ID: 953890878

View in Genome Browser
Species Human (GRCh38)
Location 3:46750790-46750812
Sequence CAGCCTCATGGCCGGGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 132}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953890878_953890890 1 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890890 3:46750814-46750836 AGGGTCGAGGCCATGAGGCTGGG 0: 1
1: 0
2: 3
3: 12
4: 187
953890878_953890888 -4 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890888 3:46750809-46750831 GCTGGAGGGTCGAGGCCATGAGG 0: 1
1: 0
2: 0
3: 16
4: 224
953890878_953890894 14 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890894 3:46750827-46750849 TGAGGCTGGGGGCCATCATAAGG 0: 1
1: 0
2: 2
3: 10
4: 154
953890878_953890897 26 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890897 3:46750839-46750861 CCATCATAAGGCCATGAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 174
953890878_953890892 3 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890892 3:46750816-46750838 GGTCGAGGCCATGAGGCTGGGGG 0: 1
1: 0
2: 1
3: 22
4: 242
953890878_953890889 0 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890889 3:46750813-46750835 GAGGGTCGAGGCCATGAGGCTGG 0: 1
1: 0
2: 3
3: 23
4: 301
953890878_953890898 27 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890898 3:46750840-46750862 CATCATAAGGCCATGAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 138
953890878_953890900 29 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890900 3:46750842-46750864 TCATAAGGCCATGAGGCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 209
953890878_953890895 22 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890895 3:46750835-46750857 GGGGCCATCATAAGGCCATGAGG 0: 1
1: 0
2: 0
3: 12
4: 160
953890878_953890899 28 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890899 3:46750841-46750863 ATCATAAGGCCATGAGGCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 225
953890878_953890891 2 Left 953890878 3:46750790-46750812 CCCCACGCCCGGCCATGAGGCTG 0: 1
1: 0
2: 2
3: 21
4: 132
Right 953890891 3:46750815-46750837 GGGTCGAGGCCATGAGGCTGGGG 0: 1
1: 0
2: 0
3: 27
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953890878 Original CRISPR CAGCCTCATGGCCGGGCGTG GGG (reversed) Intronic
901063732 1:6485387-6485409 CAGCCTCCAGGCCGGGCCCGGGG - Intronic
902586086 1:17439227-17439249 CAGCCCCCTTGCCGGCCGTGCGG + Intronic
903183696 1:21618049-21618071 CAGCCTCAGGGCTGAGAGTGCGG + Intronic
905028943 1:34868785-34868807 CGGCCCCAGGGCCGGGGGTGGGG + Exonic
905610411 1:39345778-39345800 AAGATTGATGGCCGGGCGTGTGG + Intronic
906534660 1:46544755-46544777 CCACCTCAAGGCTGGGCGTGTGG + Intergenic
906855289 1:49297971-49297993 CAGCCTCCTGGCCGGAAGTTGGG - Intronic
915016981 1:152743568-152743590 GAGCCTCAGGGCTGGGAGTGTGG + Intronic
915283065 1:154835982-154836004 TAGCCCCATGGCCAGGCATGGGG + Intronic
915287969 1:154864856-154864878 CAGTTTCAAGGCCGGGCATGGGG + Intronic
915375942 1:155395708-155395730 GAGGCTCCTGGCTGGGCGTGGGG + Intronic
916147134 1:161749993-161750015 CAGCTTCAAGGCGGGGCCTGGGG + Exonic
918007874 1:180559009-180559031 CAGAGTCATGGCAGGGTGTGGGG - Intergenic
921937254 1:220806704-220806726 CAGCCTCATGCTCAGGGGTGAGG - Intronic
922591489 1:226780550-226780572 CCGCCTCATGGATGGGGGTGAGG + Intergenic
