ID: 953906057

View in Genome Browser
Species Human (GRCh38)
Location 3:46868749-46868771
Sequence GACTTCTCAGGGGCCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953906046_953906057 14 Left 953906046 3:46868712-46868734 CCAGGCTTGGTCCATTCTGGAAG 0: 1
1: 0
2: 0
3: 19
4: 130
Right 953906057 3:46868749-46868771 GACTTCTCAGGGGCCTGGACTGG 0: 1
1: 0
2: 2
3: 24
4: 191
953906050_953906057 3 Left 953906050 3:46868723-46868745 CCATTCTGGAAGAAGGGCATGGC 0: 1
1: 0
2: 1
3: 13
4: 199
Right 953906057 3:46868749-46868771 GACTTCTCAGGGGCCTGGACTGG 0: 1
1: 0
2: 2
3: 24
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953906057 Original CRISPR GACTTCTCAGGGGCCTGGAC TGG Intronic
900205990 1:1432115-1432137 AAACTCCCAGGGGCCTGGACTGG - Intergenic
900917096 1:5646662-5646684 AGTTTCTCAGGGGCCTGGAAGGG - Intergenic
901188463 1:7389721-7389743 GCCTTCACAGTGGTCTGGACAGG + Intronic
901301256 1:8201456-8201478 CATTTCTCAGAGGCCTGGGCAGG - Intergenic
904756744 1:32772210-32772232 GACTTCTTTGGGGCCTGGGGTGG - Exonic
912723819 1:112041900-112041922 GACTTCTCAGTAGCCTGGATAGG + Intergenic
914464154 1:147911126-147911148 GACATAGCAGGGACCTGGACAGG + Intergenic
915128973 1:153684081-153684103 GACATCATAGGGGCGTGGACTGG + Intronic
915290032 1:154877368-154877390 GACTGCTCTGGTGCCTGGCCTGG - Intergenic
915307293 1:154987962-154987984 GGCTGCTGAGGGGCCTGGACTGG - Intronic
915465570 1:156095910-156095932 GACTACTCAGGGGTATGGATTGG + Intronic
916026371 1:160837043-160837065 CACTTCACACGGGTCTGGACGGG - Intronic
916262859 1:162860054-162860076 GACTGCTCAGAGGTCTGGAGAGG + Intronic
917985840 1:180317884-180317906 TACTTATCTGGGGCCTGGAGCGG + Intronic
919749886 1:201030913-201030935 GGCTTCTCTGGGGCCTGGCTAGG - Intergenic
1063096424 10:2912975-2912997 GTGTTCTCAGGGTCCTGGAGCGG + Intergenic
1063174061 10:3535818-3535840 ACCTTCTCAGTGGCCTGGGCAGG + Intergenic
1063304570 10:4885507-4885529 CACTTCTCCAGGGCCTGGAGAGG + Intergenic
1063372371 10:5530212-5530234 AGGTTCTCAGGGGTCTGGACTGG + Intergenic
1063576365 10:7265489-7265511 GACATCTCAGGGGCCAGGCGCGG - Intronic
1064291987 10:14043658-14043680 GACTGCACAGCTGCCTGGACAGG + Intronic
1064464531 10:15566199-15566221 GACTTCCCATGGGACTGGTCTGG + Intronic
1070823304 10:79375740-79375762 GACGGCACAGGGGCCTGGCCTGG + Intergenic
1070828371 10:79404149-79404171 CACTTCTCTGGGTCCTGGAGGGG - Intronic
1071369410 10:84935852-84935874 GACTTCTCTGGTGTCTGTACTGG - Intergenic
1074217973 10:111406628-111406650 GACTTCATTGGGACCTGGACTGG + Intergenic
1076815477 10:132912734-132912756 GACTTCTCGGCAGCCTGGACTGG + Exonic
1077412591 11:2410565-2410587 GCCATCCCAGGGGCCTGCACAGG + Intronic
1078627814 11:12973767-12973789 GACTTCTAAGGGTCATGAACAGG - Intergenic
1078725275 11:13924517-13924539 GACCTAACAAGGGCCTGGACTGG - Intergenic
1080789987 11:35514012-35514034 GACTTCTTAGTGGCCTTGAAAGG + Intronic
1083423732 11:62571730-62571752 GAATTCTCCAGGACCTGGACTGG - Intronic
1083662665 11:64259022-64259044 GACGAGTCAGGGCCCTGGACCGG - Intronic
1083705423 11:64510918-64510940 GAGTTCTCAGGACCCTGGAGAGG + Intergenic
1084693715 11:70741610-70741632 GACATGTCAGGGGCCTGGGGAGG - Intronic
1085439521 11:76545932-76545954 GTCTTCTCAGAGGCCTGAATGGG - Exonic
1086225197 11:84499891-84499913 AACTTCTCAGGGGCATAGAATGG - Intronic
1088686249 11:112286742-112286764 GAGGTCTCAGGGGCCAGGACAGG + Intergenic
1089659410 11:119976194-119976216 GGCTTCTCAGGGGCTAGGCCGGG + Intergenic
1091644264 12:2261986-2262008 GCCTTCCCAAGGGACTGGACTGG - Intronic
1095375563 12:41524227-41524249 GACATCTCATGTTCCTGGACTGG + Intronic
1096557279 12:52411171-52411193 GACTTGGCTGGGGCCTGGGCAGG + Intergenic
1096593150 12:52675674-52675696 GATTTCTCAGGGGCATGTGCAGG - Intronic
1097837346 12:64286630-64286652 GATTTCTCATGAGACTGGACAGG - Intronic
1101830302 12:108251676-108251698 GACTTCTGCAGGGCCAGGACTGG - Intergenic
1102764830 12:115423402-115423424 GACTTCTGAGGGAGCTGAACTGG - Intergenic
1103341521 12:120223654-120223676 GAAATCTCAGGGACCTGGCCAGG - Intronic
1104058791 12:125250510-125250532 GACTGCGCAGGATCCTGGACTGG - Intronic
1104231456 12:126888574-126888596 GGCTTCTCAGGGTCCTGCACTGG - Intergenic
1104878566 12:132053535-132053557 GCCTTCGCTGGGGCCTGCACAGG - Exonic
1104972521 12:132538383-132538405 GTCTCTTCACGGGCCTGGACTGG + Intronic
1105202153 13:18190172-18190194 GGGTTCTCAGGGGCCTGGGATGG - Intergenic
1108456446 13:50619459-50619481 GCCTTCTCAGGCTCCAGGACTGG + Intronic
1108577588 13:51803284-51803306 ATCTGCACAGGGGCCTGGACTGG - Intronic
1109503294 13:63266868-63266890 GATTTATGAGGGGCCAGGACTGG - Intergenic
1112100302 13:96181537-96181559 GGCCTCTCAGGGCCCTGGCCTGG + Intronic
1112409944 13:99154346-99154368 TACTTATCAGGGGCCAGGAGTGG + Intergenic
1112594985 13:100799537-100799559 GACTACACAGGGGCCAGGAGTGG - Intergenic
1112951006 13:104996919-104996941 TCATTCTCAGGGGCCTGGAAGGG + Intergenic
1113693593 13:112329083-112329105 GACCTCACAGGGACCTGGCCGGG + Intergenic
1113864463 13:113512081-113512103 GGAGTCTCAGGGGCCGGGACTGG + Intronic
1113864513 13:113512302-113512324 GGAGTCTCAGGGGCCGGGACTGG + Intronic
1115983134 14:39076021-39076043 TGCTACTCAGGGGCCTGGAATGG - Exonic
1117886037 14:60364116-60364138 AAGTTCTCATGGGCCTGGAGTGG + Intergenic
1118370909 14:65136499-65136521 GACTCCTCAGGGTTCTGCACAGG + Intergenic
1120920288 14:89748914-89748936 CACCTGTCTGGGGCCTGGACTGG + Intergenic
