ID: 953897340

View in Genome Browser
Species Human (GRCh38)
Location 3:46812404-46812426
Sequence TGGCTCGAAGAGGCCCGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953897340_953897349 15 Left 953897340 3:46812404-46812426 CCTGCCCGGGCCTCTTCGAGCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 953897349 3:46812442-46812464 GAACCAGGCCAGGAGCCCCAGGG 0: 1
1: 0
2: 1
3: 43
4: 309
953897340_953897352 29 Left 953897340 3:46812404-46812426 CCTGCCCGGGCCTCTTCGAGCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 953897352 3:46812456-46812478 GCCCCAGGGAGCTGCCGCTCTGG 0: 1
1: 0
2: 2
3: 44
4: 300
953897340_953897348 14 Left 953897340 3:46812404-46812426 CCTGCCCGGGCCTCTTCGAGCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 953897348 3:46812441-46812463 AGAACCAGGCCAGGAGCCCCAGG 0: 1
1: 0
2: 4
3: 42
4: 361
953897340_953897346 0 Left 953897340 3:46812404-46812426 CCTGCCCGGGCCTCTTCGAGCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 953897346 3:46812427-46812449 TGGCTGAAGAAGCAAGAACCAGG 0: 1
1: 0
2: 2
3: 29
4: 292
953897340_953897354 30 Left 953897340 3:46812404-46812426 CCTGCCCGGGCCTCTTCGAGCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 953897354 3:46812457-46812479 CCCCAGGGAGCTGCCGCTCTGGG 0: 1
1: 0
2: 0
3: 31
4: 335
953897340_953897347 5 Left 953897340 3:46812404-46812426 CCTGCCCGGGCCTCTTCGAGCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 953897347 3:46812432-46812454 GAAGAAGCAAGAACCAGGCCAGG 0: 1
1: 0
2: 5
3: 55
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953897340 Original CRISPR TGGCTCGAAGAGGCCCGGGC AGG (reversed) Exonic
900119870 1:1043987-1044009 CAGATCGAGGAGGCCCGGGCAGG + Exonic
900241845 1:1620999-1621021 TGGCTAGAAGCGGCCTGTGCTGG + Intronic
900616671 1:3568609-3568631 TGGCTCGAAGGGGCCAGGCAGGG - Intronic
901458128 1:9375611-9375633 TGGCTGCAAGAGGCCAGGACAGG - Intergenic
903174637 1:21573656-21573678 TGGCTCGAAGAGACCTGAGGAGG - Exonic
905104809 1:35557919-35557941 CGGCTCGGAGAGGCCCCGGCTGG - Exonic
906474153 1:46156606-46156628 TGGCTCAGAGAGACCCGGTCAGG - Intronic
906511112 1:46410958-46410980 AGGCTGGAAGTGGCCCAGGCAGG + Intronic
917821384 1:178767690-178767712 TGGCTACAAGAGGCCAGGCCAGG + Intronic
920254277 1:204643878-204643900 TGGTGGGAAGAGGCCAGGGCAGG - Intronic
1065317113 10:24473882-24473904 CGGCTCGGAGAGGCCCGGTCTGG - Exonic
1065637333 10:27745114-27745136 TGGCTCGGAGAAGGCCGGGCCGG - Intronic
1068544127 10:58327230-58327252 GGGGTCGAACAGGCCTGGGCGGG + Intergenic
1069981096 10:72253176-72253198 TTGCTCAAAGAGTCCTGGGCAGG - Intergenic
1071825686 10:89323018-89323040 TGGCTACAAGAGGCCAGGGTAGG - Intronic
1072573205 10:96676464-96676486 AGGCTGGGAGAGGCCCGAGCTGG - Intronic
