ID: 953890830

View in Genome Browser
Species Human (GRCh38)
Location 3:46750617-46750639
Sequence AGTCCCCCGCCTCCAAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 305}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953890820_953890830 6 Left 953890820 3:46750588-46750610 CCCAGGAGTAGGCAGCCACACCC 0: 1
1: 0
2: 2
3: 14
4: 188
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305
953890818_953890830 11 Left 953890818 3:46750583-46750605 CCCGACCCAGGAGTAGGCAGCCA 0: 1
1: 0
2: 1
3: 19
4: 288
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305
953890821_953890830 5 Left 953890821 3:46750589-46750611 CCAGGAGTAGGCAGCCACACCCC 0: 1
1: 0
2: 1
3: 23
4: 197
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305
953890824_953890830 -9 Left 953890824 3:46750603-46750625 CCACACCCCGGGCCAGTCCCCCG 0: 1
1: 0
2: 2
3: 39
4: 777
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305
953890815_953890830 22 Left 953890815 3:46750572-46750594 CCGCAAAAATCCCCGACCCAGGA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305
953890817_953890830 12 Left 953890817 3:46750582-46750604 CCCCGACCCAGGAGTAGGCAGCC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305
953890819_953890830 10 Left 953890819 3:46750584-46750606 CCGACCCAGGAGTAGGCAGCCAC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953890830 Original CRISPR AGTCCCCCGCCTCCAAGGCC AGG Intronic
900612138 1:3548732-3548754 GGTCCCCAGCTTCCCAGGCCTGG + Intronic
900938391 1:5781444-5781466 AGCCCCCCACCTCAAAGGCGAGG - Intergenic
900971566 1:5994892-5994914 AGGCCCCTCCCTCCAAGCCCAGG - Intronic
901233190 1:7652509-7652531 AGGCCCCAGCCAGCAAGGCCTGG + Intronic
901934773 1:12619607-12619629 AGTCCCCCGATTGCAAGGTCAGG - Intergenic
902140426 1:14349245-14349267 AGTCCTCATCCTCCAAGGCAGGG - Intergenic
902930221 1:19725905-19725927 ACTCCTCAGCCCCCAAGGCCTGG - Intronic
903557484 1:24204225-24204247 AGCCTTCCGCCTCCCAGGCCAGG - Intergenic
903648979 1:24911706-24911728 GATCCCCCGACTCCAAGCCCAGG + Intronic
903856139 1:26338396-26338418 AGTACCCCACCTCAGAGGCCTGG - Exonic
904003535 1:27351396-27351418 AGTCCACCGCCCCCAAACCCGGG - Intronic
904237157 1:29123219-29123241 ACTCTCCCGCGTCCAAAGCCTGG + Intronic
905567863 1:38980137-38980159 AGGCGCCCGCCACCAAGCCCGGG - Intergenic
905861594 1:41355591-41355613 GGTCCACTGCCTCCATGGCCTGG + Intergenic
907319612 1:53594352-53594374 AGCCCCAGGCCTCCAAGGCTTGG + Exonic
907627177 1:56041649-56041671 ACTCCCCAGCCTCCAGGGCTGGG - Intergenic
908293170 1:62688139-62688161 ACCCACCCGCCTCCTAGGCCAGG + Intronic
911317367 1:96371233-96371255 AGGCGCCCGCCACCAACGCCCGG + Intergenic
911627476 1:100141471-100141493 AGTCCCACGCCACCATGCCCAGG + Intronic
913323787 1:117608432-117608454 ATTCCCCCGTGTTCAAGGCCAGG + Intronic
914850092 1:151307875-151307897 GGTCCCCGGCCTGCATGGCCAGG - Intronic
915098127 1:153478459-153478481 AGTCCCACCCCTCCATGCCCGGG - Intergenic
915129687 1:153687934-153687956 AGTCCCCCGCCCCCATGCCTTGG + Intronic
915623273 1:157099042-157099064 ACTCCCACCCCTCCAAGGCTTGG - Intronic