1122048166 14:99038054-99038076 GTCTTCTCAAGGGCCTGCAAAGG + Intergenic
1122262352 14:100530701-100530723 GGCTCCTCAGGTGCCTGTACAGG + Intergenic
1122283260 14:100636681-100636703 GACTGCACAGGGCCCTGGCCAGG + Intergenic
1122296528 14:100709208-100709230 GGCCTCACGGGGGCCTGGACGGG + Intergenic
1122791873 14:104187457-104187479 GGCTGCTCAGGGGCCTGGGCAGG - Intergenic
1122882238 14:104695345-104695367 GCGTTCTCAGGGGTCTGGGCTGG - Intronic
1124654111 15:31494908-31494930 GAGTCCTCAGGAGCCTGGAGTGG + Intronic
1125716491 15:41822598-41822620 GACCTCTCTGGGACCTGCACTGG - Exonic
1126591688 15:50346659-50346681 GACTTCTCAGCCTCCTGGGCTGG - Intronic
1128215799 15:65933279-65933301 GACCTCTGAGGGCCTTGGACTGG + Intronic
1128995609 15:72292253-72292275 GTCTTCTCAGGCTCCTGAACAGG - Intronic
1129267933 15:74403980-74404002 GGGTTCTCAGGGGCCAGGATGGG + Intergenic
1129616584 15:77103790-77103812 GTCTGCTCAGGGGCCTTGAGAGG + Exonic
1132819131 16:1853618-1853640 AACTGCTCAGGGGCCTTGATGGG + Intronic
1136673458 16:31878180-31878202 GACCTCACAGAGGCCTGGGCTGG + Intronic
1137613551 16:49834638-49834660 GGCTTCCCAGGGGCCCGGGCAGG + Intronic
1139549381 16:67665052-67665074 GAGCTTTCAGGGGCCTGGGCTGG + Exonic
1141617281 16:85217152-85217174 GACTTCACAGGTGTCTGGGCGGG + Intergenic
1143027821 17:3951455-3951477 GACTCCTCTGGGGCCTGGGATGG + Intronic
1143090132 17:4445184-4445206 GGGGCCTCAGGGGCCTGGACAGG - Intronic
1143712754 17:8745312-8745334 TTCTTCTGAGGGGCCTGGCCTGG - Intergenic
1146380431 17:32323487-32323509 GAATCCCCAGGGGCCAGGACAGG - Exonic
1147131744 17:38413679-38413701 GACATCTCAGGGGCATCCACGGG + Intergenic
1147919240 17:43906287-43906309 GCCCTCTCAGAGGCTTGGACGGG - Intronic
1148460394 17:47836356-47836378 CACTTCTCCTGGACCTGGACGGG + Exonic
1148785258 17:50143198-50143220 GACTTCCCAGGGCCCAGCACCGG + Intronic
1151214443 17:72568066-72568088 GCCTGGTCAGGGGCCTGGGCAGG + Intergenic
1151425374 17:74027799-74027821 GACTTCCCAAAGGCCTGGGCAGG - Intergenic
1152626504 17:81390214-81390236 GACTTGTCAGGGGCCAGACCTGG - Intergenic
1158867494 18:61652026-61652048 TTCTTCTCCGGGGCCTTGACTGG - Intergenic
1161197461 19:2994891-2994913 GACATCTCAGGCACCTGGAGGGG - Exonic
1162479699 19:10921172-10921194 GACTGCCCAGGGGCCGGGAAGGG + Intronic
1163933462 19:20421085-20421107 GATATCACAGAGGCCTGGACTGG - Intergenic
1164525520 19:29010487-29010509 GACTTGGCAGGGGTCTGGAGTGG + Intergenic
1165781079 19:38434657-38434679 GGCTTTTCTGGGGCCTGGGCAGG + Intronic
1166857321 19:45789179-45789201 CACATCTCAGGGCCCTGGACAGG - Intronic
1167178491 19:47883114-47883136 GACTGCCCCGGGGCCAGGACTGG - Intronic
1167446931 19:49543288-49543310 GCCTCCTGCGGGGCCTGGACAGG - Exonic
