ID: 953903090

View in Genome Browser
Species Human (GRCh38)
Location 3:46854232-46854254
Sequence CGGGCTCTGGCCAGCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953903090_953903095 14 Left 953903090 3:46854232-46854254 CCAGGAAGGCTGGCCAGAGCCCG No data
Right 953903095 3:46854269-46854291 ACACATGAAGATGCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953903090 Original CRISPR CGGGCTCTGGCCAGCCTTCC TGG (reversed) Intergenic
No off target data available for this crispr