915959149 1:160249973-160249995 ATTCCCCTACCTCCAAGCCCTGG - Intronic
917345273 1:174022484-174022506 AGTCACCGGCCACCAACGCCCGG + Intergenic
919744108 1:200998268-200998290 AGTCCCTTGCCTAGAAGGCCAGG + Intronic
919782662 1:201230897-201230919 TGTCCCAGGCCTCCAAGGGCAGG - Intergenic
919878014 1:201884725-201884747 AGTCCCAGGCAGCCAAGGCCTGG - Intergenic
922698222 1:227742674-227742696 GGTCCCTCCCCTCGAAGGCCAGG + Intronic
922917669 1:229271433-229271455 AGACCCCCGCAGCCCAGGCCCGG - Intronic
923076122 1:230610270-230610292 GGTCTCCTGCATCCAAGGCCAGG - Intergenic
923631092 1:235649897-235649919 AGCCCCCAGCGTCCAGGGCCGGG - Exonic
923665408 1:235994304-235994326 AGGCACCCGCCACCAAGCCCAGG + Intronic
1063388927 10:5635905-5635927 AGCACCCCGCCTCCACGGGCTGG + Intergenic
1064335168 10:14433863-14433885 AGGCCCCTACCTCCAAGACCAGG - Intronic
1065390653 10:25177245-25177267 AATTCCCCGCCTCAAAGGTCAGG - Intronic
1067656309 10:48194586-48194608 AGTCCCCTGCCTCTAAGGGATGG - Intronic
1068193648 10:53687153-53687175 AGGCACCCGCCACCACGGCCCGG + Intergenic
1069253897 10:66308206-66308228 AGGCACCCACCTTCAAGGCCTGG - Intronic
1069428592 10:68312751-68312773 AGGCGCCCGCCACCATGGCCTGG + Intronic
1070592322 10:77809974-77809996 AGTGCCCCTGCTCCCAGGCCCGG + Intronic
1073207246 10:101775739-101775761 GGTCCTCTGCCTCCAAGCCCAGG - Exonic
1073920540 10:108453138-108453160 AGTACACAGCCACCAAGGCCTGG + Intergenic
1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG + Intergenic
1076383502 10:130040687-130040709 AGGCACCCGCCACCAAGCCCGGG - Intergenic
1076944554 10:133637414-133637436 GGTTCGCCTCCTCCAAGGCCCGG - Intergenic
1077047156 11:551711-551733 AGTCCCGGGCCTCCAGGCCCTGG + Exonic
1077049355 11:559901-559923 AGGCACCCGCCTCCACCGCCAGG + Intronic
1077462255 11:2716485-2716507 TGTCCCCAGCCTCCAGGGCCAGG + Intronic
1078415106 11:11158280-11158302 GGTCCCCCTCCTGCAAGGTCTGG - Intergenic
1079434210 11:20429422-20429444 AGTCCCCAGCCCCCAAGCCAGGG - Intronic
1079553229 11:21727185-21727207 AGTCCCCCTCCTCCCAGGGAGGG - Intergenic
1081671075 11:44943014-44943036 GGTCCCCTGCCCCCAAAGCCGGG - Intronic
1081770944 11:45650383-45650405 AGTCCCCCTCCTCCAGGACCAGG + Exonic
1083299131 11:61731153-61731175 AGTGTCCTTCCTCCAAGGCCTGG + Intronic
1083389520 11:62337682-62337704 CGCCGCCCGCCTCCAAGCCCCGG - Intronic
1084838668 11:71827227-71827249 AGCCCCTCCCCTCAAAGGCCTGG + Intergenic
1085023306 11:73222272-73222294 AGTCCCCCTCCTACAAGCCAGGG - Intronic
1085126190 11:74004294-74004316 AGTCTCCAGCCTCCCAGCCCAGG + Intronic
1087151971 11:94867502-94867524 AGTCCTCCGGCTCCCAGGCCTGG - Intronic
1088715702 11:112547400-112547422 ACTCCCCCGTCTCCTAGGCCAGG + Intergenic
1089110503 11:116052214-116052236 AGTCCCCCAACTCTAAGCCCAGG - Intergenic
1089607847 11:119652000-119652022 AGCCCCCTGCCTCCTAGTCCAGG + Intronic
1090387122 11:126363863-126363885 ACTCCCCACCCTCCCAGGCCCGG + Intronic
1090785408 11:130043853-130043875 AATCTCCCGCCTGCAAAGCCAGG + Intergenic
1091847674 12:3669826-3669848 TGTCCCCAGCCTCCCAGGCTGGG - Intronic
1092400011 12:8166862-8166884 AGCCCCTCCCCTCAAAGGCCTGG - Intronic
1092528855 12:9327691-9327713 AGTCCAGCGCCTCCAAGACTTGG - Intergenic
1096212335 12:49776302-49776324 TGTCCCCCGCCTCCCATGCCAGG + Intergenic
1096788510 12:54031234-54031256 CGCCCCCCGCCTCCAACTCCCGG - Intronic
1096935392 12:55268618-55268640 AGTCCCTCACATCAAAGGCCTGG + Intergenic
1097248036 12:57617328-57617350 AGACCCCCTCCTCCAATGGCTGG - Intronic
1099532622 12:83803495-83803517 AGGCGCCCGCCACCACGGCCCGG - Intergenic
1100362654 12:93892642-93892664 AGGGCCCCCCTTCCAAGGCCAGG - Intronic
1100815213 12:98380462-98380484 AGTCCCCTGCCCCCAAGGACTGG + Intergenic
1101831791 12:108263608-108263630 AGTCCCCTGCCTCCAGATCCAGG + Intergenic
1102678058 12:114672011-114672033 AGTCCACTGCCACCGAGGCCGGG + Exonic
1104557237 12:129811858-129811880 AGTCCCCCAACTCCAAGACACGG + Intronic
1104908976 12:132230534-132230556 ACTCCCCCGCCACGAGGGCCAGG - Intronic
1105431307 13:20339925-20339947 TGTCCCCCGCCACCAAGCCCAGG - Intergenic
1106892706 13:34263431-34263453 AGGCGCCCGCCACCAAGCCCGGG - Intergenic
1107480764 13:40784377-40784399 AGGCACCCGCCACCATGGCCAGG + Intergenic
1110448836 13:75618308-75618330 AGCACCCCTCCTCCAAGCCCAGG - Intergenic
1113766927 13:112887665-112887687 AGGCCACGGCCTCCAAGGCCAGG - Intergenic
1114612446 14:24051818-24051840 TGCCCCCCGCCCCGAAGGCCCGG + Intergenic
1117365983 14:55027497-55027519 AGACCCCGGCCTGCGAGGCCAGG - Intronic
1118320471 14:64749513-64749535 AGCCCCCCACCTCCCGGGCCAGG + Exonic
1119219399 14:72893697-72893719 AGTCCCCCGCCTCGCGGGCAGGG - Intronic
1119656668 14:76422088-76422110 AGTCCCCTCCCTCAAAGGCCTGG + Intronic
1119721734 14:76896288-76896310 AGACCCCCGACTTCAAGTCCAGG + Intergenic
1121038508 14:90726398-90726420 AATGCCCTGCCTCCAAGCCCTGG + Intronic
1121332213 14:93056691-93056713 AGTGCCCCTCCTCCAGAGCCTGG + Intronic
1121417345 14:93788529-93788551 AGTCCCCCGCCCTCTAGGCGGGG + Intergenic
1122272739 14:100575678-100575700 AGACCAGGGCCTCCAAGGCCAGG + Intronic
1122418456 14:101561254-101561276 AGTCCCCCGCCCCCGAGAGCTGG + Intergenic
1122716458 14:103699439-103699461 AGGCCTCCGCCCCCAGGGCCAGG - Exonic
1124338744 15:28876399-28876421 AACTCCCAGCCTCCAAGGCCTGG + Intergenic
1124652939 15:31486252-31486274 AGTCCTGCGTCTCAAAGGCCTGG - Intronic
1124880523 15:33638319-33638341 AGTCCCCTCCCTCTGAGGCCAGG + Intronic
1124983479 15:34584043-34584065 ACTCCCCAGCCAGCAAGGCCGGG - Intronic
1125795744 15:42402834-42402856 TGTACAACGCCTCCAAGGCCAGG + Exonic
1127693390 15:61419592-61419614 AGGCGCCCGCCACCAAGCCCCGG - Intergenic
1128157690 15:65402130-65402152 AGACCCCAGACTCCAAGGGCAGG - Intronic
1128802113 15:70503599-70503621 AGTCCCCTGGCTCCCTGGCCTGG + Intergenic
1129178174 15:73854997-73855019 AGTCCCCAGCCTCTAAAGCCAGG - Intergenic
1129366011 15:75055361-75055383 AGGCACCCGCCACCATGGCCCGG + Intronic
1129388912 15:75210836-75210858 AGTCACCGGCCCCCAAGGTCAGG + Exonic
1129461607 15:75702651-75702673 AGTCCCCTGCCTCTGAGCCCTGG - Intronic
1131063135 15:89416701-89416723 AGCCCCGCGCTTCCCAGGCCAGG - Intergenic