1167741591 19:51327412-51327434 GACTTTTCAGGGAGCTGGCCAGG + Intronic
926062361 2:9812429-9812451 GACTTCTCTGGGGTCTGGTCTGG - Intergenic
928449381 2:31365053-31365075 AACTTCCCAGGGGCCTGGACAGG - Intronic
929127314 2:38533719-38533741 GAATTTTCAGGGTGCTGGACAGG - Intergenic
929511591 2:42569084-42569106 ACCTTCTCAGGGGGCTCGACGGG - Intronic
929865335 2:45712638-45712660 TACACCTCTGGGGCCTGGACAGG + Intronic
929920087 2:46165629-46165651 GCCTTCTCTGGGGACTGGAGGGG + Intronic
930054794 2:47243807-47243829 GGCTGCTCAAGTGCCTGGACCGG - Intergenic
931021145 2:58046628-58046650 GGCGTCTCCGGGGCGTGGACAGG + Intronic
932442613 2:71747248-71747270 GGCTTCCCCGGGGCCTGGCCTGG - Intergenic
934710664 2:96512049-96512071 GAGGTCTCAGGGTCCTGGAGAGG - Intergenic
937910742 2:127074374-127074396 GGCTTTTCAGGGGCCAGGGCTGG - Intronic
944676473 2:202036754-202036776 GGCCTCACAGGGGTCTGGACAGG - Exonic
947621630 2:231594516-231594538 GCCTTCCCAGGGGCCTAGGCTGG + Intergenic
948692772 2:239717360-239717382 AACTTCTCAGGTGCCTGGTGTGG - Intergenic
1172162826 20:32880165-32880187 GACTTCCCCGTGGCCTGGTCTGG - Intronic
1172773622 20:37395344-37395366 GCCTTCTCAGGAGCCTGGCCAGG - Intronic
1173223713 20:41149359-41149381 GACTTCTCAGAGGGCTGGATTGG + Intronic
1173365767 20:42383298-42383320 GGCTTCCCTGGTGCCTGGACTGG + Intronic
1173803223 20:45907951-45907973 GATTTCTCCTGGACCTGGACTGG - Intronic
1175173347 20:57094540-57094562 GACTACTCAAGGGCCTGGCCGGG - Intergenic
1175879634 20:62249873-62249895 GACTTCTCAGAGGCCTGGGTGGG - Intronic
1176169964 20:63692309-63692331 GGCTGCTGAGGGGCCTGGGCTGG + Intronic
1176628496 21:9115852-9115874 CCGTTCTCAGGGACCTGGACTGG + Intergenic
1176689327 21:9883962-9883984 GACTTCTCATGTGCCTGATCTGG + Intergenic
1178259495 21:31085814-31085836 GCCCTCTCTGGGGCCAGGACAGG + Intergenic
1181546805 22:23606873-23606895 GGCTTCTCAGGCCCCTGGCCAGG + Intergenic
1183363357 22:37394438-37394460 GGCCCCTCAGGGGCCTGGCCCGG + Intronic
1184875653 22:47273866-47273888 AACTTGTCAGGGGCCAGGCCTGG + Intergenic
1185247240 22:49779738-49779760 GGGTTCTCGGGGGCCAGGACGGG - Intronic
950045816 3:9947929-9947951 GACGTCGAGGGGGCCTGGACTGG + Exonic
953906057 3:46868749-46868771 GACTTCTCAGGGGCCTGGACTGG + Intronic
955013055 3:55038619-55038641 GACTTCTCAGGGTCTTTAACAGG - Intronic
956766988 3:72492271-72492293 AATTTCCCAGGGGCCTGGGCTGG + Intergenic
962056122 3:131873683-131873705 GACTTCTCAGGGGCAGGGACTGG - Intronic
968232098 3:197010243-197010265 ACCTTCTCAGGGGCCTGGGCTGG - Intronic
969056307 4:4404978-4405000 GACTTCACAGGGGTCAGGACTGG - Intronic
975458587 4:74623525-74623547 GACTGCGTAGGGGACTGGACAGG + Intergenic
