ID: 953904135

View in Genome Browser
Species Human (GRCh38)
Location 3:46859888-46859910
Sequence GCTGCCCTGAGCCACCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953904133_953904135 2 Left 953904133 3:46859863-46859885 CCTTTGCTATTCACAAAGGGAGT 0: 1
1: 0
2: 1
3: 14
4: 123
Right 953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG 0: 1
1: 0
2: 0
3: 19
4: 247
953904129_953904135 9 Left 953904129 3:46859856-46859878 CCATAGCCCTTTGCTATTCACAA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG 0: 1
1: 0
2: 0
3: 19
4: 247
953904132_953904135 3 Left 953904132 3:46859862-46859884 CCCTTTGCTATTCACAAAGGGAG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG 0: 1
1: 0
2: 0
3: 19
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953904135 Original CRISPR GCTGCCCTGAGCCACCACGG AGG Intronic
900013149 1:132922-132944 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
900043215 1:488909-488931 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
900064652 1:723906-723928 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
900346141 1:2211078-2211100 GATGCCCTTGGGCACCACGGCGG + Intronic
900555709 1:3279366-3279388 GCTGCCCCGAGGCACCGCGAGGG - Intronic
900892742 1:5461364-5461386 GCTGAGCTGAGCCGCCATGGGGG - Intergenic
900898780 1:5503018-5503040 TCTGGCCTGAGCCAGCACAGTGG + Intergenic
904007174 1:27369453-27369475 GATTCCCTGAGCCTCCACAGTGG - Exonic
904115217 1:28156865-28156887 GCTGCCCCCAGCCACCACACAGG - Intronic
904307461 1:29599338-29599360 CCTGCCCTCAGCCCCCATGGTGG - Intergenic
904799999 1:33085912-33085934 GGTGCCCTGGGCCTCCACGTGGG + Intronic
905877559 1:41442732-41442754 GCTGCCCTTGGCCAGCACTGGGG - Intergenic
907480616 1:54743379-54743401 CCTGCCCTGAGCCATCATGTGGG + Intergenic
912800629 1:112717634-112717656 TGGGCCCTGAGCCACCACTGTGG - Intergenic
916399644 1:164432820-164432842 GGTGCCCTGAGTCACCACAAGGG + Intergenic
917534957 1:175867822-175867844 CCTGCCCTGACACACCAGGGAGG - Intergenic
917977625 1:180250605-180250627 GCTTCCCTGAGCCGCCACACTGG - Intronic
918038819 1:180899708-180899730 GCCTCCCTGAGCCAGCACAGAGG + Intergenic
920055445 1:203187455-203187477 GCTGCAGTGAGGCACCATGGAGG + Intergenic
920084019 1:203401348-203401370 TCTGCCCTGGGCCTCCAAGGAGG - Intergenic
920386204 1:205571662-205571684 GCTGCCCAGAGTCAGCAAGGTGG - Intronic
920515823 1:206584131-206584153 GCTGGCCTGAGCCTCCTGGGAGG + Intronic
921070904 1:211656839-211656861 GAGGCCCTGAGCCACCACGCAGG - Intergenic
922099549 1:222469922-222469944 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
922261586 1:223949418-223949440 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
922735493 1:227976326-227976348 GCTGGGCTGAGCCACCCAGGGGG - Intergenic
924342751 1:243051594-243051616 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