1132517723 16:373612-373634 ACTCCAACGCCTCCAATGCCTGG + Intronic
1132731964 16:1367094-1367116 CGTCCACCGCCTCCAGGTCCAGG + Intronic
1132767705 16:1542801-1542823 GGCCCCTCGCCTGCAAGGCCGGG - Intronic
1133466895 16:6036071-6036093 AGTCCCCTCCCTTCAAAGCCTGG + Intronic
1136000579 16:27289541-27289563 AGGCACCCGCCACCAATGCCTGG + Intronic
1136027853 16:27481522-27481544 AGCCTCCCTCCTCCCAGGCCTGG + Intronic
1137000016 16:35221586-35221608 AGTTCACCTTCTCCAAGGCCCGG - Intergenic
1137013089 16:35344101-35344123 AGTTCGCCTTCTCCAAGGCCCGG - Intergenic
1137665540 16:50246880-50246902 GGTCCCCTCCCTCAAAGGCCAGG + Intronic
1138434269 16:56988631-56988653 GCTCCCCTGCCTCCCAGGCCTGG - Intergenic
1139224220 16:65218477-65218499 AATCCCCCTCCACCAGGGCCTGG + Intergenic
1141690391 16:85593357-85593379 AGTGCCTCCCCTCCAGGGCCTGG + Intergenic
1141908059 16:87040744-87040766 TGTCCCACGCTGCCAAGGCCTGG - Intergenic
1142231495 16:88902190-88902212 CGTCCCCCGCCCCCCAGCCCAGG - Intronic
1142835373 17:2581885-2581907 AGGCGCCCGCCACCATGGCCAGG - Intergenic
1142953866 17:3506795-3506817 AGGCACCCGCCACCAAGCCCAGG - Intronic
1143101206 17:4505784-4505806 TGTCCCCAGCCTCCAAGCTCTGG - Intronic
1143112473 17:4560116-4560138 GGTCCCCAGCCCCCAAGTCCTGG - Intronic
1144451953 17:15388577-15388599 AGTCCTCTGCCTCCAAGCCTGGG + Intergenic
1145710324 17:26965411-26965433 ACCCCACCGCCACCAAGGCCCGG + Intergenic
1145899488 17:28480966-28480988 AGGACCCAGCCTCAAAGGCCAGG + Intronic
1146058375 17:29592323-29592345 AGTCCCCTCCCTCCAGGGACTGG + Intronic
1146258325 17:31404718-31404740 AGTCCCCCGCCCCCACCGCAGGG - Intronic
1147157326 17:38550872-38550894 AGTCATCCGCCTCCACGGCTTGG - Intronic
1147998442 17:44374431-44374453 TGGCCCTCTCCTCCAAGGCCCGG + Exonic
1148029260 17:44608540-44608562 TGGCCCCCTCCCCCAAGGCCTGG + Intergenic
1149467032 17:56888166-56888188 AGTCCCCCGCCCCATAGGTCAGG + Exonic
1149521086 17:57318717-57318739 ACTCCTCGGACTCCAAGGCCTGG - Intronic
1149841202 17:59966141-59966163 AGGCGCCCGCCACCAAGCCCGGG - Intronic
1150336963 17:64337321-64337343 AGTCCCCTGACTCCGAGACCAGG - Intronic
1151360460 17:73585566-73585588 AATCCCCCATCTCCATGGCCAGG + Intronic
1151642259 17:75405130-75405152 AGTCCCCCGCCGCCAGGCTCGGG + Exonic
1152021822 17:77783819-77783841 AGTCCCCAGCCACCATGTCCAGG - Intergenic
1152626590 17:81390532-81390554 TGTCCCCCCACTCCAAGGCACGG + Intergenic
1152911789 17:83009494-83009516 AGTCCCCCCACTGCACGGCCTGG + Intronic
1154114229 18:11597016-11597038 AGTCGCCCGCCACCACGCCCGGG - Intergenic
1157776797 18:50402306-50402328 AGTCCAGCGCCTCCAAGACTTGG + Intergenic
1157828468 18:50834116-50834138 ACTCCCCAGCCCCCAAGGCAGGG + Intergenic
1160204468 18:76822178-76822200 AGCCCCGCGCCTCCGTGGCCCGG - Exonic
1160844556 19:1160671-1160693 AGGCACCCGCCACCACGGCCCGG + Intronic
1161192288 19:2964765-2964787 AGTCCCCTGCCACCACGCCCAGG - Intergenic
1161301920 19:3546975-3546997 AGGCACCCGCCACCAACGCCCGG + Intronic
1161346409 19:3770761-3770783 CCTCCCCCGCCTCCTGGGCCCGG - Exonic
1161497770 19:4597024-4597046 AGGCGCCCGCCACCAAGCCCGGG + Intergenic
