ID: 953906915

View in Genome Browser
Species Human (GRCh38)
Location 3:46872994-46873016
Sequence GAGAAGCCTCCATCTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953906915_953906921 17 Left 953906915 3:46872994-46873016 CCCCCAAGAGATGGAGGCTTCTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 953906921 3:46873034-46873056 AACCTAGCCCCTGTCCTCAAGGG 0: 1
1: 0
2: 2
3: 23
4: 215
953906915_953906920 16 Left 953906915 3:46872994-46873016 CCCCCAAGAGATGGAGGCTTCTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 953906920 3:46873033-46873055 TAACCTAGCCCCTGTCCTCAAGG 0: 1
1: 0
2: 2
3: 36
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953906915 Original CRISPR GAGAAGCCTCCATCTCTTGG GGG (reversed) Intronic
901299187 1:8186636-8186658 GAGAAGTCTTCATGTCTTGTAGG + Intergenic
902548550 1:17205695-17205717 GCCAAGCCCCCATCTCTTTGAGG + Intronic
906653099 1:47527356-47527378 AAATAGCCTCCATCTCTTGATGG + Intergenic
907887306 1:58605473-58605495 CAGAAAGCTCCATCCCTTGGGGG - Intergenic
913157741 1:116116360-116116382 CAGAAGCCTCTTTCTCTAGGTGG - Intronic
916030828 1:160876227-160876249 GAAAAGCGTCCATTTTTTGGGGG - Intergenic
916778653 1:167998072-167998094 GAGAAGCCTGTATATCTGGGAGG - Intronic
916819100 1:168380836-168380858 AAGAAGCTTCCATTTCTTGAGGG + Intergenic
917151891 1:171954740-171954762 AAAAATCCTCCATCTCCTGGTGG - Intronic
1062977544 10:1696657-1696679 GAGAAGCATTCATCTCTCAGCGG - Intronic
1065105250 10:22377204-22377226 GGGAAGCCTCCATTCCTTGCTGG - Intronic
1065839175 10:29686580-29686602 GAGAATCCACCATCTCTTCATGG + Intronic
1065862156 10:29881046-29881068 AAGAAGCCTACATCTCTTAGTGG + Intergenic
1078289849 11:9997920-9997942 GAGAAGCCAACATCTAATGGGGG + Intronic
1080009212 11:27440651-27440673 GAGAAGCCTCCGGGTCTTTGTGG - Intronic
1080774912 11:35376907-35376929 GAAAAGCCTGGATCACTTGGAGG + Intronic
1081280163 11:41199857-41199879 GAAAAGTCTCCATCACTTAGGGG - Intronic
1085404783 11:76255309-76255331 GGCCAGCCTCAATCTCTTGGGGG + Intergenic
1086844224 11:91728698-91728720 AGGAAGCTTCCATCTCTTGATGG + Intergenic
1088093962 11:106077163-106077185 GAGAGGTTTCCATCTCTAGGAGG - Intronic
1091761530 12:3090641-3090663 GGGCAGACTCCACCTCTTGGTGG + Intronic
1094785636 12:33845804-33845826 GAGAAGCCTCACAATCTTGGTGG + Intergenic
1096610005 12:52795038-52795060 GAAAAGCCTCCCATTCTTGGTGG + Intronic
1097406258 12:59194366-59194388 GAGAAGCCTCAGAATCTTGGTGG + Intergenic
1097686068 12:62691951-62691973 GAGAAGCCGCCATTTCAGGGAGG - Intronic
1098102267 12:67030399-67030421 GAGAAGCACCCATCTCTCTGCGG + Intergenic
1099140842 12:78973429-78973451 GAGAAGCCTCCATAGAATGGCGG - Intronic
1100159221 12:91838196-91838218 CAGAAGACTCAATCTCTGGGTGG + Intergenic
1101964734 12:109274704-109274726 GAGATGCTTCCACCTGTTGGGGG + Intergenic
1101988057 12:109462653-109462675 GAAGAGCCTGCCTCTCTTGGGGG - Intronic
1102036437 12:109772990-109773012 GAGAAGCCACCATCTCATCCAGG + Intergenic
1102148173 12:110670229-110670251 CAGAAGCCGCCATCTGTGGGAGG + Intronic
1106546925 13:30738817-30738839 GAGGAGGCTGCCTCTCTTGGGGG - Intronic
1109306966 13:60651593-60651615 GAGAAGCCTGGGTCTCTTTGAGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1117525036 14:56592470-56592492 GCTAAGCCTCCTTCTTTTGGTGG - Intronic
1122314997 14:100820736-100820758 CAGAAGCCACCAGCTCCTGGGGG - Intergenic
1122834024 14:104422293-104422315 GAGAAACCTCCAGCGCTTTGGGG + Intergenic
1122953686 14:105060238-105060260 GAGAGCCCTGCATCTCTTGCTGG - Intronic
1127550199 15:60029992-60030014 GAGAAGACTTCATATCTAGGAGG - Intronic
1128234884 15:66060493-66060515 GAGAAGGCTACATCCCTCGGAGG - Intronic
1128287974 15:66454241-66454263 GTGAAGTCTCCATCTCTTGTTGG + Intronic
1133068214 16:3225821-3225843 GATCAGCCCCCATGTCTTGGTGG - Intronic
1133837506 16:9379862-9379884 GACAAGCCTCCCTCTCTCTGTGG - Intergenic
1134052749 16:11148364-11148386 TAGAAACCTCCACCTCCTGGTGG + Intronic
1135058952 16:19254692-19254714 GAGAAGCTGGCATCGCTTGGGGG - Intronic
1135973744 16:27091304-27091326 GTGAAGACTCCATTTCTTTGTGG - Intergenic
1136055009 16:27681816-27681838 GAGAAGTCACCCTCACTTGGGGG + Intronic
1137492434 16:48944257-48944279 GATCAGCCTCCATCTCTCTGAGG - Intergenic
1138618087 16:58188085-58188107 GAGAAACCTTCATCTTTTGTTGG + Intronic
1140353871 16:74287887-74287909 GAGAAGTTTCCATCTCTTAGTGG + Intergenic
1140470979 16:75214232-75214254 GAGGAGCCCCCATCTCCCGGGGG - Intergenic
1141186691 16:81792638-81792660 GAGAAGCCTTCTTCACATGGTGG + Intronic
1142184451 16:88687842-88687864 CAGCAGCCTCCACCTCCTGGAGG - Intergenic
1143993076 17:10983565-10983587 GAGAGGCTGCCAGCTCTTGGAGG + Intergenic
1144110578 17:12027711-12027733 GGGAAGCATCCATCTTTTTGGGG + Intronic
1146557790 17:33841684-33841706 CTGATGCCTCCCTCTCTTGGGGG - Intronic
1149197137 17:54134547-54134569 AAGAAGCCCCCATCTGTAGGAGG - Intergenic
1149451330 17:56752151-56752173 GAGAGGCCACCAGCTCTTGCTGG + Intergenic
1157271740 18:46281639-46281661 TACAAGTCTCCATCTATTGGTGG - Intergenic
1157520041 18:48339198-48339220 GCACAGCCCCCATCTCTTGGGGG + Intronic
1157889363 18:51400302-51400324 AAGTAGCCTCCAACTCTTGGTGG + Intergenic
1158088653 18:53683894-53683916 TAGAACCCTCAAGCTCTTGGAGG + Intergenic
1158848070 18:61465797-61465819 GAGCAGATTCCATATCTTGGTGG - Intronic
1160820618 19:1056058-1056080 GAGAAGCCTCCGTATCTGTGGGG - Exonic
1160928861 19:1560337-1560359 GCGGAGCCTCCATCTGTGGGTGG - Intronic
1162520790 19:11178355-11178377 GAGGAGCCTCCAGTTCGTGGGGG - Exonic
1165205953 19:34186388-34186410 GAGTAGCCTCCATCTGTGGGTGG + Intronic
1167729595 19:51244029-51244051 GCCAAGCCCCCAGCTCTTGGGGG + Intergenic
927042639 2:19245274-19245296 AAGTAGCCTTCATCTCTTGGTGG - Intergenic
929191704 2:39146366-39146388 CAAAGGCCTCCATCTCTTGTAGG + Intergenic
931432006 2:62215781-62215803 TAGCAGCCTCCATCTCTAGAGGG - Intronic
931684908 2:64784692-64784714 CTGTAGCCTCCCTCTCTTGGTGG - Intergenic
933166627 2:79083660-79083682 GGAAAGACTCCATCTTTTGGGGG - Intergenic
934050985 2:88210661-88210683 GAGAACCCTTGAGCTCTTGGAGG - Intergenic
942165456 2:173236477-173236499 GAGTAGCCTGCATCTGTTGGGGG + Intronic
943270878 2:185801933-185801955 CAGAATCCACCATCTTTTGGAGG - Exonic
944811027 2:203328082-203328104 GAGAAGCCCCCACCTCCCGGCGG - Intergenic
946348768 2:219133748-219133770 GAAAAGGCTGCATCTCCTGGGGG + Intronic