924073212 1:240304821-240304843 CTGCCACAGGGCCGGGAGTGGGG + Intronic
924303578 1:242664538-242664560 CTGCCTACTGGCCGGGCGTGTGG - Intergenic
1064351860 10:14584124-14584146 CAGCCTCAGGGCTGGGCATCAGG - Intronic
1076864267 10:133159665-133159687 CTGCCTCTTGGCCGAGCTTGGGG + Intergenic
1077104745 11:837300-837322 CAGCCTCATGGCCCGGCTGGTGG - Exonic
1077322685 11:1949361-1949383 CAGCCTGGTGGCCGGGCCAGTGG - Intronic
1077476694 11:2793824-2793846 CAGCCCCATGGCTGGGCAGGGGG + Intronic
1083287087 11:61667040-61667062 CAGACTCATGGCTGGCCTTGGGG + Intergenic
1083651700 11:64208109-64208131 CAGGCTCTTGGCCGGGACTGTGG - Intronic
1083728921 11:64642828-64642850 CAGCCCCATGGCCGGGGGCGGGG + Intronic
1084492434 11:69486177-69486199 CAGCCCCACTGCCGGGCCTGGGG + Intergenic
1088416684 11:109596967-109596989 CAGATTCTTGGCCAGGCGTGTGG - Intergenic
1088746656 11:112809675-112809697 CAGCTTTATGGCCAGGCCTGGGG + Intergenic
1091122016 11:133064742-133064764 CAGCCACACGGCCCGGCGCGGGG + Intronic
1202805702 11_KI270721v1_random:4674-4696 CAGCCTGGTGGCCGGGCCAGTGG - Intergenic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1095098397 12:38159818-38159840 CAGCCCCTTTGCCGGGCATGCGG + Intergenic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1096167353 12:49436535-49436557 CCGCCTCCTGGCCGGGCGGGGGG + Intronic
1097195454 12:57240292-57240314 CCGGCTCCTGGCCGGGCTTGGGG + Intronic
1101994663 12:109516463-109516485 CCTCCTCAAGGCTGGGCGTGGGG - Intronic
1102234807 12:111287664-111287686 CTGCCTAATGACGGGGCGTGGGG + Intronic
1107912740 13:45120649-45120671 CAGACCCATGGCCGAGCGCGGGG + Exonic
1118370735 14:65135335-65135357 CAGCCTCAGGGTTGGGCCTGGGG + Intergenic
1118734615 14:68692314-68692336 CAGCCTCACTGCAGAGCGTGAGG + Intronic
1121031833 14:90664780-90664802 CAACCCCATGGCTGGGAGTGAGG - Intronic
1121055160 14:90846045-90846067 CACCCTCATGGCCAGTGGTGTGG + Intergenic
1121761188 14:96446418-96446440 CACCCCCATGGCTGGGCGTGGGG - Intronic
1123704280 15:22939891-22939913 CGGCTTCATGGCAGGGCTTGTGG - Intronic
1127369972 15:58330460-58330482 CCGCCTCATTGCCGGGACTGGGG + Intronic
1129431548 15:75504184-75504206 CAGCCCCATGTCCGGGAGGGAGG + Intronic
1130653225 15:85774045-85774067 CAGCCTCATAGCAGGGCCTGGGG + Intronic
1139383661 16:66550053-66550075 CAGCAGCATAGCCGGGCGAGCGG + Exonic
1142137790 16:88459634-88459656 CAGCCCCATGGGTGGGCGTTAGG - Intronic
1143114463 17:4574820-4574842 CAGACTCAGGGCCTGGCTTGGGG + Intergenic
1144807471 17:17977446-17977468 CAGACCCAGGGCTGGGCGTGGGG + Intronic
1147813775 17:43193410-43193432 CTGCCTCAAGGCCGGCCATGTGG + Exonic
1150110528 17:62495199-62495221 CAACCTCATGGCCGGGCATGAGG + Intronic
1151293287 17:73165554-73165576 CAGCCTCATGCCCGTGTGCGTGG + Intronic
1151593223 17:75060614-75060636 CAGGTTCATGGCTGGGCGCGTGG + Intronic
1152081322 17:78189134-78189156 CAGCCTCATGGCAAGGCCTGAGG - Intronic
1152300067 17:79490446-79490468 CAGCCTCATGGCCAGGGTTCTGG - Intronic
1152552199 17:81035403-81035425 CAGCCTCCTGGCCCGGCGCGCGG - Intronic
1152685428 17:81691444-81691466 CAGCACCACTGCCGGGCGTGTGG + Exonic
1152746624 17:82043334-82043356 CAGCCTCATGGCCCAGCTTCAGG - Intergenic
1160922994 19:1529344-1529366 CAGCCCCAGGGACAGGCGTGAGG - Intronic
1162789509 19:13055613-13055635 CAGCCTCAGGGCTGGGGGAGGGG + Intronic
