ID: 953896588

View in Genome Browser
Species Human (GRCh38)
Location 3:46807887-46807909
Sequence CATTCCCCGCAGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953896588 Original CRISPR CATTCCCCGCAGATGGAACA TGG Intronic
900751204 1:4398949-4398971 CTTTCCCTGCAGAAAGAACATGG + Intergenic
900820275 1:4881300-4881322 CCTTCCCCATAGATGGCACAGGG + Intergenic
903375074 1:22860624-22860646 AATGCCCCGCAGATGGAGGAGGG + Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
906658487 1:47565832-47565854 CATTTCCCGGAGACTGAACACGG - Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
920363571 1:205436121-205436143 CCCGCCCCTCAGATGGAACACGG + Intronic
920462309 1:206150565-206150587 CAATCTCCCCATATGGAACATGG - Intergenic
923038277 1:230300793-230300815 CATTCCCCAGAGATGGAAGCAGG + Intergenic
1067724850 10:48762330-48762352 CATTCCCCAAAGAAGGGACATGG - Intronic
1069234288 10:66050704-66050726 CATTCCCCAGAGAAGGAATATGG - Intronic
1069957847 10:72062639-72062661 CAGTCCCCCCAGGTGGAGCAGGG + Exonic
1075565778 10:123503109-123503131 CATTCTCAGCAAATGGAATAGGG - Intergenic
1075754732 10:124801783-124801805 CATGCCCCGCGGAGGGCACACGG - Exonic
1077495993 11:2886609-2886631 CCTGCCCAGTAGATGGAACAGGG + Intergenic
1077813203 11:5659313-5659335 CATGCCCTGCAAAGGGAACAAGG + Intergenic
1082782952 11:57301310-57301332 CATTGCAGGCAGAGGGAACAGGG - Intronic
1084785192 11:71438013-71438035 CACTCCACGCAGATGCAGCAGGG + Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1095453945 12:42362741-42362763 GATTTCCCACAGATGGAAAAAGG - Intronic
1098498081 12:71160085-71160107 TATTCCAGGCAGAAGGAACAAGG - Intronic
1102813631 12:115844631-115844653 CATTCTCAGCACCTGGAACAGGG + Intergenic
1104749894 12:131231730-131231752 CATTACCCACAGATGTCACACGG + Intergenic
1107718942 13:43228135-43228157 CATTCCCTGGGGATGGAAAAAGG + Intronic
1113020277 13:105877372-105877394 CAGTCCCCTCAGATGAAACCAGG + Intergenic
1123508004 15:20964846-20964868 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123565222 15:21538588-21538610 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123601485 15:21975875-21975897 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1124377560 15:29137943-29137965 CATTTCCCACAGATTGACCACGG - Intronic
1128878571 15:71222568-71222590 CACTCCCCTCAGTGGGAACAGGG - Intronic
1130181963 15:81638929-81638951 CCATCCCCGCAGATACAACATGG - Intergenic
1202973593 15_KI270727v1_random:265694-265716 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1136109720 16:28057202-28057224 GATCCGCCTCAGATGGAACAGGG + Intronic
1141946599 16:87315062-87315084 CATTCACAGCAGATGGCCCAGGG + Exonic
1145256134 17:21323493-21323515 CTTTCCCTGAAGATGGAAGAAGG - Intergenic
1145320479 17:21764457-21764479 CTTTCCCTGAAGATGGAAGAAGG + Intergenic
1146477107 17:33171868-33171890 CTTTCCAGGCAGACGGAACAAGG - Intronic
1149127695 17:53255058-53255080 CATGCCCCTCAGCTGGGACAGGG - Intergenic
1152610346 17:81312171-81312193 CAAGCCCTGCAGATGGCACAGGG - Exonic
1153155389 18:2143848-2143870 CATTCCCAGCATCTGGAATAGGG - Intergenic
1153263853 18:3248452-3248474 CTTTCCCCCCAAATGGGACAAGG - Intronic
1158876653 18:61740390-61740412 CATTCCAAGCAGATGTGACAAGG + Intergenic
1159115966 18:64113667-64113689 CTTTCCCTGCAGGTGAAACAAGG - Intergenic
1159459958 18:68712263-68712285 TATTCTCAGCAGATAGAACATGG - Intronic
1163698346 19:18775132-18775154 CATAGCCCGCAGATGGGACGGGG - Intronic
1163977862 19:20869484-20869506 CATTCACCCCAGTGGGAACATGG + Intergenic
1165067821 19:33239313-33239335 CATTCCAAGCAGCTGGAACAGGG - Intergenic
1168164229 19:54535717-54535739 CATTCCCAGCAGCTTGACCAGGG + Exonic
925946142 2:8865656-8865678 CATTCCCCGTAAAGGGAAGAGGG - Intronic
926329219 2:11810988-11811010 CATTCTCAGCAACTGGAACAGGG - Intronic
928143638 2:28752084-28752106 CCTTCCCAGCAGCGGGAACAAGG - Exonic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
933618760 2:84512315-84512337 CATTCCCCCATGATGGAAGATGG + Intergenic
934515632 2:94984846-94984868 CATTGCCCACAGAGGGAACCCGG - Intergenic
936958184 2:118044572-118044594 CTTTCCCCACAGATGTAACCAGG + Intergenic