924422123 1:243919334-243919356 GCTGCCCTGAACAACCAAGAGGG - Intergenic
1063548081 10:7001389-7001411 GGAGCCCTGAGCCACCGTGGAGG + Intergenic
1066733727 10:38453960-38453982 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
1068765463 10:60758491-60758513 GCAGGCGTGAGCCACCACGCTGG - Intergenic
1069826051 10:71255918-71255940 CCTGCTCTGAGCCCCCACGGTGG + Intronic
1070783768 10:79151633-79151655 GCTGCTCAGAGCCAGCACTGAGG + Intronic
1072075563 10:91969685-91969707 ACAGGCCTGAGCCACCACGCTGG - Intronic
1072919069 10:99560181-99560203 ACTGGCGTGAGCCACCACGCCGG + Intergenic
1073065640 10:100757640-100757662 GCAGCCCTGGGACACAACGGTGG + Intronic
1073572619 10:104593258-104593280 GCTGCCCTGAGGTGCCAGGGAGG - Intergenic
1075426849 10:122348598-122348620 TCTGCCCTGAGCCACCAGAAAGG + Intergenic
1076235901 10:128863757-128863779 CCTGCCATGAGCCACCCCAGTGG + Intergenic
1076522811 10:131091402-131091424 TCTGCCCAGAGCCACCAGGGAGG - Intergenic
1076566137 10:131400730-131400752 GCTTGCCTGGGCCACCGCGGAGG + Intergenic
1076822425 10:132946142-132946164 GCTCCCCTGTGCCTCCACAGGGG - Intergenic
1076969486 11:125126-125148 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
1077315336 11:1917197-1917219 GCTGACCTGAGCCCCCAGGCTGG - Intergenic
1077472177 11:2769287-2769309 CCTGCCCTGAGTCACCAAGCTGG + Intronic
1082064707 11:47890714-47890736 GCAGGCATGAGCCACCACGCAGG - Intergenic
1083228562 11:61300360-61300382 GCTGACCTGTGCCACCCAGGGGG - Intronic
1085521955 11:77144326-77144348 CCTGCCCAGAGCCCCCAGGGTGG + Intronic
1085622271 11:78046375-78046397 GCTGGCCGGAGCCGCGACGGCGG + Intronic
1087253854 11:95933915-95933937 GCTGCCCACAGACACCAAGGAGG - Intergenic
1089840970 11:121417271-121417293 GCTGCCCAGAGCCAACAAGGTGG + Intergenic
1090004060 11:122984588-122984610 GGTGCCCTGAGGAACCGCGGCGG + Intergenic
1091259437 11:134223310-134223332 GCTGCCCTGAGACACCTCAGAGG + Intronic
1091280289 11:134377910-134377932 ACTGCCCTGCTCCTCCACGGAGG - Intronic
1093450432 12:19307194-19307216 ACTGGCCTGAGCCACCATGTGGG - Intronic
1093493047 12:19726248-19726270 GCTGCCCTCAGCCCCCACCTCGG + Intergenic
1096304835 12:50465074-50465096 CCTGGCCTGAGCCACCATGCAGG - Intronic
1098504838 12:71237506-71237528 GCTCCCCTGAGGCACCAGGTAGG + Intronic
1099202119 12:79690065-79690087 GGTGCCCAGAGCCCCCGCGGGGG + Exonic
1100494637 12:95113059-95113081 CCTGACCTCAGCCACCACGCTGG + Intronic
1101437257 12:104674558-104674580 TCTGCTCTGAGCCACCACCCAGG + Intronic
1102318071 12:111905747-111905769 TCTGTTCTGAGCCACCACTGGGG - Intergenic
1102346859 12:112166297-112166319 GCTGCCCTGAGTGACCCAGGGGG + Intronic
1102437765 12:112938642-112938664 GCTGCCCTGAGGGAGCGCGGGGG + Exonic
1102944495 12:116974126-116974148 GCTTCCCTGAGCCCTCACTGGGG - Intronic
1102955118 12:117054144-117054166 GCAGCTCTGAGCCACCTGGGAGG - Intronic
