ID: 953907858

View in Genome Browser
Species Human (GRCh38)
Location 3:46877304-46877326
Sequence CAGAGAAATCAGAGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953907858_953907869 12 Left 953907858 3:46877304-46877326 CCAGCCCCCCTCTGATTTCTCTG 0: 1
1: 0
2: 4
3: 41
4: 394
Right 953907869 3:46877339-46877361 TTGAGTGAAGTCACTAGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 101
953907858_953907868 11 Left 953907858 3:46877304-46877326 CCAGCCCCCCTCTGATTTCTCTG 0: 1
1: 0
2: 4
3: 41
4: 394
Right 953907868 3:46877338-46877360 CTTGAGTGAAGTCACTAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
953907858_953907867 10 Left 953907858 3:46877304-46877326 CCAGCCCCCCTCTGATTTCTCTG 0: 1
1: 0
2: 4
3: 41
4: 394
Right 953907867 3:46877337-46877359 ACTTGAGTGAAGTCACTAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953907858 Original CRISPR CAGAGAAATCAGAGGGGGGC TGG (reversed) Intronic
901917051 1:12507945-12507967 TAGAGAGAGCAGAGGTGGGCAGG - Intronic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902210805 1:14903162-14903184 CACAGAAATAAGAGGCGGCCAGG - Intronic
902350445 1:15849602-15849624 CTGAGAAACCAGGCGGGGGCGGG + Intronic
902786239 1:18734408-18734430 CAGTGAGTTCAGAGGAGGGCAGG - Intronic
903238105 1:21963821-21963843 CCCAGAGATCAGAGGGGAGCTGG - Intergenic
903718153 1:25384698-25384720 CAGAGAAATCATGGAGGCGCTGG - Intronic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
903953598 1:27010682-27010704 CAGAGACTTCAGAGCTGGGCTGG - Intronic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
905294523 1:36945966-36945988 CAGAGATTTCCGAGGGGGCCAGG - Intronic
906091732 1:43185344-43185366 CAGAGAAATCAGGGTAAGGCGGG + Exonic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
908814190 1:68014621-68014643 GGGAGAAATCACAGGGTGGCAGG + Intergenic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
910582405 1:88843264-88843286 CAAAGAAATAAGAGTGGAGCAGG - Intergenic
910716356 1:90235766-90235788 AAGTGAAATCAGAGGTGGCCTGG - Intergenic
911154855 1:94627411-94627433 AAGAGAAGTCAGAGTGGTGCAGG - Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914808510 1:151009048-151009070 CGGAGAACTCAAAGAGGGGCGGG - Intronic
915294309 1:154909389-154909411 CAGAGAGCTCAGAGGGTTGCAGG + Intergenic
915765450 1:158357570-158357592 CAGAGATATCAGAGAGGGAATGG - Intergenic
921262967 1:213400057-213400079 CATAGAAAAAAGAGGTGGGCGGG + Intergenic
921681503 1:218038107-218038129 CAAAGAAATCAGCTGGGGGCGGG - Intergenic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
922619397 1:226980851-226980873 CTGAGAAACCAGGGTGGGGCGGG - Intronic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923784665 1:237055400-237055422 TAGAGAGATCAGAGCGGGACCGG + Intronic
923866684 1:237947199-237947221 CAGAGGATTCAGAGGGGACCAGG + Intergenic
924514771 1:244756678-244756700 AAGAGAATTCAGAGGGGAGGAGG + Intergenic
1063201842 10:3791470-3791492 CAGAGAAATCCAATGGGGACAGG + Intergenic
1063639163 10:7813872-7813894 GAGAGCAATCAGAGGGGTGTGGG + Intergenic
1065328581 10:24571107-24571129 CAGAAAGAGCTGAGGGGGGCTGG + Intergenic