1161581897 19:5085720-5085742 AGGCCCTCGCCGCCCAGGCCAGG - Intronic
1161660594 19:5543423-5543445 AGGCGCCCGCCACCAATGCCCGG - Intergenic
1162356810 19:10190967-10190989 AGGCGCCCGCCACCAAGCCCAGG - Intronic
1162731980 19:12723816-12723838 AGTCCCGGGCCTCCAAGGTTAGG + Exonic
1163556896 19:17998308-17998330 CCTCCCCTGCCTCCCAGGCCCGG + Exonic
1166305980 19:41937270-41937292 AGTCCACCGCCGGCAGGGCCAGG - Intergenic
1166307019 19:41940804-41940826 CGGCCCCAGCCTCCAAGGGCGGG + Intergenic
1166765110 19:45248257-45248279 ATTCCCCAGCCTCCAACCCCTGG + Intronic
1167166512 19:47803113-47803135 AGGGCCCCGGCTCCAAGGCCTGG + Intronic
1167175333 19:47860651-47860673 GGGCCCCCGGCTCCCAGGCCTGG - Intergenic
1167579448 19:50333108-50333130 AGTCCCCCGTCTCCAAAACTAGG + Intronic
1168475336 19:56671079-56671101 AGTCACACACCTGCAAGGCCTGG + Intronic
1168629667 19:57947190-57947212 GGGCACCCGGCTCCAAGGCCAGG - Intronic
926129238 2:10290481-10290503 AAACCCCCGCCTCCCAGGCGTGG - Intergenic
926575276 2:14573392-14573414 GGTCCCCTGACTCCCAGGCCAGG - Intergenic
927213147 2:20650939-20650961 AGGCCGCCGCCTCCTAGGCCAGG - Intronic
928700239 2:33891606-33891628 CGTCCCCCGTCCCCAAGTCCTGG - Intergenic
929865374 2:45712841-45712863 GGTCCCCGCCCTCCAAGGACAGG - Intronic
931868341 2:66434453-66434475 ACTCCCCCACCTCCTAGCCCCGG - Intronic
936385289 2:112023532-112023554 GGGCCCCCGTCTTCAAGGCCAGG + Intronic
940640636 2:156342008-156342030 AGTCCCCCGACTCTAGGTCCAGG + Intronic
941570008 2:167159015-167159037 AGGCCCCTTCCTCCAAGGCTAGG + Intronic
942072423 2:172327828-172327850 AGTCCCCCATCTGCACGGCCTGG - Intergenic
942346095 2:175004827-175004849 AGGCCCCCGCCCCCGAGCCCCGG + Intronic
946299690 2:218814934-218814956 ACTCCCCCGTCTCCGGGGCCAGG - Exonic
946359905 2:219213056-219213078 AGTCTCCCGCCTGCAAGGAAAGG + Exonic
946692662 2:222320462-222320484 AGTCCCCCGCCCCCTACGCGGGG + Intergenic
948009077 2:234636476-234636498 AGTCCCTCCCCTCACAGGCCTGG + Intergenic
948053755 2:234996599-234996621 AGACCACAGCCTCCAGGGCCAGG - Intronic
948582749 2:238999026-238999048 AGTCCTCTGACTCCAAGCCCTGG + Intergenic
1168961713 20:1874566-1874588 TTTCCCCCTCCCCCAAGGCCAGG - Intergenic
1168961908 20:1875832-1875854 TGTCCCCCCACCCCAAGGCCTGG - Intergenic
1172316775 20:33961499-33961521 AGGCCCATGCCACCAAGGCCAGG - Intergenic
1173841858 20:46162679-46162701 AGTCTCCTGCATCCAAGCCCGGG + Intergenic
1174695374 20:52551559-52551581 AGTCCACTGGCTCCAAGCCCAGG + Intergenic
1174831287 20:53814534-53814556 AGGCGCCCGCCACCAAGCCCGGG - Intergenic
1175093805 20:56525816-56525838 AGTTGGCCGCCTCGAAGGCCAGG - Exonic
1175307556 20:57987364-57987386 AGCCCCCAGACTCCAAGGCCAGG + Intergenic
1175924943 20:62466981-62467003 GGACACCCGCCTCCCAGGCCGGG + Intronic
1177676780 21:24310347-24310369 AGGCGCCCGCCACCACGGCCCGG + Intergenic
1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG + Intronic
1180078139 21:45473510-45473532 AGTCCCCCAACCCCAAGTCCCGG - Intronic
1180594289 22:16963351-16963373 GGTCCCCCGCATCAATGGCCGGG + Intronic
1181444665 22:22959750-22959772 AGTCCCCCGTCTCCACCCCCAGG - Intergenic