1166809422 19:45506866-45506888 CAGCCGCAGGGTCGGGGGTGGGG - Intronic
1167303816 19:48695796-48695818 CACCCTTATGGCCAGGCTTGGGG + Intergenic
1167517302 19:49930630-49930652 GAGCCTCATGGACGTGCCTGGGG + Intronic
925193035 2:1900585-1900607 AAGCCTCCTGGCCGGGCGAGGGG - Intronic
927291497 2:21408947-21408969 CAGCATCATGTCCGGGTATGAGG + Intergenic
927480672 2:23451551-23451573 CAGCCTCATGGCCCCACTTGAGG + Intronic
927554222 2:24021322-24021344 GAGCCTCAGGGCCTGGCATGCGG + Intronic
929575526 2:43049560-43049582 CAGGATCAAGGCCGGGAGTGAGG + Intergenic
929938577 2:46313287-46313309 CAGCCTCATGGGTGGGGCTGAGG - Intronic
933794026 2:85905960-85905982 CAGCCTCATGCCGGGGTGTGTGG + Intergenic
935109625 2:100080711-100080733 CTGCATCCTGGCCGGGGGTGGGG - Intronic
935746430 2:106193860-106193882 CTGCCTCCTGCCCGGGCGCGGGG - Intronic
936125349 2:109784498-109784520 CAGCATCCTGGCCGGGGGTGGGG + Intergenic
936219344 2:110586970-110586992 CAGCATCCTGGCCGGGGGTGGGG - Intergenic
936529912 2:113268939-113268961 CAGCCCCATGGCCAGCAGTGGGG + Intronic
937436256 2:121884430-121884452 CATCCTCATGGCGGGGGGAGGGG - Intergenic
938077070 2:128345773-128345795 CGGCCTCAGGGCCGGGGTTGGGG - Intergenic
938099189 2:128486611-128486633 CAGCCGCGTGGCCGGGGGCGGGG + Intergenic
944579054 2:201116542-201116564 CTGACTCAGGGCCGGGCGTCGGG - Intronic
944732927 2:202534961-202534983 CCACCTCCTGGCCGGGCGGGTGG + Intronic
946008922 2:216549186-216549208 CAGCCCCATGGCGGGGGGAGAGG - Intronic
946225469 2:218261957-218261979 CAGCCTCAGGCCTGGGGGTGTGG + Intronic
948280220 2:236741084-236741106 CAACCTCATGGCCCTGAGTGGGG - Intergenic
948867247 2:240782362-240782384 CGGCCTCACGGCAGGGCCTGGGG - Intronic
1171454391 20:25259344-25259366 GAGCCTCATGGCCGGGCTTCTGG + Intronic
1172227497 20:33314841-33314863 CAGCCCCTTGGCCAGGCTTGCGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175958649 20:62624046-62624068 CAGCCTCAGGGGCGGGGCTGTGG + Intergenic
1176077682 20:63255646-63255668 CAGGCTCATGGGCGGGTGAGGGG + Intronic
1178162785 21:29939008-29939030 CAGCCTCCTGGGTGGGCGTCTGG - Intronic
1180175300 21:46084296-46084318 CAGCCACAGGGCCGGGTGTGGGG - Intergenic
1180623950 22:17181602-17181624 CAGCCTCAGGGCAGGGGTTGGGG + Intronic
1180958472 22:19751554-19751576 GAGCCTCCAGGCCTGGCGTGAGG - Intergenic
1181266613 22:21634435-21634457 CAGCCTCATGGCCGGCTGTCTGG + Exonic
1181440561 22:22933344-22933366 CAGCCTCGTGGGTGGGCCTGTGG - Intergenic
1182189301 22:28442539-28442561 TTGCCCCATGGCGGGGCGTGGGG - Intronic
1183445308 22:37849593-37849615 CAGCCTGAGGGCCGGGCGGGAGG - Intronic
1184593722 22:45502458-45502480 CAGCCTCCCGGCCGAGGGTGCGG + Intronic
1185138711 22:49088517-49088539 CGGGCTCCTGGCAGGGCGTGAGG + Intergenic
953890878 3:46750790-46750812 CAGCCTCATGGCCGGGCGTGGGG - Intronic
955403502 3:58610341-58610363 CAGCCTCATGGATGGGGGTAAGG - Intronic
958502991 3:94938016-94938038 CAGCTTCATGGCGGCGGGTGGGG + Intergenic
960087194 3:113604205-113604227 CAGCCTCTTGGCTGGGAGGGAGG - Intronic
961460973 3:127050273-127050295 CAGGATCATGGCAGGGGGTGAGG - Intergenic
962824134 3:139083649-139083671 CATGCTCATGGCAGGGGGTGGGG - Intronic
965837897 3:172871235-172871257 CAGCCTGGGGGCTGGGCGTGGGG + Intergenic
968478515 4:824039-824061 CAGCCTCAGGGACAGGCGTGGGG - Intronic