1065963578 10:30753360-30753382 AGGAGAAATCAGAGCGGGCCTGG + Intergenic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1070508864 10:77141266-77141288 CAGAGAACTAAGAGGGGGCTGGG - Intronic
1070641161 10:78171094-78171116 TAGAGGTATCAGAGGAGGGCAGG + Intergenic
1070756065 10:78993999-78994021 CACAGAAATCAAAGGGGGTTGGG - Intergenic
1070799557 10:79237191-79237213 CAGAGTAAGCCGAGGGGGACTGG + Intronic
1070803233 10:79255559-79255581 CAGAGAAATAAGAGGGGAGCGGG - Intronic
1070824989 10:79385759-79385781 CAGTGATGTCAGAGGGGGTCTGG + Exonic
1072418702 10:95271138-95271160 CGTGAAAATCAGAGGGGGGCTGG + Intronic
1072424367 10:95317165-95317187 CAGAAAAATCAGGGAAGGGCTGG + Intronic
1072624381 10:97101637-97101659 CACAGCTATCAGAGGAGGGCAGG - Intronic
1072814120 10:98488135-98488157 CATAGAAATTAGAGGAGAGCTGG + Intronic
1073183830 10:101603195-101603217 CAGAGAGACCTGAGGAGGGCAGG - Intronic
1073679128 10:105683043-105683065 CAGAAAGGTCAGAGGGGGCCAGG + Intergenic
1074258361 10:111826787-111826809 CAGAGATTTCAAAGGGAGGCAGG - Intergenic
1075182136 10:120220835-120220857 CAGAGAGACCAGAGGTGTGCTGG - Intergenic
1075407781 10:122206072-122206094 CAGTGAACTCACTGGGGGGCGGG + Intronic
1075443193 10:122495206-122495228 CACAGAAACAAGAGGGGAGCTGG - Intronic
1076092066 10:127694865-127694887 CAGAGAAAGCAGAGTGGGTATGG + Intergenic
1076339123 10:129730698-129730720 AAAAAAAATCAGAGGAGGGCAGG - Intronic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1076635994 10:131882313-131882335 CTGAAAAGTCAGTGGGGGGCTGG + Intergenic
1076727947 10:132422022-132422044 CTGAGAGATGAGAGGGCGGCGGG + Intergenic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079010219 11:16822036-16822058 CAGGGAAATGAGAGGTGGGTGGG - Intronic
1080662887 11:34311842-34311864 CAGAGAAAGCCAATGGGGGCCGG + Intronic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1083941771 11:65899949-65899971 CGCAGAAGTCAGAGGTGGGCAGG + Intronic
1084155655 11:67311271-67311293 CAGAGAAAGCATAGGAGGGGAGG + Intronic
1084302657 11:68261635-68261657 CTCAGAAATGTGAGGGGGGCGGG - Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084366746 11:68706424-68706446 CAGGGAACTCAGTGTGGGGCTGG - Intergenic
1084517180 11:69643330-69643352 CAGATATGTCAGAGGCGGGCCGG - Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086116446 11:83256546-83256568 AAGAGAAAAGAGAGGGGGGTAGG - Intronic
1088901204 11:114118967-114118989 CAAAGAATTTAGAGGGGGCCAGG + Intronic
1089965666 11:122653166-122653188 CAAAGAGAGAAGAGGGGGGCTGG - Intergenic
1089974132 11:122717757-122717779 CTGAGAAGTCACAGGGGGCCCGG + Intronic
1090458009 11:126866480-126866502 CAGTGAAATAGGAGGGGGGCCGG + Intronic
1090462697 11:126906122-126906144 GAGGGAATTCAGAGAGGGGCAGG - Intronic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1092827339 12:12413494-12413516 CTGAGAAATCAGATGGTTGCCGG - Intronic
1093528526 12:20133866-20133888 CAGAAAGAACAGAGAGGGGCAGG + Intergenic
1093746141 12:22742791-22742813 CACAGGCATCAGTGGGGGGCAGG - Intergenic
1093763352 12:22935297-22935319 CAGAGAAAAGAAAGGGGCGCTGG - Intergenic
