ID: 953901046

View in Genome Browser
Species Human (GRCh38)
Location 3:46844601-46844623
Sequence CAGCAGCCCCAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953901046_953901050 -3 Left 953901046 3:46844601-46844623 CCCTGCTCCTTCTGGGGCTGCTG No data
Right 953901050 3:46844621-46844643 CTGGTCTCCCTCTCTGCTACTGG No data
953901046_953901053 16 Left 953901046 3:46844601-46844623 CCCTGCTCCTTCTGGGGCTGCTG No data
Right 953901053 3:46844640-46844662 CTGGAGCCTGTGTCCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953901046 Original CRISPR CAGCAGCCCCAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr