ID: 953899776

View in Genome Browser
Species Human (GRCh38)
Location 3:46833573-46833595
Sequence GCCGCAGATGTGCCTGCCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953899769_953899776 11 Left 953899769 3:46833539-46833561 CCGTCAGCACCCACGTGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 119
953899767_953899776 15 Left 953899767 3:46833535-46833557 CCTGCCGTCAGCACCCACGTGGC 0: 1
1: 0
2: 1
3: 9
4: 147
Right 953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 119
953899772_953899776 2 Left 953899772 3:46833548-46833570 CCCACGTGGCGGTGACCAGGGTG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 119
953899773_953899776 1 Left 953899773 3:46833549-46833571 CCACGTGGCGGTGACCAGGGTGC 0: 1
1: 0
2: 1
3: 5
4: 90
Right 953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953899776 Original CRISPR GCCGCAGATGTGCCTGCCTT TGG Exonic
900811021 1:4801446-4801468 GGCTCAGATGTGCCCGACTTGGG + Intergenic
901421006 1:9151090-9151112 TCGGGAGATGTGTCTGCCTTGGG - Intergenic
902929298 1:19719203-19719225 GCCTCGGATGTCTCTGCCTTGGG - Intronic
903647861 1:24905587-24905609 GCAGCAGCTGTGCCTGCCGTGGG + Intronic
906754120 1:48292600-48292622 GCTGCACATATGCCTGCCTATGG - Intergenic
908535759 1:65075521-65075543 GCCTCTGATGTGCCTCCCTTTGG + Intergenic
910112027 1:83693083-83693105 GCCCCAGCTGTGCCTGCTCTGGG + Intergenic
910609428 1:89125764-89125786 GCCGCAGCTGAGCCTGCTGTGGG - Intronic
913105283 1:115608790-115608812 GCCGCAGAAGAGCATGGCTTTGG - Intergenic
921751036 1:218794585-218794607 GCAGCAGATGTGGCTGGCTCAGG + Intergenic
1063369501 10:5512017-5512039 TCCACAAATGTGGCTGCCTTCGG + Intergenic
1066218433 10:33311348-33311370 GTCCCAGGTGGGCCTGCCTTGGG + Intronic
1074109053 10:110409610-110409632 GGCTCTGATTTGCCTGCCTTCGG - Intergenic
1074577269 10:114681921-114681943 GTGGCAGCTGTGACTGCCTTTGG + Intronic
1075304331 10:121354506-121354528 GAAGCAGATTTGGCTGCCTTTGG + Intergenic
1075864256 10:125704255-125704277 GCCAGAGAGGTGCCTGCCCTGGG + Intergenic
1077100371 11:819831-819853 GCCGTAGATGTGCGTGGCGTTGG - Exonic
1078663678 11:13307020-13307042 GTTGGTGATGTGCCTGCCTTTGG + Intronic
1083397806 11:62403174-62403196 GTCCCAGAAGTGCCCGCCTTAGG + Intergenic
1083793599 11:65001820-65001842 GCTGGGGATGTGCCTGCCCTGGG - Intergenic
1088086011 11:105981365-105981387 GCCACTGATGTGCATGGCTTTGG - Exonic
1090359623 11:126163414-126163436 GCCGCAGCTATGCCTGACATAGG - Intergenic
1091315152 11:134609494-134609516 GCAGCAGCTGAGCCGGCCTTGGG + Intergenic
1094413798 12:30196777-30196799 GCAGCAAATGTGTCTGCCTGTGG + Intergenic
1095294834 12:40516091-40516113 GCTGCAGGGGTGCCTGCCATGGG - Intronic
1096255680 12:50060674-50060696 CCCACAGATGTGGCTGCCTCAGG + Intronic
1097055036 12:56244037-56244059 GCTGCAGATGTGAGTGCCTGGGG - Exonic
1097275898 12:57813501-57813523 GCAGCACATGTGCATGCCCTTGG + Intronic
1098429982 12:70408572-70408594 GAAGCAGCTGTGCCTGCCGTGGG + Intronic
1098917898 12:76276122-76276144 GGCGGAGATGTGCCTGTCTGGGG + Intergenic
1101287798 12:103333927-103333949 GCAGCATAAGTGCCTGCCTGGGG + Intronic
1102437460 12:112936463-112936485 GCAGCAGAGGTGCCTGCCTAAGG - Intergenic
1104169379 12:126265317-126265339 GCAGCAGATGCTCCTGCCTGGGG + Intergenic
1106511578 13:30417903-30417925 TCCCCAGATGTGCCTGTCTCAGG + Intergenic
1106796752 13:33214530-33214552 GGCGCGGATGTTCCTGCATTTGG - Intronic
1112434865 13:99384651-99384673 GCCACAGAACTGCCTGCCTTTGG - Intronic
1118750900 14:68807335-68807357 GCAGCAGATCTGGTTGCCTTTGG - Intergenic
1119078633 14:71671135-71671157 TCCAGAGATGTGCCTTCCTTTGG + Exonic
1119545631 14:75469547-75469569 GCCCCAGATGGCCCTTCCTTTGG + Exonic
1120165225 14:81191274-81191296 GTTGCAGATGTGCATGACTTAGG + Intronic
1120557356 14:85945146-85945168 GCCACAGTTGTACCTGGCTTAGG - Intergenic
1127585499 15:60374023-60374045 GCCCCAGCTGTGCCAGGCTTGGG - Intronic
1132282377 15:100631371-100631393 CACACAGATCTGCCTGCCTTGGG + Intronic
1133219528 16:4313911-4313933 GCTGCAGTTCTGCCTGCCTGAGG + Intergenic
1133234028 16:4379384-4379406 GCCACAGACCTGCCTGACTTGGG + Intronic
1137447419 16:48540229-48540251 GCCTCAGGTGTGGCTGCCTGTGG - Exonic
1137602145 16:49763563-49763585 GGCGAAGAAGTGACTGCCTTTGG - Intronic
1138129428 16:54467011-54467033 GCCCCAGAGGGGGCTGCCTTGGG + Intergenic
1138584123 16:57959745-57959767 GAAGCTGATGTGGCTGCCTTGGG + Intronic
1141475421 16:84269929-84269951 GTCACAGATGTGCGTGCCTGTGG - Intergenic
1141724061 16:85774666-85774688 GCTGCAGAAGTGACTGCCTGAGG - Intronic
1147383085 17:40067167-40067189 GGGGCAGAGGGGCCTGCCTTGGG - Intronic
1150435469 17:65150851-65150873 GCCCCAGATGTGCTTGCCAATGG - Intronic
1151420892 17:73996750-73996772 GCTTCATCTGTGCCTGCCTTGGG - Intergenic
1152133538 17:78491386-78491408 GCCCCCGTTGTCCCTGCCTTGGG + Intronic
1152792293 17:82287844-82287866 GCCCCCGATGTGACTGCATTTGG + Intergenic
1155651625 18:28150418-28150440 GCCGCTGATTCTCCTGCCTTAGG - Intronic
1161650096 19:5479026-5479048 GCCACAGTTGTCCCTGGCTTAGG - Intergenic
1163699075 19:18778089-18778111 GCCACCGATGGGCCTGCCTGCGG - Exonic
1165306647 19:35006844-35006866 GCGACAGAGGTGCCTGCCTTAGG + Intronic
1165791534 19:38495683-38495705 GCCCTAGAGGAGCCTGCCTTGGG + Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
926523383 2:13945688-13945710 GCTGCACAAGTGACTGCCTTAGG + Intergenic
927849822 2:26491811-26491833 CCCGCAGATGTGCCAGCCCCAGG + Intronic
929602034 2:43210542-43210564 GCTGCAGATGTGCACGCCTATGG + Intergenic
929770532 2:44888032-44888054 TCAACAGATTTGCCTGCCTTAGG - Intergenic
929779553 2:44949119-44949141 CCCCTAGATGTGCCTGCCTGAGG + Intergenic
931813480 2:65877440-65877462 CCCTCAGAGGTGCCTGCCTTGGG + Intergenic
935290866 2:101610027-101610049 ACCTCAGATGTGACTGCATTTGG + Intergenic
938306881 2:130262658-130262680 GCAGGAGAGGTGGCTGCCTTGGG - Intergenic
939468373 2:142587002-142587024 GCCACAGGGCTGCCTGCCTTTGG + Intergenic
939510159 2:143095072-143095094 GCCCTAGGTGTGACTGCCTTAGG - Intronic
943637241 2:190319673-190319695 GCCGCTGAAGAGCCTGCCCTTGG + Intronic
945957542 2:216100137-216100159 GACGCTGATCTGCCTGCCTGTGG + Exonic
946360169 2:219214621-219214643 GCTGCAGAGGTGCCTCCCTGTGG - Intronic
947375076 2:229487851-229487873 CATGCACATGTGCCTGCCTTGGG - Intronic
947621826 2:231595727-231595749 GCAGCAGAACTGCCTGCTTTAGG + Intergenic
948455160 2:238101435-238101457 GCGGGAGCTGTGCCTGCCTGGGG + Intronic
949041418 2:241851639-241851661 CCCACATATGTGCCTGCCTGCGG - Intronic
1172084514 20:32370016-32370038 GCCACAGATGTGCCTTAATTAGG + Intronic
1172099336 20:32475846-32475868 GGAGCAGATGTGTCTGCCTCAGG - Intronic
1178935035 21:36854358-36854380 GCCCCAGATGTGCCTGTCTCTGG - Intronic
1180902959 22:19387854-19387876 GCGGCACATGTGTCTGCCTGGGG - Intronic
1181459817 22:23079288-23079310 GGCTCAGATGTCCCTTCCTTAGG - Intronic
950675841 3:14554000-14554022 GCCCCAGATGTGACTGCCCTGGG + Intergenic
950706885 3:14788410-14788432 GCTGTAAATGTGCCTGCTTTGGG - Intergenic
953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG + Exonic
955966740 3:64396703-64396725 TCCGCAGCTGTGACTGCCTTTGG - Intronic
958675642 3:97265457-97265479 GCCGGATATGTGCCTGCTTGGGG - Intronic
960679155 3:120228856-120228878 GCACCAGATGTGCTTCCCTTTGG + Intronic
965374008 3:167898961-167898983 GCCTCAGAAGTACCTGGCTTTGG + Intergenic
968534282 4:1113545-1113567 GGCGCAGAGCTGCCCGCCTTCGG - Intronic
969259109 4:6022495-6022517 GTGGCAGATGTGCCTGACCTGGG + Intergenic
969651320 4:8469834-8469856 AACGCAGAGGTGCCTGCCTGAGG - Intronic
971191403 4:24432278-24432300 GGAGAAGATGTGCCTGCCATGGG + Intergenic
971333071 4:25698393-25698415 GCCTCAGGTAAGCCTGCCTTGGG - Intergenic
985492590 5:188137-188159 GGCGCTGGTGTGCCTGCCCTGGG + Exonic
985649433 5:1100476-1100498 TCCGCAGATGGGCTTGCCTTTGG - Intronic
989634406 5:43519149-43519171 GCCACAGCTGTCCCAGCCTTCGG + Intergenic
994638327 5:102371377-102371399 CCCACAGAAGTGCCTTCCTTTGG - Intergenic
997487870 5:134246930-134246952 AGAGCAGATGTGCCTGCCTGAGG + Intergenic
1000597584 5:163233439-163233461 GCCCCACATTGGCCTGCCTTTGG + Intergenic
1000863792 5:166488267-166488289 GCTGCAGATGTGTGTGCCTGAGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1011855956 6:91691684-91691706 GCCGCAGATGTGCTTACCTAAGG - Intergenic
1014090871 6:117402269-117402291 GCCACAGATGTTCTTGCCTTAGG + Intronic
1017146458 6:151240038-151240060 GCAGCAGAAGCTCCTGCCTTGGG + Exonic
1018970844 6:168527671-168527693 GCCGCTGATGGGCCTCCCGTTGG - Exonic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1029629585 7:101742246-101742268 GCTCCAGTTGTGCCTGTCTTAGG + Intergenic
1032026570 7:128447270-128447292 GCCTCAGATATGCCTGCTATGGG + Intergenic
1035052939 7:156014281-156014303 GCCTCTGATGTCACTGCCTTGGG + Intergenic
1035446622 7:158947647-158947669 GCTGCAGATGGTCCTCCCTTGGG - Intronic
1035568685 8:658591-658613 GCCCCCGATGTGGCTGCATTTGG + Intronic
1037015679 8:13903253-13903275 GACACAGATGTGTCTGTCTTGGG - Intergenic
1041411377 8:57560273-57560295 GCCTCACATATGCATGCCTTTGG - Intergenic
1042561002 8:70071921-70071943 GCCGCAGCTGTCACTTCCTTCGG + Intergenic
1042857578 8:73283803-73283825 TCAGGTGATGTGCCTGCCTTGGG - Intergenic
1057919088 9:99082027-99082049 CCCTCACCTGTGCCTGCCTTTGG + Intergenic
1061048231 9:128178940-128178962 GCTGCAGCTGCACCTGCCTTGGG + Exonic
1061048247 9:128179024-128179046 GCTGCAGCTGCACCTGCCTTGGG + Exonic
1061077811 9:128352501-128352523 ACCTCACATCTGCCTGCCTTGGG - Intronic
1062333510 9:136054943-136054965 CCTGCAGCTGTGCCAGCCTTCGG + Intronic
1062731081 9:138109623-138109645 GCCCCAGATGTGACTGTATTTGG - Intronic
1187042598 X:15612558-15612580 GCCACAGATGGGCCAGCATTGGG - Intergenic
1188344095 X:29043080-29043102 GCCTCAGATGGAACTGCCTTAGG - Intronic
1193073731 X:77333325-77333347 GCTGCAGATGTGGGTTCCTTTGG + Intergenic
1194097962 X:89666436-89666458 GCCTGAGATTTGCCTGCCTGAGG - Intergenic
1195342492 X:103919012-103919034 GCCGCAGCCGTGACTTCCTTGGG - Intronic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic
1200057027 X:153467075-153467097 GGCGCAGATTTGCCTGACTCAGG - Intronic
1200082903 X:153588097-153588119 AACGCAGATGTGGCTGCCTTGGG + Exonic
1200450984 Y:3327825-3327847 GCCTGAGATTTGCCTGCCTGAGG - Intergenic