1094492878 12:30972197-30972219 CACAGAAACCAGAGTGGAGCTGG + Intronic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097149418 12:56965437-56965459 CAGAGTAATTAGAGGTTGGCAGG - Intergenic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1101609776 12:106279813-106279835 CAGAGAAATTCTAGGGGGACAGG - Intronic
1101864248 12:108508330-108508352 CAGAGAAATCAGAGAAGGGGAGG + Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102164351 12:110794812-110794834 CAGAGAACACATAGGTGGGCTGG + Intergenic
1103514511 12:121498624-121498646 CAAAGAAAACAAAGGGGGGTGGG - Intronic
1103994583 12:124820777-124820799 CACAGAAAACAGTGGGGGGCAGG + Intronic
1104169301 12:126264697-126264719 CAGAGAAATGAGATGAGGACTGG - Intergenic
1104214561 12:126723422-126723444 CAGGGAACTCACATGGGGGCTGG + Intergenic
1104393884 12:128415171-128415193 CCGAGAAACCAGAGAGGTGCGGG + Exonic
1104787181 12:131457236-131457258 CTGAGAAGTCAGATGGGGGCTGG - Intergenic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1104990781 12:132622717-132622739 GAGAGAAATAGGAGGGAGGCCGG + Intergenic
1106367834 13:29100562-29100584 CAGAGAACTCAGAGAGGAGGTGG - Intronic
1106546192 13:30732858-30732880 GAGAGAAAAAAGAGGGGGCCGGG + Intronic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1107602370 13:42026701-42026723 TAGAGAAATCAAAGTGGGCCGGG - Intergenic
1107609503 13:42099014-42099036 GAGAGAAATCAGTGTGGGCCAGG + Intronic
1107708848 13:43133024-43133046 CAGAGAGATCACAGGATGGCTGG - Intergenic
1108807385 13:54175895-54175917 GAGAGAAAAGGGAGGGGGGCGGG + Intergenic
1110319781 13:74148346-74148368 CAGAGAAATGGGATGGGAGCTGG - Intergenic
1113227292 13:108173253-108173275 CAAAGAAATCAGAGAAGGGTTGG + Intergenic
1113570919 13:111356929-111356951 CAGAGAAAGCTGAGGGGGCTAGG - Intergenic
1113641553 13:111961249-111961271 CAGAGAGACCAGTGGGGTGCAGG - Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118478777 14:66143367-66143389 CAAAGAAAACAGAGAGGGGATGG + Intergenic
1118482323 14:66179718-66179740 GAGGGAAATTAGAGGGGTGCTGG - Intergenic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1119102064 14:71889113-71889135 TGGAGAATTCAGAGGCGGGCAGG + Intergenic
1119584165 14:75816800-75816822 CAGAGGAGTCAGTGTGGGGCAGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120346368 14:83295956-83295978 GAGAGAAATCAAGGGGGGGGGGG - Intergenic
1120959787 14:90114295-90114317 CAGAGAAGTCCAAGGGGGTCTGG - Intronic
1122430011 14:101634687-101634709 CAGAGGACTCAGTGGGGAGCAGG + Intergenic
1122482413 14:102055607-102055629 TAGAGACTTCAGCGGGGGGCTGG - Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1123394696 15:19920404-19920426 AAGACAAATCAGAAGAGGGCAGG + Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1125968220 15:43891274-43891296 CAAATAAAACAGAGAGGGGCAGG + Intronic
1126468859 15:48985769-48985791 CAGAGAAAGCAGAGTGTCGCAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127114052 15:55706454-55706476 GGCAGAAATCAGAGGGTGGCCGG + Intronic
1127613792 15:60663061-60663083 CAGGGAGATCAGAGTGGGGGTGG - Intronic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131752876 15:95528266-95528288 CTGAGAAATCAGAGGGGGTGAGG - Intergenic
1131847115 15:96500019-96500041 CACAAAAATCAGAGTGGCGCTGG - Intergenic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133478916 16:6150589-6150611 CAGAGAAAATAAAGGGGGACAGG - Intronic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1133801544 16:9090071-9090093 CAGAGATAGCAGACTGGGGCAGG + Intergenic
1134014884 16:10880975-10880997 TAGAAAGATCAGAGAGGGGCCGG + Intronic
1134104806 16:11477843-11477865 CAGAGAAATCCGAGCGCTGCTGG + Exonic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1135467687 16:22701360-22701382 CTGAGAAATTTCAGGGGGGCAGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136558790 16:31025985-31026007 CAGAGACCTGAGACGGGGGCCGG + Intergenic
1137394205 16:48105585-48105607 CAGAGAAACCAGATGGGCACTGG + Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137505320 16:49049409-49049431 AGGAGAAATCCGAGGGGGGCAGG + Intergenic
1138589692 16:57993137-57993159 CGGAGATACCAGAGGGGAGCAGG + Intergenic
1139126661 16:64086475-64086497 CAAAGAAAGCAAAGGAGGGCAGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139598317 16:67970618-67970640 CTGAGAAATCTGAGGGGAGGTGG - Intergenic
1141085964 16:81095984-81096006 AACAGAAATAAGAAGGGGGCAGG + Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141929799 16:87194440-87194462 CACAGAAATAAGAAGTGGGCTGG + Intronic
1142085535 16:88178245-88178267 CAGGGAAATGAGAGAGGGGAGGG + Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142275906 16:89118799-89118821 CAGAGTTATCAGGGAGGGGCTGG + Intronic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1143256245 17:5560003-5560025 GAGAGAAATCAGAGAAAGGCAGG - Exonic
1143460665 17:7101518-7101540 CAGAGAAGCCAGAGCTGGGCAGG + Exonic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1143648601 17:8248554-8248576 CAAAAAAATCAGAGAGGGCCAGG - Intronic
1143757457 17:9077336-9077358 CAGATAAATCAGAGGTGAGAGGG + Intronic
1144038018 17:11384745-11384767 GAGAAATATCAGAGGAGGGCAGG - Intronic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145722893 17:27089694-27089716 CAGAGCAGTAAGAGGGTGGCCGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1145974507 17:28976496-28976518 CAGTGAATTCATAGAGGGGCAGG + Intronic
1147337829 17:39737974-39737996 CAGAGAAGTCAGAGGCGGGGGGG - Intronic
1147668446 17:42163388-42163410 CAGAGCAGACAGAGGGGGACTGG + Intronic
1149018543 17:51936600-51936622 GAGCGAAATGAGATGGGGGCTGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1152260812 17:79266081-79266103 CAGAGAAGGCTGAGAGGGGCGGG - Intronic
1152277014 17:79363812-79363834 CAGAGAGTTCTGAGTGGGGCAGG - Intronic
1152296133 17:79467888-79467910 CAGAGAAATCAGAGGGTCAGAGG - Intronic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153694565 18:7627195-7627217 CAGAGTAATGACAGGGTGGCTGG - Intronic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1153977126 18:10279402-10279424 GAGAAAAATCAGAGCGGGCCTGG - Intergenic
1154209219 18:12365125-12365147 CAGAGCAATCCCAGAGGGGCTGG + Intronic
1155085655 18:22455180-22455202 AAGAGAACTCAGAGGAGGGCTGG + Intergenic
1157297939 18:46459499-46459521 CAGAGAATTGGGAGGGGGGAGGG - Exonic
1157556987 18:48619384-48619406 CTGAGAAGTCAGCGAGGGGCTGG - Intronic
1158065267 18:53399607-53399629 CAAAGAAATCAGAGGGGGCCGGG + Intronic
1158694527 18:59691835-59691857 GAGAGAAATCAGAATGGGCCTGG + Intronic
1159960936 18:74555398-74555420 CCGAGCCATCAGAGGCGGGCTGG - Intronic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1160930074 19:1566417-1566439 CAGAGAAAGGTGTGGGGGGCTGG - Intronic
1160958606 19:1706842-1706864 CTCAAAAAGCAGAGGGGGGCCGG + Intergenic
1164842178 19:31400785-31400807 CAGAGAAATCCTGGGTGGGCTGG - Intergenic
1165419535 19:35716101-35716123 CAGAGAAGGCAAAGGAGGGCAGG - Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1166828762 19:45625808-45625830 CAGAGAACTCAGAGGCTGCCTGG - Intronic
1167410308 19:49340206-49340228 CAGAGAAGTCGAAGGGGTGCTGG - Intronic
1168352680 19:55685712-55685734 GAGAGAAAGCAGTGGGCGGCCGG - Intronic
925484602 2:4313811-4313833 AAGAGAAAACAGGGGGTGGCTGG - Intergenic
925964204 2:9048154-9048176 CACAGCAGTCAGAGGAGGGCTGG + Intergenic
926058489 2:9790581-9790603 TAAAGAAATAAGAGGTGGGCCGG - Intergenic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
926294681 2:11560402-11560424 CAAAGAAATAAGAAGCGGGCCGG + Intronic
926880148 2:17536715-17536737 GAGTGAAATCAGAGGAGGACTGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928133858 2:28673445-28673467 AAGAGAAAGAAGAGGAGGGCAGG + Intergenic
928359504 2:30651620-30651642 CAGAGAGATCAGAGATGGGAAGG - Intergenic
928415479 2:31088133-31088155 CAGAGAAAAAAGAGGGGCACAGG + Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929732843 2:44514135-44514157 TAGAGAAATCAGAGGGTGAATGG + Intronic
931014562 2:57961625-57961647 CAGAGTAATAAGTGGGGGGGGGG - Intronic
931193027 2:60023888-60023910 CAGTGAAATCAGAGGAGGTGAGG - Intergenic
931460587 2:62447171-62447193 CAGAGAACTCAGATGGGGAAGGG + Intergenic
932223952 2:70024437-70024459 CTGAGAGAACAGAGAGGGGCCGG + Intergenic
933876056 2:86623174-86623196 CACAGAAAGGAGAGGGGCGCGGG + Exonic
934053562 2:88232302-88232324 CAGAGAACTTAGAGGAGGGATGG - Intergenic
934133647 2:88972927-88972949 CAGGGAAATCACAGCAGGGCAGG + Intergenic
934629044 2:95895318-95895340 CGAATAAATCAGTGGGGGGCTGG - Intronic
934629458 2:95900934-95900956 CGAATAAATCAGTGGGGGGCTGG - Intronic
934629873 2:95906550-95906572 CGAATAAATCAGTGGGGGGCTGG - Intronic
934630278 2:95912163-95912185 CGAATAAATCAGTGGGGGGCTGG - Intronic
934630555 2:95915899-95915921 CGAATAAATCAGTGGGGGGCTGG - Intronic
934803636 2:97194976-97194998 CGAATAAATCAGTGGGGGGCTGG + Intronic
934832991 2:97551208-97551230 CGAATAAATCAGTGGGGGGCTGG - Intronic
935077726 2:99761977-99761999 AAGAGAAACAAGATGGGGGCAGG - Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936795343 2:116196536-116196558 CAGCGGAATGGGAGGGGGGCAGG - Intergenic
937061072 2:118980861-118980883 CAGAGGACTCAGAAGGGGACAGG + Intronic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937257961 2:120568197-120568219 CAGAGAAGCCAGAGGGGAGGTGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938379262 2:130827436-130827458 CAGAGAAGTCATCGGGGGTCAGG - Intergenic
939316511 2:140557550-140557572 CAGAGAGGTCACAGGGGGTCAGG - Intronic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942134999 2:172916381-172916403 CAGAGAGAGCAGAGGAGGACTGG - Intronic