1103295001 12:119878471-119878493 CAGGCCCTGAGCCACCACGCCGG + Intergenic
1103373441 12:120437030-120437052 ACAGCCATGAGCCACCACGCTGG + Intergenic
1103972078 12:124678727-124678749 GCTGCCCTGGGCCAGGACGGTGG + Intergenic
1105681606 13:22733893-22733915 GCTGCCATGAGCCAAGACTGAGG + Intergenic
1105835514 13:24207781-24207803 GCTATCCTGAGCCATCAGGGAGG + Intronic
1106303840 13:28494060-28494082 GCTGCGCTCAGCCACCCGGGTGG - Intronic
1108244861 13:48504120-48504142 TCTCCCCTCAGCCACCACTGGGG + Intronic
1113726011 13:112602421-112602443 TCTTCCGTGAGCCACCACCGTGG + Intergenic
1116117137 14:40669051-40669073 GCTGACCTGAGTCAAAACGGGGG - Intergenic
1120980085 14:90281464-90281486 TCTCCCCTGTGCGACCACGGGGG + Intronic
1122804122 14:104248088-104248110 GGTGCCCTGGGCCACCAGAGGGG - Intergenic
1122860795 14:104581581-104581603 TCAGGCCTGAGCCACCCCGGAGG + Intronic
1123191890 14:106579359-106579381 GCTGGCCTGAGCCTCCTGGGAGG + Intergenic
1123764689 15:23466482-23466504 GCAGGCCTGAGCCACCATGCAGG + Intergenic
1123970866 15:25506992-25507014 GCTAGACTGAGCCACCTCGGAGG - Intergenic
1124545845 15:30626121-30626143 GACACCCGGAGCCACCACGGGGG - Intronic
1124779363 15:32615508-32615530 GACACCCAGAGCCACCACGGGGG - Exonic
1125160602 15:36639327-36639349 GCAGGCGTGAGCCACCACGCTGG - Intronic
1126183557 15:45809568-45809590 GGTGCCCTGACCCACCAAGGGGG + Intergenic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1128119245 15:65133574-65133596 GCAGCCCCGAGCCTCCGCGGAGG - Exonic
1128156673 15:65395858-65395880 GCTGCCCAGCGCCCCCACGCGGG - Exonic
1129454735 15:75670605-75670627 GCTGCCCTGCTCCTCCATGGGGG + Intergenic
1132935072 16:2475763-2475785 CCAGCCCTGAGCCAGCACAGCGG + Intronic
1133000473 16:2848711-2848733 GCAGGCGTGAGCCACCACGCCGG - Intergenic
1134232402 16:12439010-12439032 GCTGCCATGTGCAACCACGATGG - Intronic
1136403721 16:30031443-30031465 GGGGCCCTGAGCCCCCACAGGGG + Intronic
1136687291 16:32002925-32002947 GCTTCCCTGTGCCACCCCAGCGG + Intergenic
1136787903 16:32946476-32946498 GCTTCCCTGTGCCACCCCAGCGG + Intergenic
1136881878 16:33907313-33907335 GCTTCCCTGTGCCACCCCAGCGG - Intergenic
1137339230 16:47583071-47583093 ACAGCCATGAGCCACCACGCCGG + Intronic
1141420805 16:83914307-83914329 GCTGCCCGGCCACACCACGGCGG - Intronic
1142198430 16:88749596-88749618 GCTGCCCTGAGCCAGAGCCGTGG + Intronic
1142329234 16:89440329-89440351 ACAGGCCTGAGCCACCACGCTGG - Intronic
1142413319 16:89926991-89927013 GCAGGCATGAGCCACCACGCCGG + Intronic
1203090133 16_KI270728v1_random:1208133-1208155 GCTTCCCTGTGCCACCCCAGCGG + Intergenic
1146039499 17:29437472-29437494 ACAGGCCTGAGCCACCACGCCGG + Intronic
1146882083 17:36450183-36450205 GCTGCACTGAGCCACAACGTGGG - Intergenic
1147148270 17:38498594-38498616 GCTTCCCTGTGCCACCCCAGCGG + Intronic
1147442981 17:40458672-40458694 GTCTCCCTGAGGCACCACGGCGG + Intergenic
