ID: 953902283

View in Genome Browser
Species Human (GRCh38)
Location 3:46850112-46850134
Sequence TGCAGTCCGTCTTCAAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953902283_953902288 5 Left 953902283 3:46850112-46850134 CCCCCTCTTGAAGACGGACTGCA No data
Right 953902288 3:46850140-46850162 CCTGAGTCAGCCCTCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953902283 Original CRISPR TGCAGTCCGTCTTCAAGAGG GGG (reversed) Intergenic
No off target data available for this crispr