1181559134 22:23689692-23689714 AGTCCGCCATCTCCAAGGCAAGG - Intronic
1181601070 22:23952183-23952205 AGTCCCCATCCTTCAAGGCCCGG - Intergenic
1181607439 22:23989143-23989165 AGTCCCCATCCTTCAAGGCCCGG + Intergenic
1181689518 22:24550770-24550792 CTTCCCCAGCCTTCAAGGCCTGG + Intronic
1181741770 22:24926707-24926729 AGTCCCACGCATCCAATTCCAGG - Intronic
1183831995 22:40423133-40423155 TGTTCCCCTCCTTCAAGGCCTGG - Intronic
1183893145 22:40947532-40947554 AGGCACCCGCCACCAACGCCTGG - Intergenic
1184101740 22:42344504-42344526 ACTCGCGCGCCTCCCAGGCCAGG - Intergenic
1184119951 22:42443726-42443748 GATCCCCTGCCTCCAAGTCCTGG - Intergenic
1184437661 22:44489182-44489204 AGTCCCGCGTCCCCCAGGCCCGG + Intergenic
1184602094 22:45549650-45549672 ACTCCCCAGCCTCAAAGGCCCGG - Intronic
1184669109 22:46003533-46003555 AGGCGCTGGCCTCCAAGGCCAGG - Intergenic
949477143 3:4458710-4458732 AGGCGCCCGCCACCAACGCCTGG - Intronic
950529871 3:13547088-13547110 AGTGCCTCTCCTCCCAGGCCTGG + Intergenic
951956334 3:28258761-28258783 AGGCACCCGCCACCAAGTCCGGG + Intronic
952264898 3:31775797-31775819 TCTCCCGCTCCTCCAAGGCCTGG - Intronic
953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG + Intronic
954646780 3:52136425-52136447 AGTCCCCCTCTTCCCAGGCCAGG + Intronic
957083595 3:75658991-75659013 AGTTCGCCTTCTCCAAGGCCCGG + Intergenic
960155250 3:114291989-114292011 AGTCTCCAGACTCCAAGGCCAGG - Intronic
960628389 3:119703250-119703272 CGTCCGTCGCCTCCTAGGCCAGG + Intronic
961155279 3:124674524-124674546 ATTCCCCCGCCGCCGAGGGCTGG + Intronic
962071206 3:132035133-132035155 AGAGCGCCGCCGCCAAGGCCTGG - Exonic
963604593 3:147403933-147403955 ACCCCCCTGCCTCCTAGGCCTGG - Intronic
966095098 3:176190622-176190644 AGGCACCCGCCCCCCAGGCCCGG - Intergenic
966733557 3:183170320-183170342 AATACCCCGCTTCCAAGGGCAGG - Intergenic
966814125 3:183875269-183875291 AGTCGCCCGCCACCACGCCCAGG - Intronic
969413567 4:7044441-7044463 AGCCCCAGGCCTCCCAGGCCAGG - Intronic
969605886 4:8202106-8202128 AAGCCCCTGCCTGCAAGGCCAGG - Intronic
969780091 4:9394712-9394734 AGCCCCTCCCCTCAAAGGCCTGG + Intergenic
970513130 4:16800816-16800838 AGGCGCCCGCCACCAACGCCCGG + Intronic
972245778 4:37244538-37244560 AGGCCCCCGCGCCCAAGCCCCGG + Exonic
973843872 4:54891018-54891040 AGGCCCCCGCCACCAAGCCTGGG - Intergenic
976898143 4:90137562-90137584 AGTACCCAGCCTCAGAGGCCTGG + Intronic
976952415 4:90849932-90849954 AGCCCCTCCCATCCAAGGCCTGG + Intronic
980464079 4:133151400-133151422 AGTCCCCCGCCTCTCGGTCCAGG - Exonic
980974684 4:139599259-139599281 ACACCCCCGCCTCCAACCCCTGG + Intronic
984356201 4:178662467-178662489 AGGCGCCCGCCACCAATGCCGGG + Intergenic
984694929 4:182769960-182769982 AGGCCCCCGCCACCACGCCCAGG - Intronic
984992629 4:185396235-185396257 AGTCGCCCGCCTCCCAACCCGGG - Intronic
985447940 4:190037924-190037946 GGTTCGCCTCCTCCAAGGCCCGG - Intergenic
985688303 5:1293761-1293783 AGTCCCTGGCATCCAGGGCCTGG + Exonic
985810024 5:2075869-2075891 AGGCCACCTCCTCCCAGGCCAGG - Intergenic
985953724 5:3244212-3244234 AGGCGCCCGCCACCAAGCCCGGG + Intergenic
