ID: 953902288

View in Genome Browser
Species Human (GRCh38)
Location 3:46850140-46850162
Sequence CCTGAGTCAGCCCTCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953902286_953902288 2 Left 953902286 3:46850115-46850137 CCTCTTGAAGACGGACTGCACAG No data
Right 953902288 3:46850140-46850162 CCTGAGTCAGCCCTCAGAGCAGG No data
953902283_953902288 5 Left 953902283 3:46850112-46850134 CCCCCTCTTGAAGACGGACTGCA No data
Right 953902288 3:46850140-46850162 CCTGAGTCAGCCCTCAGAGCAGG No data
953902284_953902288 4 Left 953902284 3:46850113-46850135 CCCCTCTTGAAGACGGACTGCAC No data
Right 953902288 3:46850140-46850162 CCTGAGTCAGCCCTCAGAGCAGG No data
953902285_953902288 3 Left 953902285 3:46850114-46850136 CCCTCTTGAAGACGGACTGCACA No data
Right 953902288 3:46850140-46850162 CCTGAGTCAGCCCTCAGAGCAGG No data
953902281_953902288 23 Left 953902281 3:46850094-46850116 CCATCACTATGAGAAAGGCCCCC No data
Right 953902288 3:46850140-46850162 CCTGAGTCAGCCCTCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953902288 Original CRISPR CCTGAGTCAGCCCTCAGAGC AGG Intergenic
No off target data available for this crispr