978132103 4:105211470-105211492 GTCACCTCAGGGGGCTGGACTGG - Intronic
980352718 4:131701773-131701795 GACTTCTCATGTGCCTGATCTGG + Intergenic
981403084 4:144337338-144337360 GGCTTCAAAGGGGTCTGGACAGG - Intergenic
984325097 4:178241634-178241656 GCACTCTCAGGGGCCTGGAAAGG + Intergenic
986004389 5:3656119-3656141 GACAGAGCAGGGGCCTGGACAGG + Intergenic
986156759 5:5184083-5184105 CACTTTTCCGGGGCCTGGGCTGG - Intronic
987323091 5:16788238-16788260 GATTGCTGAGGGGCCTGGCCAGG + Intronic
988996300 5:36718021-36718043 GGCTTCTCAGACGCCTGGCCTGG + Intergenic
989786674 5:45340547-45340569 GGATTCTCAGGGGCCTGGAGAGG - Intronic
990093933 5:52088402-52088424 GATTTCGCAGCGGCCTGTACTGG - Intergenic
990450154 5:55925966-55925988 GACTTCTCAGGGGCTGGGTCCGG + Intergenic
990536732 5:56730639-56730661 AACTTCTCGGGGGCCAGGCCTGG + Intergenic
993401899 5:87463814-87463836 GACTTCTCAGGCTCATGGATTGG - Intergenic
993477191 5:88380315-88380337 GACTTCTCTGGGGCCAAGTCTGG + Intergenic
997584472 5:135036037-135036059 CACTTCTCAGGGGTTTGGATTGG + Intronic
1001089592 5:168727507-168727529 GAAGTCTCATGGGCCTGGAGAGG + Intronic
1002566664 5:180116027-180116049 GGCTCCTCTGGGGCCTGGTCTGG + Intronic
1004471557 6:15933966-15933988 AACTCCTCAGGGGACAGGACTGG + Intergenic
1006513925 6:34535739-34535761 AATTTCTCAGGGGCATGGGCAGG + Intergenic
1007619736 6:43204636-43204658 TAGGTCTCAGGGGCCTGGAAAGG - Intronic
1009683836 6:66930536-66930558 CACTTCTCAAGGGCTTGGACTGG + Intergenic
1011257805 6:85441826-85441848 GACTTTTAAGGGACCTGGACAGG + Intergenic
1011282019 6:85687056-85687078 GACTTCTCTGTGCCCTGAACAGG + Intergenic
1012155518 6:95814841-95814863 GACTTCTCCAGGTCCTTGACAGG + Intergenic
1014253766 6:119141297-119141319 AACTTCTCAGAGGCTTGGACAGG - Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1019510041 7:1413152-1413174 GACTTCGCAGGGTCTTGGAGGGG + Intergenic
1019619042 7:1980604-1980626 GTGGTCTCAGGGGCCTGGGCTGG - Intronic
1019981667 7:4626140-4626162 GACATTTCAGGGAGCTGGACTGG + Intergenic
1020084144 7:5301631-5301653 CCATTCTCAAGGGCCTGGACTGG - Intronic
1020997034 7:15278421-15278443 GAGTCCTCAAGGGACTGGACTGG + Intronic
1021763906 7:23928027-23928049 TACATCTCAGGGACCTGGATGGG - Intergenic
1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG + Intronic
1023925909 7:44669530-44669552 CACCTCTCAGGGGCCTGTTCAGG + Intronic
1025778928 7:64582382-64582404 GATATCTCAGAGGCCTGGCCTGG + Intergenic
1025824802 7:65001716-65001738 GACATCTCAGAGGCCTGGCCTGG - Intronic
1028475018 7:91244021-91244043 GACTTTTCAGGGTCATGGAAAGG + Intergenic
1029501073 7:100930205-100930227 GAATTCTCAGAGGCCAGGAGTGG - Intergenic
1032303957 7:130715163-130715185 CACTTCTCAAGGGCCAGTACTGG - Intergenic