1075718655 10:124572081-124572103 TGGCAGGGAGAGGCCAGGGCTGG + Intronic
1076570933 10:131432445-131432467 TGCCTCGGAGAGGACTGGGCTGG + Intergenic
1079452058 11:20605927-20605949 TGGCTTGGAGAGCCCCGGGCAGG + Intronic
1084172859 11:67409051-67409073 TGTCTCCAGGAGGCCAGGGCAGG - Exonic
1084398921 11:68932421-68932443 TGGCACCAGGTGGCCCGGGCAGG + Intronic
1084758088 11:71251795-71251817 TGTCGCGGAGAGGCCGGGGCCGG - Intronic
1084904379 11:72334670-72334692 TGGCCCGAAGGGGCCCTGGGTGG - Intronic
1084971543 11:72774821-72774843 TGGCTCCAAGTGGCCCAGCCAGG + Intronic
1086437923 11:86800282-86800304 TGGCGCCGAGAGGCCCGGACTGG + Exonic
1088995410 11:114991705-114991727 TGGCTGGAAGAGGAGAGGGCGGG - Intergenic
1091463553 12:664306-664328 GGGCTTGAAGAGGTGCGGGCAGG + Intergenic
1091901055 12:4144379-4144401 TGCCTTGAAGCTGCCCGGGCTGG - Intergenic
1092000462 12:5027398-5027420 TGGCTCCAAGAGGACTGGTCAGG - Intergenic
1095414582 12:41962436-41962458 TGGATGGAAGAGGCTCTGGCAGG - Intergenic
1095947152 12:47759691-47759713 TGGGGCGAAGAGGCCCGCGCTGG - Intronic
1099898744 12:88681485-88681507 TGGCTCAAAGAGGCCAGGTACGG + Intergenic
1113363702 13:109656063-109656085 TGGCTGGAAGAGCCGAGGGCAGG + Intergenic
1113874262 13:113584804-113584826 CGGCGCGGAGAGGCGCGGGCTGG - Exonic
1113949976 13:114066415-114066437 GGGCGAGAGGAGGCCCGGGCAGG + Intronic
1114539252 14:23442778-23442800 TGGCTCTGAGAAGCCAGGGCAGG + Intergenic
1118763403 14:68894368-68894390 TGTCTGGAAGAGGCCTGTGCTGG - Intronic
1119090219 14:71773937-71773959 TGGCCCACAGAGGCCAGGGCAGG + Intergenic
1119556441 14:75557007-75557029 GGGCTGGAAGAGGCGAGGGCAGG + Intergenic
1119767520 14:77199730-77199752 TGGCTGGAAGTGCTCCGGGCAGG + Intronic
1123039943 14:105486390-105486412 CGGCTCGGAGATGCCCGGACCGG - Intergenic
1124653044 15:31486963-31486985 TGGCTTGAAGTGGCTCTGGCTGG - Intronic
1125748573 15:42013619-42013641 TGGATGGAAGAGGCCCTGGCTGG - Intronic
1129251798 15:74313212-74313234 TGGCTCCAGGATGCCAGGGCAGG + Intronic
1129948240 15:79560594-79560616 TGGCGCGGGGAGGCGCGGGCCGG + Intergenic
1130362807 15:83207172-83207194 CGGCACGAAGAAGACCGGGCCGG - Intronic
1139529785 16:67537508-67537530 CGGCTCGAAGTGGCCAGGGCCGG + Intronic
1141444442 16:84049055-84049077 TGGCTCCGAGAGCCCTGGGCGGG + Intergenic
1142009314 16:87705841-87705863 TGGTTGGAAGAGGCTCGGACAGG - Intronic
1142870412 17:2816141-2816163 GAGCTGGAAGAGGCCCGAGCCGG + Intronic
1144960412 17:19041365-19041387 TGGCTGGGAGAGGGCTGGGCGGG - Intronic
1144974747 17:19133159-19133181 TGGCTGGGAGAGGGCTGGGCGGG + Intronic
1146208170 17:30922298-30922320 GGGCTCGTAGGGGCCGGGGCAGG - Intronic
1146676373 17:34776262-34776284 TGGCTGAAAGAGGGCAGGGCAGG - Intergenic
1146940341 17:36839811-36839833 TGGGTGGAAGAGGCAAGGGCGGG - Intergenic