942454108 2:176125721-176125743 AAGAAAAAGCATAGGGGGGCTGG + Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
944034929 2:195283123-195283145 TAGAGACATTAGAGGGAGGCTGG - Intergenic
944359880 2:198841367-198841389 CTGAGAAAGCAGAGTAGGGCAGG + Intergenic
946063652 2:216967867-216967889 CAGAGAAATGCAAGGGGGGTTGG + Intergenic
948125676 2:235563276-235563298 CAGACACAGCAAAGGGGGGCAGG - Intronic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169376112 20:5067748-5067770 AAAAAAAAGCAGAGGGGGGCTGG - Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170323183 20:15124747-15124769 CAAAGAAATGAGATGGGGGAAGG - Intronic
1170647931 20:18213296-18213318 CAGAGAACTCAGGGCAGGGCAGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1171511266 20:25686476-25686498 GAGAGAAGTCAGAGGGTGGCTGG + Exonic
1173415002 20:42847373-42847395 GCCAGAAATCAGAGGGGGGCGGG - Intronic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175284991 20:57831840-57831862 CAGAGCAACCATAGAGGGGCAGG - Intergenic
1175581632 20:60104347-60104369 CAGAGAATTCAGTGGAGTGCAGG - Intergenic
1176838817 21:13820683-13820705 AAGAGAACTCAGAGGCTGGCAGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1181642548 22:24211031-24211053 AAGAGAACTCAGAGGCTGGCGGG - Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182453061 22:30432623-30432645 CAGGGAAATAAGGGGGGGGCGGG - Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1183699712 22:39444439-39444461 AGGAGAAATCACTGGGGGGCAGG + Intergenic
1183774810 22:39957002-39957024 GAGAGAAGTCAGCGGGGGGAAGG + Intronic
1183818472 22:40323962-40323984 CTGAGAAGTCAGGGTGGGGCAGG - Exonic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184191816 22:42900027-42900049 CAGAGAGCTGAGATGGGGGCAGG - Intronic
1185331062 22:50252226-50252248 CAGAGAGACCAGTGAGGGGCAGG - Intronic
949908926 3:8884093-8884115 CAGAGAAGGCAGAGCGGGGTTGG - Intronic
950055574 3:10021550-10021572 CAGAGACAACAGTGGGTGGCAGG - Intergenic
950473318 3:13199722-13199744 CGGAGGACTCAGATGGGGGCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951105457 3:18736854-18736876 CAGAGAATTCAGAGGGTTTCTGG + Intergenic
953044505 3:39282500-39282522 CAGAGAAATGAGAGTGTGGTGGG + Intergenic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
953663104 3:44905398-44905420 CAGAGATGTCAGGGAGGGGCCGG - Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
955279193 3:57578117-57578139 CAGAGTAATAAAAGGGGGGTGGG + Intronic
956558222 3:70544267-70544289 CAGAGAAATCCTAGGCAGGCAGG - Intergenic
956920903 3:73928059-73928081 AAGAGAAATCTGAGGGGGAAAGG + Intergenic
957758335 3:84522393-84522415 CAGTGATATGAGACGGGGGCGGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959090934 3:101901980-101902002 CAGAGAAAACAGGGGCGGGAAGG - Intergenic
960822384 3:121749001-121749023 CCCAGGAATCAGAGGTGGGCAGG - Intronic
961171713 3:124801975-124801997 CAGAGAAAGCCGGGGTGGGCTGG - Intronic
961976082 3:131026773-131026795 CGGAGAAAGCAGAGGAGGACCGG - Exonic
964678059 3:159305366-159305388 CAGAGAAAACAGAGGCTGACAGG + Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965389561 3:168088707-168088729 GAGAGAAACCAGAAGAGGGCAGG - Intronic