1032450114 7:132023474-132023496 GAGTTCTCAGGGCACTGGACAGG - Intergenic
1033864487 7:145672255-145672277 GACTGCTCAGGGGCCAGAATAGG + Intergenic
1034386209 7:150743305-150743327 CACTTCTCAGGGACCTGCATGGG - Exonic
1034432155 7:151046436-151046458 GGCTTCTGAGGGGCCTGGAAAGG + Intronic
1036474626 8:9081889-9081911 GACTTCTCATTAGCCTGCACTGG + Intronic
1038011418 8:23479535-23479557 GACTCCTCTGGGGCCAGGACAGG + Intergenic
1040960489 8:53027140-53027162 GGCTTCCCAGGGGTCTGGAAAGG + Intergenic
1040979442 8:53230747-53230769 GACTTCTCAGGGGCAGGGGTTGG - Intronic
1043604027 8:81977451-81977473 GACTTCTCAGGCTCCAGAACTGG + Intergenic
1047078995 8:121438377-121438399 GTCTTCTTATGGGCCTGGCCTGG - Intergenic
1047255147 8:123208450-123208472 GAGTTGTCAGGGGCCAGGACTGG + Exonic
1048203967 8:132400924-132400946 ATCATGTCAGGGGCCTGGACAGG - Intronic
1049599799 8:143502173-143502195 GACTTCTCACAGTCCTGGGCCGG - Intronic
1049710291 8:144060294-144060316 CGCTTCTCCGGGCCCTGGACTGG + Intronic
1052459119 9:28740968-28740990 GACTTGGCAGGGGCATGGCCAGG + Intergenic
1053302182 9:36960141-36960163 GACTCCTCCTGGGCCCGGACAGG + Intronic
1053351661 9:37417337-37417359 GTACTCTCAGGAGCCTGGACAGG + Intergenic
1053779997 9:41597938-41597960 GACTTCTCATGTGCCTGATCTGG - Intergenic
1054167954 9:61808181-61808203 GACTTCTCATGTGCCTGATCTGG - Intergenic
1054669592 9:67772723-67772745 GACTTCTCATGTGCCTGATCTGG + Intergenic
1056818693 9:89821165-89821187 TGCTTCTGAGGGGCCTGGGCAGG - Intergenic
1058398758 9:104588844-104588866 CACTACTCAGGTGCCTGAACTGG + Intergenic
1058807887 9:108610013-108610035 GTCTTCTCTGGGTCCTGCACTGG - Intergenic
1059823938 9:118005775-118005797 GACTTCTCAGTGAGCAGGACTGG + Intergenic
1060929528 9:127480018-127480040 GGCTCCTCAGGGGACTGCACGGG - Intronic
1061619384 9:131801716-131801738 GACCTCTCTGGGGACTGGAGGGG - Intergenic
1061921365 9:133784252-133784274 GCTCTCTCAGGGGCCTGGGCTGG + Intronic
1203751342 Un_GL000218v1:83531-83553 CCGTTCTCAGGGACCTGGACTGG + Intergenic
1186276267 X:7941399-7941421 ACTTTCCCAGGGGCCTGGACAGG + Intergenic
1188110539 X:26192624-26192646 GACTCCTCAGGGACCAGGTCGGG - Intronic
1190594080 X:52035551-52035573 GCCTTCACATGGGCCTGGAATGG + Intergenic
1192784917 X:74326008-74326030 GCCTGCTCAGGGGCCGGGGCGGG - Intergenic
1196491098 X:116267921-116267943 GACTACTCTGGCGCCTTGACAGG - Intergenic
1196768117 X:119268093-119268115 GAGATCACAGTGGCCTGGACTGG - Intergenic
1198363977 X:135922706-135922728 GTCTTCTCAGGGCCCAGGTCTGG + Intergenic
1199633897 X:149796674-149796696 GTCTCATCAGGGGACTGGACAGG + Intergenic
1201164999 Y:11201144-11201166 CCGTTCTCAGGGACCTGGACTGG + Intergenic