1148153563 17:45410356-45410378 GTTGCCCTGTGCCAGCACTGGGG - Intronic
1149845725 17:60008589-60008611 ACTGCACTGAGCCACAACGTGGG - Intergenic
1150084073 17:62265169-62265191 ACTGCACTGAGCCACAACGTGGG - Intergenic
1151721771 17:75860939-75860961 TCCGCCGTGAGCCACCACGCCGG - Intergenic
1151786399 17:76277132-76277154 CCTGCCTGGAGCCACCAGGGAGG - Intronic
1154082220 18:11269106-11269128 GATGCCCTGAGCCACCAAACAGG - Intergenic
1154274378 18:12947250-12947272 GGTGCTAGGAGCCACCACGGGGG - Intronic
1159917685 18:74201039-74201061 GCTGCCCTAAGCCGCCTGGGAGG + Intergenic
1160511228 18:79454608-79454630 GCCGCCCTGAGACACCTGGGAGG - Intronic
1160594381 18:79964068-79964090 GCAGGCCTGGGCCACCACGCCGG - Intergenic
1160646291 19:195052-195074 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
1160717297 19:582171-582193 GCTGCCCCGAGCCACCCCTGGGG + Intronic
1161221437 19:3119902-3119924 GCTGCCCTGACACACCCCGTGGG - Intronic
1161659991 19:5539995-5540017 GCTGCCAACAGCCAGCACGGTGG + Intergenic
1161699694 19:5787879-5787901 GATGCCCTGATCCACCTCTGGGG - Intronic
1163018602 19:14471360-14471382 ACAGGCCTGAGCCACCACGCCGG + Intronic
1163267469 19:16229534-16229556 CCTGCCCTGAGCCCCCCTGGTGG - Intronic
1163430912 19:17267037-17267059 GCTGGCCTGAGCCTCCATGTGGG - Intronic
1164800144 19:31069197-31069219 GGTGCTCTGAGACACCACAGCGG - Intergenic
1165489005 19:36112658-36112680 AGTGTCCTGAGCCACCACGGAGG - Intronic
1165844503 19:38809541-38809563 GCTGCAGTGAGCCACCATCGTGG - Intronic
1168272991 19:55260018-55260040 GCAGGCGTGAGCCACCACGCTGG - Intergenic
1168671268 19:58243102-58243124 CCTGGCCTGAGCCACCATGCTGG + Intronic
926679803 2:15654542-15654564 CCTGCCCTCAGCCACGACGCTGG + Intergenic
927317870 2:21706641-21706663 GCTTCCCTGAGCCACACTGGAGG + Intergenic
927497820 2:23562530-23562552 GCTGGCCTGAGCCTGCAGGGAGG - Intronic
929979294 2:46663865-46663887 TCTGTCCTGAGCCAGCAGGGCGG - Intergenic
931398918 2:61912910-61912932 GCAGGCCTGTGCCACCACGCAGG - Intronic
932492580 2:72131558-72131580 CCTGCCCAGGGCCACCAGGGAGG + Exonic
933001098 2:76924728-76924750 GCTGAACTGAGCCACCACATAGG + Intronic
933721551 2:85400593-85400615 GGTGAGCTGAGCCACCAAGGTGG - Intronic
934557020 2:95292791-95292813 GCTGCCCTGAGCAGCCACCTGGG - Intergenic
934710253 2:96509665-96509687 GCCGCCCTCAGCCACCAAGTCGG + Intergenic
935263772 2:101377405-101377427 GCTGCCCTGATTCACCAAGAAGG + Intronic
935328617 2:101960408-101960430 GCTTCCCAGAGCCCCCACTGAGG + Intergenic
935506837 2:103915798-103915820 GCAGGCTTGAGCCACCACGCCGG - Intergenic
937297849 2:120820501-120820523 GCTGCCTTGAGGCACTCCGGGGG + Intronic
938070315 2:128304963-128304985 ACTGCCCTGGGCCACCAGGAAGG - Intronic
938731906 2:134153194-134153216 ACTGGCGTGAGCCACCACGCCGG + Intronic
943820433 2:192314827-192314849 GCTGCCCTCAGCCCCCACCTCGG + Intergenic