968566550 4:1316542-1316564 CAGGCGCATGGCTGGGCATGGGG - Intronic
968617647 4:1586436-1586458 CAGCTTCATGGCTGGGGGGGTGG - Intergenic
968658582 4:1789400-1789422 CAGCCTCATGGCAGGGCCGAGGG + Intergenic
968701403 4:2059695-2059717 CAGCCTCACGGCGGGGCGGGGGG + Exonic
968947639 4:3673958-3673980 CACCTTCATGGCTGGGCCTGAGG + Intergenic
969815912 4:9687330-9687352 TAACCACAAGGCCGGGCGTGGGG + Intergenic
976650198 4:87425682-87425704 CAGGGTCTTGGCCAGGCGTGGGG - Intronic
981518715 4:145638079-145638101 GATCCTTATGGCCGGGCGTGGGG + Intronic
990458968 5:56014866-56014888 CAGCCCCATGTCCGGGAGGGAGG - Intergenic
997472848 5:134126299-134126321 CATCCCCATGGGCGGGGGTGTGG + Intronic
997924312 5:138014223-138014245 TGCCCTCATGGCTGGGCGTGGGG - Intronic
1000849449 5:166322087-166322109 CAGCCTCATTCCCAGGCATGTGG - Intergenic
1002252511 5:177938575-177938597 CAGCCTCATGGGGGGGAGTGTGG - Intergenic
1002428806 5:179191384-179191406 CAGCCTCTGAGACGGGCGTGTGG - Intronic
1003174392 6:3744456-3744478 CCGCCTCCTGCCCGGGAGTGTGG - Intronic
1003535133 6:6969936-6969958 CAGCCTCAGGGCAGGGCGGTGGG - Intergenic
1005289206 6:24361787-24361809 CAGCTTCATGGGCTGGCGTCAGG - Intergenic
1007500329 6:42292145-42292167 CAGTCTCATTGCCTGGGGTGGGG + Intronic
1007749250 6:44062151-44062173 CAGCCTCATGGGCAGCCTTGTGG + Intergenic
1007821041 6:44561012-44561034 CAGCCCCAGGGCCAGGCGGGTGG + Intergenic
1010283035 6:74041819-74041841 CAGTCTCTTGGCTGGGAGTGGGG + Intergenic
1016063354 6:139653408-139653430 CAGACTCATGGGAGGGTGTGGGG + Intergenic
1020066229 7:5190406-5190428 CAGGTTCATGGCTGGGCGCGCGG - Exonic
1020139274 7:5603815-5603837 GAGCCTCCTGGCAGGGAGTGGGG - Intronic
1020279534 7:6643241-6643263 CAGCCCCAAGCCCGGGGGTGTGG + Intronic
1021043374 7:15890899-15890921 TAGCCTCCTGGCCAGGCCTGTGG - Intergenic
1023048769 7:36233842-36233864 CAGGCTCATGGACAGGAGTGTGG - Intronic
1023850998 7:44150313-44150335 CAGAGTCAAGGCAGGGCGTGGGG + Intronic
1024948220 7:54833317-54833339 CAGCCGCAGGGCCGGGCGCCTGG - Intergenic
1026277400 7:68892096-68892118 CATCCTCATGGCAGTGAGTGAGG - Intergenic
1029458982 7:100684765-100684787 CAGCCCCATGGCTGAGCGGGAGG + Exonic
1032039719 7:128549102-128549124 CAACCTCATGGCCGGGCATGAGG + Intergenic
1035435644 7:158857023-158857045 CCGCCTCCAGGCCGGGCGCGAGG - Intronic
1039589456 8:38734481-38734503 CAGGCTTATGGCCAGGCGTGTGG - Intronic
1049530869 8:143154271-143154293 GAGCCTCAGGGCTGGGTGTGTGG - Intergenic
1049705476 8:144040201-144040223 CAGCCTCGTGGCAGGCCCTGTGG + Exonic
1049762406 8:144337261-144337283 CAGCAGCATTGTCGGGCGTGTGG + Intergenic
1052610341 9:30764742-30764764 TAGACTCATGGCTGGGGGTGTGG + Intergenic
1056691078 9:88809142-88809164 CTGCCTCATGCCGGGGTGTGTGG - Intergenic
1056841855 9:90004230-90004252 CTCCCTCATGGCTGGGCATGAGG - Intergenic
1060995163 9:127871746-127871768 CATCCCCATGGGCGGGCCTGCGG - Intronic
1061227745 9:129290623-129290645 CAGCCTCCTGGCCAAGCGGGAGG + Intergenic
1062405377 9:136393745-136393767 CTTCCCCATGGCCGGGCGGGCGG - Intronic
1062430663 9:136525611-136525633 CAGCTTCAGGGCCGGTCCTGGGG - Intronic
1185615983 X:1422376-1422398 CAGCCTCCTGGCCTGCCCTGTGG + Intronic
1186847280 X:13543256-13543278 CAGAATTTTGGCCGGGCGTGGGG - Intergenic
1190968280 X:55323476-55323498 CAGCCTGATGGCTGGGGCTGTGG + Intergenic