948292004 2:236832486-236832508 GAGAAGCCTACTCCTCATGGTGG + Intergenic
1169935336 20:10877593-10877615 GAGTTGCCTCCCTCTCTTTGAGG - Intergenic
1175407613 20:58745171-58745193 GAGTAGGCTCCATCTCTTCTTGG + Intergenic
1175877258 20:62236330-62236352 GAGAATCCTCCCTCAGTTGGTGG - Intronic
1178177244 21:30117184-30117206 GGGAAGCCTCCATCTCCTAATGG - Intergenic
1179727355 21:43347933-43347955 GAGAAACACCCGTCTCTTGGAGG + Intergenic
1181544976 22:23597632-23597654 GAAAAGGCTGCATCTCTGGGAGG + Intergenic
1181815335 22:25432250-25432272 GAAAAGGCTGCATCTCTGGGAGG - Intergenic
1181999919 22:26911754-26911776 GAGGATCCACCATCTCTTGGAGG + Intergenic
1182496183 22:30709428-30709450 GAGAAGCCACCAACTCCTGATGG - Intronic
1184039035 22:41932691-41932713 GCAAAGCCCCCACCTCTTGGGGG + Intergenic
949228948 3:1727702-1727724 CATAAGACTCCATCTCTGGGTGG - Intergenic
950893391 3:16425680-16425702 GTAAAGCCACCTTCTCTTGGGGG - Intronic
952451666 3:33439692-33439714 GAGAAGCCTCTGTCTCCTTGGGG - Intronic
953906915 3:46872994-46873016 GAGAAGCCTCCATCTCTTGGGGG - Intronic
954517115 3:51188179-51188201 GAGATGCCCTCATATCTTGGAGG + Intronic
956512927 3:70014302-70014324 TAGACGCCTCCATGTCTTGGGGG - Intergenic
957315247 3:78568387-78568409 GAGAAGCCTAGATTTCTTGTTGG + Intergenic
959496219 3:107055507-107055529 TAGTAGCCCTCATCTCTTGGGGG + Intergenic
960260295 3:115560250-115560272 TGGAAGCCTGCATCTTTTGGGGG + Intergenic
960890755 3:122444996-122445018 GAGAAGCTGCGATCTTTTGGAGG - Intronic
961294349 3:125872485-125872507 AAGAAGCCTCCAAATCATGGTGG - Intergenic
961432614 3:126893845-126893867 GAGAAGCAGCCAGCTCCTGGGGG + Intronic
961864854 3:129946130-129946152 GAAAAGGCTCCATCTTCTGGGGG - Intergenic
964633951 3:158841151-158841173 CAGAGGCCTCCATATCTTGTAGG + Intergenic
966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG + Exonic
967417143 3:189231845-189231867 CAGAAGCCTCCATATATTGAGGG - Intronic
972973655 4:44607381-44607403 GAGAACCCTCTGTCTCCTGGAGG - Intergenic
975779274 4:77821191-77821213 AAAATGCCTTCATCTCTTGGGGG + Intergenic
976612694 4:87046229-87046251 GAAATGCCTCTTTCTCTTGGTGG - Exonic
977644019 4:99390994-99391016 GTGAAGGCTACATCCCTTGGAGG + Intergenic
979392040 4:120139116-120139138 GAGAAGCCTCACAATCTTGGTGG + Intergenic
979808523 4:125005408-125005430 GAGAAGCCAACATGTCTTGATGG - Intergenic
979917459 4:126453969-126453991 GAGAAGGGTCCATGTCTTGAAGG - Intergenic
981776231 4:148370862-148370884 GAGAAACTTCCATCTCTTATTGG - Intronic
981804420 4:148697738-148697760 AATAAGACTCCATCTCTTGGTGG - Intergenic
985198308 4:187456982-187457004 GAGAGGCCTCCATCTCTTCTGGG - Intergenic
986329737 5:6708833-6708855 AAGAAGCCTCCACCTCTTGATGG - Intergenic
987863339 5:23511143-23511165 GAGAAGACTCCGTCTCAGGGCGG + Intronic
988496850 5:31752592-31752614 AAGGAGACTCCATCTCTGGGGGG - Intronic
991665012 5:68990815-68990837 TAGAATACTCCATCTTTTGGAGG - Intergenic
991942411 5:71865344-71865366 TAGAGGCATCCATCTCCTGGAGG + Intergenic
992449126 5:76859799-76859821 GAGAAGCCTTCATCACAGGGAGG + Intronic
993583871 5:89699116-89699138 CTGAAGCCCCCATTTCTTGGGGG - Intergenic
993850823 5:93006388-93006410 TAGAATCCTCCTTTTCTTGGAGG + Intergenic