944252800 2:197594288-197594310 ACAGGCCTGAGCCACCACGCTGG + Intronic
945240217 2:207669692-207669714 ACAGGCCTGAGCCACCACGCCGG + Intergenic
945609074 2:211975256-211975278 ACAGCCATGAGCCACCACCGTGG + Intronic
946163571 2:217850186-217850208 ACTGCTCTGAGCCAGCCCGGGGG + Intronic
947711650 2:232319795-232319817 GCTTCCCTGAGCTACCACTCTGG - Intronic
949013839 2:241698166-241698188 ACAGGCGTGAGCCACCACGGCGG - Intergenic
1168809890 20:698294-698316 GCTGCCCACACCCACCACTGAGG - Intergenic
1168879772 20:1196415-1196437 TCTGCCCTGAGACACGAGGGTGG - Intergenic
1171487613 20:25495646-25495668 CCTGTCCTGAGCTACCCCGGAGG + Intronic
1171866336 20:30489254-30489276 GCTGCCCTGGGTCCCCACCGCGG + Intergenic
1171962262 20:31503342-31503364 GCCTCCCAAAGCCACCACGGTGG + Intergenic
1173795501 20:45856915-45856937 CCTGCCCTAAGCCTTCACGGGGG - Intronic
1174059356 20:47821696-47821718 GCTTCCCTGAGCCAAGACAGTGG + Intergenic
1175129132 20:56775997-56776019 GCTGCCCTGTGTCACCCTGGGGG - Intergenic
1175426436 20:58870349-58870371 CCTGCCCTCAGCCACCACTCAGG - Intronic
1175916318 20:62427636-62427658 ACTGCCCTGAGCCGCCAGGCGGG + Intergenic
1176110692 20:63409473-63409495 GCTGGCAGGGGCCACCACGGTGG + Intronic
1178359943 21:31940812-31940834 TCTGCCCAGAGCGACCACAGAGG - Intronic
1178522291 21:33296415-33296437 GCTGCCCTGATCCCTCACTGAGG - Exonic
1180184412 21:46132404-46132426 GCTGCCCAAGGCCAGCACGGTGG - Exonic
1180612373 22:17106364-17106386 GCTGCCCTGAGCCACAGGGGTGG + Intronic
1181493470 22:23275059-23275081 CCTGCCCTGGGCCACCAGGCAGG + Intronic
1182512593 22:30829594-30829616 GCAGGCGTGAGCCACCACGCCGG + Intronic
1182782739 22:32881007-32881029 GCTGCCCCAGGCCACCACGTGGG - Intronic
1183708612 22:39489623-39489645 GCTGTCGTGAGCCAACACAGGGG + Exonic
1183736008 22:39645375-39645397 GCTGCCCTGGGCGACCCGGGTGG - Intronic
1184018513 22:41803853-41803875 ACAGGCGTGAGCCACCACGGTGG - Intronic
1184130547 22:42514390-42514412 ACTGCCCTGAGCCCCCGCAGGGG + Intronic
1184140726 22:42576220-42576242 ACTGCCCTGAGCCCCCGCAGGGG + Intergenic
1184235437 22:43180663-43180685 GCTGCCCTGTGCCATCAGGCCGG - Intronic
1184424569 22:44402018-44402040 GCTGCCCTCTGCCCCCAAGGAGG + Intergenic
1185409872 22:50676247-50676269 ACTTTCCTGTGCCACCACGGAGG - Intergenic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG + Intronic
954194546 3:48988959-48988981 GCTGGCATGCGCCACCATGGCGG - Intergenic
955358360 3:58250591-58250613 GCTCCCCTCAGCCACCACACTGG - Intronic
956719224 3:72103286-72103308 GCTGCCATGAGCCATCCAGGTGG - Intergenic
961509671 3:127393187-127393209 GAAGCCCTGAGCCACCACATTGG + Intergenic
961636228 3:128334849-128334871 GCTGCCCTATACCACCATGGTGG - Intronic
961672856 3:128547597-128547619 GCTGGCCTGAGTCAGCACGTGGG - Intergenic
968371390 3:198224474-198224496 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