944489319 2:200241848-200241870 CATTCCCTGCAGAGGAAACATGG - Intergenic
946527143 2:220532904-220532926 CATTCCCTGCAGAGGGAATTTGG + Intergenic
947026134 2:225740206-225740228 CTTTCCCAGCATATGGAAGAAGG - Intergenic
947601524 2:231453714-231453736 CATCCCCTGGACATGGAACAGGG + Exonic
948443236 2:238011319-238011341 CACTCCAGGCAGATGAAACAGGG - Intronic
948723163 2:239913965-239913987 CCTTTCCAGCAGGTGGAACAAGG + Intronic
1169100002 20:2939366-2939388 CATTCTCTGCAGCTGTAACATGG + Intronic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1174815028 20:53680012-53680034 CATGCCCCTCAGAAGGAGCAGGG + Intergenic
1176013328 20:62912687-62912709 CCTTCCCCCAGGATGGAACATGG - Intronic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1177459222 21:21388393-21388415 CATTCCAGGCAGAGGGAACAAGG + Intronic
1183387347 22:37522522-37522544 CAGTCCCAGCAGAGGCAACAGGG - Intergenic
953896588 3:46807887-46807909 CATTCCCCGCAGATGGAACATGG + Intronic
955745871 3:62139979-62140001 CAGTCCCAGCAGGTGGAATACGG - Intronic
956479458 3:69659503-69659525 CATTCCGCACAGAGGCAACATGG - Intergenic
959069258 3:101687305-101687327 CATTCCCTGCAGCCGGAAGATGG - Intergenic
959630249 3:108499621-108499643 CATACCCCTCAAATGGTACAGGG + Intronic
963680541 3:148370076-148370098 CATTACCTGCAGAGGGAACTGGG + Intergenic
964224953 3:154387664-154387686 CATTCCCATGAGATGGAAGAAGG - Intronic
966027912 3:175308666-175308688 TATTCACCCCAGATGGAATAGGG + Intronic
968227790 3:196986174-196986196 GACTCCCCCCAGATTGAACATGG + Intergenic
970351100 4:15202558-15202580 CCTTCCCTGGAGAGGGAACAAGG + Intergenic
972220991 4:36954083-36954105 CATCCTCCTAAGATGGAACAAGG - Intergenic
985591365 5:767063-767085 CGTTCCCCGCAGAGGGAGCAGGG + Intergenic
985604419 5:850746-850768 CGTTCCCCGCAGAGGGAGCAGGG + Exonic
986769956 5:10963582-10963604 CATTCGCAGCAAATGAAACATGG - Intergenic
992195315 5:74333454-74333476 CATTCCAGGCAGAAGGAACAGGG - Intergenic
992402290 5:76422668-76422690 CAATCCCCCCAGATTGCACAAGG - Intronic
993195177 5:84732965-84732987 CAATCCTGGCAGATGGCACAGGG - Intergenic
995851008 5:116545613-116545635 TGCTCCTCGCAGATGGAACACGG - Intronic
997625187 5:135326682-135326704 CCATCCCCGCAGCTGTAACATGG - Intronic
1001429980 5:171651922-171651944 AATTCCCTGCAAATGGAACTAGG - Intergenic
1002394992 5:178945801-178945823 CCTTCCCTGCATCTGGAACACGG - Intronic
1002705417 5:181158078-181158100 CATTTCCCGCACAAGGACCAGGG + Intergenic
1003432924 6:6056521-6056543 CATTCCTGGCAGAAGAAACATGG - Intergenic
1008894310 6:56534922-56534944 TATTCCCAGCAACTGGAACAAGG + Intronic
1010502416 6:76616900-76616922 AATTGCCAGCAGCTGGAACAGGG - Intergenic
1010745666 6:79558787-79558809 CATTCCCCACAGAAGGAATCAGG + Intergenic
1016520046 6:144936838-144936860 CATTCACCCCAGAAGGATCATGG + Intergenic
1022729676 7:33010545-33010567 CATTCCTAGGAGAGGGAACAGGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1035107237 7:156452102-156452124 CATTCCAGGCAGAGGGAACAAGG - Intergenic
1038092644 8:24271002-24271024 CATTCCACCCTGGTGGAACAGGG + Intergenic
1045509011 8:102799049-102799071 CATTCCCTGAAGATGGGAGAAGG + Intergenic
1048586412 8:135778184-135778206 CAGCCCCCGCACATGGGACAGGG - Intergenic
1049119114 8:140718462-140718484 CATTCCACGCAGATGCCCCAGGG + Intronic
1049182173 8:141228533-141228555 CACTCCCCGCAGCTGGAGCATGG + Exonic
1049310196 8:141930078-141930100 TAAACCCCGCTGATGGAACAGGG - Intergenic
1049456516 8:142694081-142694103 CATCCCCAGCAGAGGGCACAAGG + Intergenic
1049481256 8:142824402-142824424 CATCCCCAGCAGAGGGCACAAGG - Intergenic
1050627962 9:7526074-7526096 CAATCCCAGCTGATGGTACATGG - Intergenic
1058822751 9:108747740-108747762 CATCCCAGGCAGGTGGAACACGG - Intergenic
1059283098 9:113151204-113151226 CATTGCCAACAGCTGGAACAGGG + Intronic
1188612368 X:32116185-32116207 CATTCCAGGCAGAGGAAACAAGG - Intronic
1188639968 X:32488920-32488942 GATTCCAGGCAGAAGGAACATGG - Intronic
1196924679 X:120621680-120621702 TCTTCCCCTCAGATGGTACAGGG + Intergenic
1197675094 X:129321098-129321120 GATTCCCCACAGATGCAAGAAGG - Intergenic