986152294 5:5139570-5139592 AGTCACCGGCCTCCGCGGCCTGG + Intergenic
986518803 5:8591985-8592007 AGTCCTCCTCCTCCAAAGCTGGG + Intergenic
986743759 5:10726569-10726591 AGAACCCCGCCTCCTGGGCCGGG - Intronic
987362989 5:17123335-17123357 ACTCCCCCGCTTCTAAAGCCTGG - Intronic
988970601 5:36463854-36463876 ACTCCCCAGCCCCCAAGTCCTGG - Intergenic
993042467 5:82830570-82830592 AGTCCCCAGCCTCCAGAGCAGGG - Intergenic
993109158 5:83633956-83633978 AGTCTCCCGGCACCAATGCCGGG + Intergenic
994353098 5:98769146-98769168 AGACCCCCGCGTCCAGGTCCTGG - Intronic
996388580 5:122934982-122935004 AGTGCCCCCCCTTGAAGGCCAGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998306074 5:141078389-141078411 AGGCGCCCGCCACCACGGCCCGG + Intergenic
1002675456 5:180908620-180908642 CGTCCTCCCCCACCAAGGCCTGG - Exonic
1002684010 5:180992847-180992869 CGTCCTCCCCCACCAAGGCCTGG - Exonic
1003632863 6:7803592-7803614 ACTCCCCACCCTGCAAGGCCTGG + Intronic
1005964873 6:30720272-30720294 ATTCTCCCGCCTCCCAGCCCCGG + Exonic
1007518970 6:42436926-42436948 AGTCTCCTGCCTCTAAGGCCTGG - Intronic
1007743862 6:44030240-44030262 AGTCCCCTGCCTCCAGAGCAGGG + Intergenic
1008360870 6:50617024-50617046 AGGCACCCGCCACCAATGCCTGG - Intergenic
1010212859 6:73375933-73375955 AGGCACCCGCCACCACGGCCAGG + Intronic
1015803720 6:137087770-137087792 ATTCCCCCAACTCCAAGCCCAGG - Intergenic
1018017897 6:159727903-159727925 TGTCCTCCGTCCCCAAGGCCCGG + Intronic
1018950781 6:168377503-168377525 ACGACCCCACCTCCAAGGCCAGG - Intergenic
1019183396 6:170207146-170207168 AGGCCACAGCCTCCGAGGCCTGG + Intergenic
1019447665 7:1079783-1079805 AGTCCCCGGCCTCCCAGCTCTGG + Intronic
1019475902 7:1244113-1244135 AGTCCCCCTCCCCCAGGGCTTGG - Intergenic
1019630493 7:2046378-2046400 TGTCCTCCTCCTCCCAGGCCCGG + Intronic
1020279439 7:6642906-6642928 AGCCCCCAGCCTGCAGGGCCAGG - Intronic
1020410762 7:7889208-7889230 AGGCGCCCGCCACCATGGCCAGG + Intronic
1022359443 7:29644261-29644283 AGTCCAGCGCCTCCAAGACTTGG - Intergenic
1022510935 7:30934415-30934437 AATGCCCAGCCTACAAGGCCCGG - Intergenic
1024566595 7:50686344-50686366 ACTCCCCAGCCTCCAAAGCTGGG + Intronic
1026460766 7:70613498-70613520 AGTCTCCCTCCTCCCAGGCTGGG + Intronic
1026568359 7:71508675-71508697 AGTCCCCAGCCTTCATGCCCGGG + Intronic
1027244475 7:76358334-76358356 GGTCCCCCGCCCCCACGCCCAGG + Intronic
1031282162 7:119818527-119818549 AGGCCCCCGCATCAAAGGCCTGG + Intergenic
1031489159 7:122366459-122366481 AGGCGCCCGCCACCATGGCCGGG - Intronic
1034234686 7:149557422-149557444 AATCCCCCACCTCCAAGCCTTGG - Intergenic
1034239466 7:149598654-149598676 AATCCCCCACCTCCAAGCCTTGG - Intergenic
1035589260 8:800843-800865 AGCCCTGCGTCTCCAAGGCCGGG + Intergenic
1036277515 8:7368691-7368713 AGCCCCTCTCCTCAAAGGCCTGG + Intronic
1036650203 8:10637230-10637252 AGTCCCCAACCTCCCAGGCTTGG + Intronic
1038777839 8:30546910-30546932 GGTCACCTGCCTCCCAGGCCTGG + Intronic
1039454169 8:37696834-37696856 TGTCCCCCTCCTCCAGGCCCAGG - Intronic
1039997001 8:42542178-42542200 AGCCCCGCGCCTCCACGCCCAGG + Intronic
