:82435500-82435522 AAGTGGTCAACTTTGTTATGAGG + Intergenic
1019117650 6:169778092-169778114 ACGTGCACAGCTCTGGGATGTGG + Intronic
1019121108 6:169804564-169804586 GTGTGGACAGCTCTGTGGTGTGG - Intergenic
1019121119 6:169804722-169804744 ATGTGGAGAACTATGTGGTGTGG - Intergenic
1019121285 6:169806755-169806777 ATGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121298 6:169806876-169806898 ATGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121300 6:169806893-169806915 ATGTGGAGAGCTCTGTGATGTGG - Intergenic
1019121308 6:169807016-169807038 ATGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121329 6:169807374-169807396 ATGTGGAGAGTTCTGTGATGTGG - Intergenic
1019811196 7:3166285-3166307 ACGTGGAGATCACAGTGATGTGG + Intronic
1021109979 7:16682423-16682445 ACTTAGACAACGATGTGATGGGG - Intronic
1023109653 7:36796475-36796497 ACGTGCACATCTTTGGGATGCGG - Intergenic
1024153615 7:46598224-46598246 ATGTGCATAACTCTGGGATGAGG - Intergenic
1029346649 7:99983562-99983584 AAGGGGACAACACTGTGCTGTGG - Intergenic
1029941687 7:104487518-104487540 ACGTGCACATCTTTGGGATGTGG + Intronic
1032810407 7:135408694-135408716 ACGTGCACAGCTTTGGGATGTGG + Intronic
1034358264 7:150471239-150471261 ACTTGGAGAATTCTCTGATGGGG + Intronic
1035130012 7:156642754-156642776 ACGTGCACAGCTTTGGGATGTGG + Intronic
1037196685 8:16199216-16199238 ATGTGGACACCTTTGTGAGGAGG - Intronic
1040596626 8:48844435-48844457 ATGTGGAAATATCTGTGATGTGG + Intergenic
1042560203 8:70068233-70068255 ACGGAGACAATTCTGTGATGTGG - Exonic
1048527914 8:135221468-135221490 ATGTGAACAGCTCTGTGATGGGG + Intergenic
1052795477 9:32919735-32919757 ACGTGTACAGCTTTGGGATGTGG - Intergenic
1054731706 9:68707247-68707269 ACGTGGACAAAAATGTAATGTGG - Intronic
1056163143 9:83918246-83918268 ACGTGGACAACACTATAATGTGG + Intronic
1058727245 9:107815979-107816001 ACATGACCAACTCTGTGATGAGG + Intergenic
1059641175 9:116218450-116218472 AGGTGGACACCTCTGGGAAGTGG + Intronic
1061289770 9:129643958-129643980 AGGAGGCCAACGCTGTGATGTGG - Intergenic
1061711492 9:132490937-132490959 ATGTGCACATCTCTGGGATGTGG - Intronic
1187686756 X:21823087-21823109 ACGTGCACAGCTTTGGGATGTGG + Intergenic
1188525986 X:31088392-31088414 ACGTGCACAACTTTGAGATGTGG - Intergenic
1192337108 X:70230926-70230948 TTCTTGACAACTCTGTGATGTGG + Intergenic
1200841867 Y:7790296-7790318 ACGTGGACACCTTTGGGATGTGG - Intergenic