1146957305 17:36942990-36943012 TGGAGTGCAGAGGCCCGGGCAGG - Exonic
1147375715 17:40021549-40021571 ATGCCCGGAGAGGCCCGGGCTGG - Intronic
1147383633 17:40069842-40069864 TGGCTGGAGCTGGCCCGGGCAGG + Intronic
1149995835 17:61405546-61405568 TGGCTGGAAAAGGCCAGGCCGGG - Exonic
1151892988 17:76962095-76962117 TGGCTCGCCTGGGCCCGGGCTGG - Intergenic
1158649330 18:59272616-59272638 TGGGGCGACGAGGCCCGGGAGGG + Intronic
1159900450 18:74040089-74040111 TGGCTCCAAAAGGCACTGGCCGG - Intergenic
1160151891 18:76401696-76401718 TGGCTCTGAGAGCCCCGGGAAGG - Intronic
1163862235 19:19748485-19748507 TGGCCGGGGGAGGCCCGGGCAGG - Intergenic
1166661317 19:44649123-44649145 TGACTCGGAGAGGGCAGGGCTGG - Intronic
925976604 2:9146278-9146300 AGGCACAAAGAGACCCGGGCTGG + Intergenic
926210169 2:10863351-10863373 TGGCTGGAAGAGGTCAGGGCTGG + Intergenic
926616194 2:14999068-14999090 TGGCTGGTAGAGGCCCAGGAAGG - Intergenic
927653567 2:24927231-24927253 TGGCTAGAAAAGGCCCCGGATGG + Intergenic
932703977 2:74009406-74009428 TGGCTTGAATAGGCTCAGGCTGG + Intronic
935332897 2:101990047-101990069 TGGCTCCATGAGGCTCCGGCAGG + Intergenic
941918241 2:170826003-170826025 TGGCTCTGAGAGGCCCTGGAAGG - Intronic
944237482 2:197453462-197453484 TGGCTGGAAGAGACCGGAGCCGG + Exonic
946998025 2:225418248-225418270 TGGCTCGAACAGGGCAGAGCAGG + Intronic
1170937203 20:20820705-20820727 TGGCTTGAAGAGACAAGGGCAGG + Intergenic
1173384074 20:42572358-42572380 TGGCCAGCAGAGGCCAGGGCAGG - Intronic
1175991639 20:62792839-62792861 TGGCTCCAGGGGGCCAGGGCTGG - Intergenic
1176108752 20:63401612-63401634 TGGCGTGAAGAGGCCTGGTCAGG - Intergenic
1179075062 21:38113264-38113286 TGTCTCGAAGAGTCAGGGGCTGG - Intronic
1181570912 22:23767513-23767535 TGGCCCGAAGGGGCGGGGGCTGG + Exonic
1183093972 22:35541256-35541278 GGGCTCGGCGGGGCCCGGGCAGG - Exonic
1183705504 22:39472907-39472929 TGGCTGGGAGGGGCCCAGGCAGG + Intronic
949414339 3:3799658-3799680 CGGCTCTCAGAGGCCAGGGCAGG - Exonic
949810538 3:8001923-8001945 AGGCTGGAGCAGGCCCGGGCGGG + Intergenic
950155757 3:10720365-10720387 TGACTCAAACAGGCCTGGGCTGG + Intergenic
953897340 3:46812404-46812426 TGGCTCGAAGAGGCCCGGGCAGG - Exonic
954116627 3:48470229-48470251 GGGCTCCCAGAGGCCAGGGCTGG - Intronic
954329620 3:49882709-49882731 TGGGTCGAAGAGACCAGGGCAGG + Intergenic
954583645 3:51716987-51717009 TGGGTGGTAGAGGCCAGGGCTGG + Intronic
960547652 3:118934732-118934754 TGGCTCGAACAGGGCCAAGCTGG + Intronic
960702475 3:120451299-120451321 TGGCTGGCGGCGGCCCGGGCGGG + Intergenic
961014199 3:123454855-123454877 TGGCTGGAAGAGGCCTGTGGAGG + Intergenic
961640963 3:128364631-128364653 AGGCTGGAAGAGGCCCTGGAGGG - Intronic
962292261 3:134146637-134146659 TGGCTCTAGGAGGCCCATGCTGG + Intronic
968478585 4:824297-824319 GGCCTCGAAAAGGGCCGGGCTGG + Intronic