969842040 4:9889825-9889847 GCTGCCCTGAGCCATGCAGGGGG + Intronic
971882148 4:32391277-32391299 GCAGGCATGAGCCACCACAGCGG - Intergenic
977034733 4:91935321-91935343 GCTGCCCACAGACACCAAGGAGG + Intergenic
979260077 4:118636947-118636969 GCTGGGCTGAGCCACCCAGGGGG - Intergenic
979328300 4:119403681-119403703 GCTGGGCTGAGCCACCCAGGGGG + Intergenic
984511372 4:180682984-180683006 GATGCCCACAGCCACCATGGTGG + Intergenic
984822238 4:183892167-183892189 GCGGCCCGGAGCCATCTCGGAGG - Intronic
985621236 5:957272-957294 GCTGCCCCGAGCCAGCTCTGAGG - Intergenic
985898055 5:2762167-2762189 ACAGCCCTGAGCAACCACGGGGG + Intergenic
991775038 5:70076148-70076170 CCTAGCCTGAGCCACCACGCCGG + Intronic
991854331 5:70951568-70951590 CCTAGCCTGAGCCACCACGCCGG + Intronic
996715046 5:126580371-126580393 ACAGGCGTGAGCCACCACGGTGG + Intronic
997270912 5:132537135-132537157 GCTGACATCAGCCACCACAGTGG + Intergenic
998116289 5:139540193-139540215 ACAGCCATGAGCCACCACGCCGG + Intronic
1001403011 5:171457315-171457337 GCTGCCCCGAGACACCGCGCAGG + Exonic
1001568201 5:172713996-172714018 GCTGCCCAGAGCCCCCTGGGTGG + Intergenic
1002122689 5:177017646-177017668 ACAGGCCTGAGCCACCACGCTGG + Intronic
1002582225 5:180215813-180215835 GCTGCTTTGAGCCACTACGTTGG + Intergenic
1002730628 5:181330020-181330042 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
1006417003 6:33910649-33910671 GCTGGCCTGAACCGCCATGGAGG - Intergenic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1010238020 6:73591187-73591209 ACAGGCGTGAGCCACCACGGCGG + Intergenic
1015678887 6:135781639-135781661 CCTGCCCTGAGCGGCCACAGAGG + Intergenic
1019029269 6:168996066-168996088 GCTTCCCTGGGCCACAATGGAGG + Intergenic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1019109540 6:169698790-169698812 GCTGCCAGGTGCCACCACCGTGG - Intronic
1021111274 7:16697364-16697386 GCAGGCATGAGCCACCACGCCGG + Intronic
1022842984 7:34182276-34182298 GCTGCAGAGAGCCACCATGGGGG + Intergenic
1023401791 7:39796548-39796570 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
1023889772 7:44383807-44383829 TCTGCCCTGAGCCACCACCCTGG - Exonic
1023930261 7:44701073-44701095 GCTGCCCTGGGATACCGCGGGGG + Intronic
1024075772 7:45817193-45817215 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
1024342564 7:48282388-48282410 GCTGCCCAGAGCCCCCTCAGTGG + Intronic
1024647826 7:51384114-51384136 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
1024880565 7:54081108-54081130 ACTGCCCTGAGCCACAGTGGAGG - Intergenic
1025051667 7:55738601-55738623 GCTGGGCTGAGCCACCCGGGGGG + Intergenic
1025128629 7:56364268-56364290 GCTGGGCTGAGCCACCCAGGGGG + Intergenic
1025177008 7:56807151-56807173 GCTGGGCTGAGCCACCCAGGGGG + Intergenic
1025235546 7:57232287-57232309 GCTTCCCTGAGCCAAGACAGTGG - Intergenic
1025694784 7:63769235-63769257 GCTGGGCTGAGCCACCCAGGGGG - Intergenic