1040286958 8:46105389-46105411 AGTCACCCTGCTCCAAAGCCTGG + Intergenic
1040289066 8:46115159-46115181 AGTCACCCTGCTCCAAAGCCTGG + Intergenic
1040289699 8:46117970-46117992 AGTCACCCTGCTCCAAAGCCTGG + Intergenic
1040290437 8:46121432-46121454 AGTCACCCTGCTCCAAAGCCTGG + Intergenic
1040294794 8:46143598-46143620 AGACACCCTGCTCCAAGGCCTGG + Intergenic
1040295318 8:46145987-46146009 AGTCACCCCGCTCCAAAGCCTGG + Intergenic
1040302522 8:46195393-46195415 AGGCACCCTCCTCCAAAGCCTGG - Intergenic
1040305111 8:46208015-46208037 AGTCACCCTGCTCCAAAGCCTGG - Intergenic
1040309752 8:46230659-46230681 AGGCACCCTCCTCCAAAGCCTGG - Intergenic
1040315456 8:46258520-46258542 AGTCACCCTGCTCCAAAGCCTGG - Intergenic
1040338883 8:46429925-46429947 AGTCACCCTGCTCCAAAGCCTGG - Intergenic
1040338983 8:46430358-46430380 AGTCACCCTGCTCCAAAGCCTGG - Intergenic
1040339322 8:46432473-46432495 AGTCACCCTGCTCCAAAGCCTGG - Intergenic
1040829430 8:51661009-51661031 CTTCCCCTGACTCCAAGGCCGGG - Intronic
1042282029 8:67064972-67064994 AGTCAGCCACCTCCAGGGCCCGG + Intronic
1043763099 8:84094675-84094697 AGTCCACTGCCTCTAAGCCCAGG + Intergenic
1043974631 8:86570816-86570838 AGGCACCCGCCACCAAGCCCGGG + Intronic
1046356012 8:113086103-113086125 AGTCGCCCGCCACCCACGCCTGG - Intronic
1049419750 8:142511344-142511366 GATCCCGGGCCTCCAAGGCCAGG - Intronic
1049553431 8:143271040-143271062 AGTCCCCAGCCCCACAGGCCTGG + Intronic
1050838312 9:10112603-10112625 AGTCTGCCTCCTCCACGGCCTGG - Intronic
1053506367 9:38646779-38646801 AGGCGCCCGCCACCAACGCCCGG + Intergenic
1053516692 9:38736227-38736249 AGTCACCCCCTTCCAAGGCCTGG - Intergenic
1054460718 9:65460915-65460937 AGTCCCCCGCTAGCATGGCCTGG - Intergenic
1054808103 9:69412384-69412406 AGCCTCCCGCGTCCCAGGCCGGG + Intergenic
1057623022 9:96653982-96654004 AGGCGCCCGCCACCAAGCCCGGG + Intronic
1060126804 9:121055355-121055377 AGTCCACTGCCTCCAAGACCAGG - Intergenic
1061028372 9:128065258-128065280 AGTCGCCCACCTCCAAGCCTGGG + Intronic
1061029543 9:128071853-128071875 AGGCGCCCGCCACCATGGCCCGG + Intronic
1061209372 9:129181963-129181985 TGTCCCCTGCCACCAAGCCCGGG - Intergenic
1062132985 9:134910186-134910208 CTTCCCCTTCCTCCAAGGCCTGG - Intronic
1062325422 9:136010391-136010413 AGTCCCCCGCTCCCCAGGTCCGG + Exonic
1062474927 9:136722180-136722202 AGACCCTCGACTCCAAGGCCCGG + Exonic
1062544204 9:137054326-137054348 GGTCTCCTGCCTCCACGGCCGGG - Intergenic
1062580860 9:137228643-137228665 GGCCCCCCTCCTCCGAGGCCTGG - Exonic
1203441696 Un_GL000219v1:15630-15652 AGTTCGCCTTCTCCAAGGCCCGG - Intergenic
1203512506 Un_KI270741v1:134539-134561 AGTTCGCCTTCTCCAAGGCCCGG - Intergenic
1190100051 X:47515695-47515717 ATCCGCCCGCCTCCCAGGCCCGG + Intergenic
1192548802 X:72037277-72037299 AGGCGCCCACCACCAAGGCCTGG - Intergenic
1193986880 X:88253159-88253181 AGTCCCCAGGCTCTAAGTCCAGG + Intergenic
1194032774 X:88836474-88836496 AGTCCCTCCCATCAAAGGCCTGG - Intergenic
1199236731 X:145501985-145502007 GACCCCCCCCCTCCAAGGCCAGG + Intergenic
1200116116 X:153770423-153770445 GGGCAGCCGCCTCCAAGGCCTGG - Exonic