997947240 5:138213534-138213556 GAGAAGCCACGACCTCTGGGCGG + Intergenic
998622643 5:143811941-143811963 GAGCAGCCTCCTGCTATTGGAGG - Intergenic
1000971967 5:167724673-167724695 GAGAAGACTTCATTTCTTTGTGG + Intronic
1001561502 5:172672289-172672311 CAGAAACCTGCATCTCCTGGAGG - Intronic
1001797969 5:174518147-174518169 GAGAAACCACCATCTCTTTGCGG - Intergenic
1002705348 5:181157497-181157519 GAGGAGGCTCCTTCCCTTGGGGG + Intergenic
1004638780 6:17494075-17494097 GAGCTGCCTTCATCTCTTGTCGG + Intronic
1005509261 6:26497725-26497747 GGAAAGCCTACTTCTCTTGGAGG + Intergenic
1007451693 6:41944975-41944997 GAGGAGCCTCTATTTCTTTGAGG - Intronic
1009957380 6:70471968-70471990 GGGAAGCCTTCATTTCTTGAAGG - Intronic
1012257264 6:97048348-97048370 TAGAAGAACCCATCTCTTGGGGG + Intronic
1014725781 6:124970209-124970231 GAGATTACTCCATCTCTTTGTGG + Intronic
1017274865 6:152554356-152554378 GAGGAGGCAGCATCTCTTGGTGG - Intronic
1017590104 6:155969338-155969360 GACAAGCATCCATCTCTTATAGG - Intergenic
1019949550 7:4360410-4360432 GGGTAGGCTCCGTCTCTTGGTGG + Intergenic
1020008840 7:4797435-4797457 GATAAGCCCCCTTCTCTTTGTGG + Intronic
1026976626 7:74502684-74502706 GGCAGGCCTCCAGCTCTTGGCGG + Intronic
1028777831 7:94700667-94700689 GAGTTGCTTCCACCTCTTGGTGG - Intergenic
1028931350 7:96415887-96415909 GAGAAGTCTCCCTCTCTATGAGG + Intergenic
1031983210 7:128143559-128143581 AATTAGCCTCCATCTTTTGGAGG + Intergenic
1036725781 8:11219346-11219368 CAGAATGCTCCTTCTCTTGGGGG - Intergenic
1036788005 8:11700736-11700758 GAGGCGCGTCCATATCTTGGAGG + Intronic
1039223604 8:35363228-35363250 GGGAAGCCTCCAAATCATGGTGG + Intronic
1039947998 8:42146485-42146507 CAGCAGCCTCCCTCTCCTGGTGG - Intergenic
1040610991 8:48982136-48982158 CTGCAGCCTCCATCTCTTGATGG + Intergenic
1044888674 8:96808443-96808465 CAGAAGCCTCCATCTTTGAGAGG - Intronic
1044970648 8:97616362-97616384 GAGAAGTTTACTTCTCTTGGGGG - Intergenic
1046996446 8:120529442-120529464 GAACAGATTCCATCTCTTGGTGG - Intronic
1047141137 8:122141138-122141160 GGGCAGCCTGCATCTCATGGTGG - Intergenic
1047540379 8:125759483-125759505 GAGACGACGCCATCTCTGGGAGG + Intergenic
1049965275 9:773840-773862 GACAAGCCTCCACCTATTTGAGG + Intergenic
1050726361 9:8653708-8653730 CAAAAGCATCGATCTCTTGGAGG - Intronic
1053567386 9:39267630-39267652 GAGGAGCCTCCATCTCCTGTAGG - Intronic
1053833111 9:42105363-42105385 GAGGAGCCTCCATCTCCTGTAGG - Intronic
1054129757 9:61351368-61351390 GAGGAGCCTCCATCTCCTGTAGG + Intergenic
1054597441 9:67082046-67082068 GAGGAGCCTCCATCTCCTGTAGG + Intergenic
1058704074 9:107624431-107624453 CAGGGGCCTCCAGCTCTTGGGGG + Intergenic
1060133840 9:121132681-121132703 GAGAAGCTGCCATCCTTTGGAGG + Intronic
1186141322 X:6577539-6577561 GAGAAGCCACAAACTCTTGCAGG + Intergenic
1188847069 X:35085731-35085753 GAGGAGCCTCCATCTGGTGAGGG + Intergenic
1190397958 X:50003726-50003748 GAGAAGTCTCCCTCTCCTGCAGG - Intronic
1191780385 X:64857966-64857988 GTGAAACCTCCCTCTGTTGGTGG - Intergenic
1194526526 X:94983872-94983894 CAGAAGCCTCCATGGGTTGGTGG + Intergenic
1194939925 X:99997393-99997415 AAGGGGCCTCCATCTCTTGACGG + Intergenic
1198636712 X:138710349-138710371 CAGAAGCCCACATCCCTTGGAGG + Intronic