1026987005 7:74561045-74561067 GCTGGCCAGAGCCTCCAGGGCGG + Intronic
1028417581 7:90596355-90596377 GCGGCGCGGGGCCACCACGGCGG + Intronic
1031030280 7:116726923-116726945 GCTGCCCAGAAGCACCACTGTGG + Intronic
1032052304 7:128656940-128656962 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
1032163825 7:129530363-129530385 ACAGGCCTGAGCCACCACGTTGG - Intergenic
1034524294 7:151647016-151647038 GCTACCCTGGGCTACCAGGGAGG + Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036669540 8:10772378-10772400 CCTGCCCTGAGCCACTATGGCGG + Intronic
1036810674 8:11866329-11866351 GCTGTCCTGAGCCAACACCCAGG + Intronic
1039404139 8:37298244-37298266 GCTGCACTCAGCCACCAAGGCGG - Intergenic
1041244992 8:55880636-55880658 CCTGCCCGGGGCCACCAGGGAGG - Intronic
1042561314 8:70073662-70073684 GCAGACCTGAGCCACCACACCGG + Intergenic
1043743897 8:83849038-83849060 GCTGCTCTGAGCCACTCCAGTGG + Intergenic
1044542245 8:93420987-93421009 GCAGCCCTGAGCCAGCAGGGAGG + Intergenic
1045168766 8:99639882-99639904 GCTTCCTTGAGCCACCACTGAGG + Intronic
1047747494 8:127855697-127855719 GCTGTCCTGAGCAACCTCGCTGG - Intergenic
1049204947 8:141359303-141359325 GCTGCCCTGAGCCAGGCCAGGGG - Intronic
1052771924 9:32697820-32697842 GCTGCCCTGAGCCTGCGGGGTGG - Intergenic
1056836894 9:89962739-89962761 GCCACCCTGAGCCACTAAGGGGG - Intergenic
1058200921 9:102039390-102039412 GCTTCCCTGAGCCACATTGGAGG + Intergenic
1060204386 9:121674079-121674101 GCTTCCCTGAGGCCCCATGGAGG + Intronic
1060348820 9:122839470-122839492 ACTGCCCTGCACCACCTCGGTGG - Intergenic
1060468873 9:123930682-123930704 GCAGAGCTGAGCCACCACGTGGG - Intergenic
1061709330 9:132476895-132476917 GCTGCCTTCAGCCACCAAGGTGG + Intronic
1061719341 9:132542175-132542197 GCTGCCCTGAGCCAGGTCTGTGG + Intronic
1062091809 9:134682346-134682368 GCTTCCTTTAGCCACCACAGCGG + Intronic
1062099671 9:134721551-134721573 TCTGCCCTGGGCCACCCCTGGGG - Intronic
1062395183 9:136349920-136349942 CCTGCCCAGAGCCCCCACCGGGG - Intronic
1062755037 9:138282530-138282552 GCTGGGCTGAGCCACCCGGGGGG - Intergenic
1185909207 X:3966507-3966529 GCTGCATTGATCCTCCACGGGGG - Intergenic
1186026968 X:5323885-5323907 GCAGCCCTGAGCCCCCAGGTAGG - Intergenic
1188716884 X:33469558-33469580 GCTTCCCTGAGCCACATTGGAGG - Intergenic
1192542198 X:71983659-71983681 ACTACCCAGAGCCACCACAGTGG + Intergenic
1194978024 X:100412100-100412122 GCTCCCTTGAGCCACCACTCTGG - Intergenic
1195383236 X:104290484-104290506 GCAGACCTGAGCCACCACGCCGG + Intergenic
1198158638 X:133985833-133985855 GCTGCCGGGAGCCACCGCGCGGG - Intronic
1199607147 X:149586263-149586285 CCAGCCCTGAACCACCCCGGGGG - Intronic
1199631975 X:149783105-149783127 CCAGCCCTGAACCACCCCGGGGG + Intronic
1202381569 Y:24279317-24279339 GCTGGGCTGAGCCACCTGGGGGG - Intergenic
1202489216 Y:25390809-25390831 GCTGGGCTGAGCCACCTGGGGGG + Intergenic