968584256 4:1408631-1408653 TGGGTCGGGGAGGGCCGGGCAGG + Intergenic
968647296 4:1747212-1747234 TGGCTCAGAGAGGCCCCAGCAGG - Intergenic
968963778 4:3759175-3759197 TGGCTTGTACAGGCCTGGGCTGG - Intergenic
972686986 4:41361069-41361091 CGGCTCGCCGAGGCCCGGGGGGG - Intronic
982209238 4:153021421-153021443 TGGCTGGAAGAGACCCCGGAAGG - Intergenic
985896444 5:2752073-2752095 TGGCTGGAAGGGGCGGGGGCCGG - Intergenic
995725770 5:115179442-115179464 AGGCCCGAAAAGGCCAGGGCAGG + Intronic
997713214 5:136023385-136023407 TGGGTGGAAGAGGCACAGGCTGG + Intergenic
999272904 5:150307958-150307980 AGGTTGGAAGAGGCCAGGGCGGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1006784330 6:36655160-36655182 TGGCTGAAAGGGGCCCTGGCTGG + Intergenic
1007247564 6:40473378-40473400 TGGCTAGAAGATGGCTGGGCTGG - Intronic
1007916909 6:45569561-45569583 AGCCTCGAAGTGGCCTGGGCTGG - Intronic
1017619782 6:156284562-156284584 AGGCTTGAAGAGGCAAGGGCCGG + Intergenic
1018769141 6:166956681-166956703 TGGCTCAGAGAGGCCGAGGCAGG + Exonic
1020094655 7:5361671-5361693 TGGCACGCAGAGGCCCTGGCAGG - Exonic
1024754996 7:52518922-52518944 TGGCTCAAAGAGGCTCAGGTAGG - Intergenic
1025106447 7:56175133-56175155 TGGCCCGCAGAGGCCGAGGCCGG - Intergenic
1025831443 7:65054680-65054702 TGGGTAGAAGAGGCCAGGGCAGG - Intergenic
1027231389 7:76274689-76274711 TGGCTGGATGAGCCCTGGGCTGG - Intronic
1029360967 7:100088579-100088601 GGGCTAGAAGAGGCCAGGCCGGG + Intergenic
1029462718 7:100705708-100705730 TGGTCAGAAGAGGCCTGGGCAGG - Intergenic
1033644292 7:143288670-143288692 AGGCTCGGAGCGGCTCGGGCGGG - Intronic
1034486528 7:151368276-151368298 TGGCTGGAAGAGGCACTGACAGG - Intronic
1037568168 8:20135315-20135337 TGGCTCAAAGTGGCAGGGGCTGG + Intergenic
1039887775 8:41665037-41665059 TGGCTGCCAGAGGACCGGGCTGG - Intronic
1049611954 8:143559972-143559994 GGGCCCGAAGAGGGCAGGGCAGG + Intronic
1049778392 8:144416550-144416572 TGGCGGGAAGAGGCCAGGGCTGG + Intronic
1060276778 9:122188514-122188536 TGGACCGAAGGGGCCCCGGCAGG - Intronic
1060673284 9:125489693-125489715 TGGCAAGAAGAGGCCACGGCAGG + Intronic
1060770075 9:126326525-126326547 GGGCTCGGGGAGGCCCGGGTGGG + Intergenic
1062076908 9:134594591-134594613 TGGCTGGAAGAGGGCAGGACAGG - Intergenic
1062370177 9:136234771-136234793 TGGCGCGATGAGGCTGGGGCGGG - Intronic
1062370199 9:136234848-136234870 TGGCGCGATGAGGCTGGGGCGGG - Intronic
1062380212 9:136283516-136283538 TGGCCCGGAGGGACCCGGGCTGG - Intronic
1185475592 X:413623-413645 TGGCTTGCAAAGGCCCGGGGTGG + Intergenic
1185508375 X:644871-644893 AGCCTTGGAGAGGCCCGGGCTGG - Exonic
1187318635 X:18220878-18220900 AGGCACAATGAGGCCCGGGCAGG + Exonic
1189275094 X:39779645-39779667 TGGCTGGAGGAGGAGCGGGCTGG - Intergenic
1197717321 X:129718911-129718933 TGCCACGAAGAGCCCTGGGCTGG + Intergenic