966852906 3:184175479-184175501 CAGAGTAATGAGAGGGTGGTAGG - Intronic
967194229 3:187012724-187012746 GAGAGAAATCACAGGCAGGCTGG - Intronic
968287047 3:197514854-197514876 CAGGGAAATCACAGGGGAGGTGG + Intronic
969132517 4:5002266-5002288 CAGACAAATAAAAGAGGGGCAGG - Intergenic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970946369 4:21697784-21697806 CAGACCATTCAGAGGGAGGCGGG + Intronic
971500584 4:27314023-27314045 CAGAGCAATCAGAGAAGGGATGG + Intergenic
972784162 4:42311548-42311570 CAGAGACAGCAGAGTGGGTCTGG + Intergenic
973707626 4:53595709-53595731 CAGGGAAATCTAAGGGGGGAAGG + Intronic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
976431883 4:84971876-84971898 CTGAGAACCCAGAGGGGAGCTGG + Intergenic
977094455 4:92722139-92722161 GAGAGACATCAGAGGGGGACTGG + Intronic
979245473 4:118499016-118499038 CATAGAACTCAGAGGAAGGCAGG + Intergenic
981677041 4:147354253-147354275 AAGAGAAATAGGAGGAGGGCTGG - Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985577807 5:681816-681838 CACAGACCTCAGAGTGGGGCAGG + Intronic
985592744 5:773968-773990 CACAGACCTCAGAGTGGGGCAGG + Intergenic
985861742 5:2476877-2476899 GAGAGAAATGAGAGGGAGGGAGG + Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
988918108 5:35915860-35915882 CAGAGCAATCAGACAGGAGCAGG + Intronic
989317673 5:40102029-40102051 CAGTGATATAAGAGGGGAGCAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989444364 5:41510356-41510378 CAGATAAAGCAGGGCGGGGCAGG + Intronic
989640815 5:43581223-43581245 AAGAGAACTCAGAGGCTGGCGGG + Intergenic
991976661 5:72189842-72189864 CAGGGAACTCAGAGTCGGGCTGG + Intronic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
994943704 5:106358409-106358431 CAGAGAAATCAGAGTTGAGATGG + Intergenic
995843016 5:116462618-116462640 CAAAGAAATCAGAAGGGCACTGG + Intronic
995852828 5:116563902-116563924 CAGAGATATCTGAGGGGAGGTGG + Intronic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996897105 5:128498016-128498038 GTGAGACATCAGAGGGAGGCAGG + Intronic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997765197 5:136496031-136496053 AAAAGAAATCAGAGATGGGCTGG - Intergenic
999054283 5:148557161-148557183 CAGAGTAATGACATGGGGGCAGG + Intronic
999388567 5:151173717-151173739 CAGAGAAAACAGGGTGGGTCTGG - Intergenic
999771521 5:154779802-154779824 TAGAGAATGTAGAGGGGGGCTGG - Intronic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1002061537 5:176628644-176628666 CTGAGTAATAAGAGGGGGGCAGG - Intronic
1002316834 5:178349236-178349258 CAGAGAAATAACAGGGGCACAGG + Intronic
1002468384 5:179419983-179420005 CAAAAAAATCATAGTGGGGCTGG + Intergenic
1002529203 5:179833835-179833857 CGCTGAAATCAGAGGAGGGCAGG - Intronic
1002830652 6:817448-817470 CAGGGAAATCTGAGTGGGGTTGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003902259 6:10665511-10665533 CAAAGAAATCAGAGAGGGGCTGG - Intergenic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004390109 6:15202849-15202871 AAGAGAAATGAGAAGGGGTCAGG + Intergenic
1005755581 6:28922989-28923011 CAGAGAAAAGAGAGTGGGGGTGG + Intronic
1006109364 6:31735381-31735403 CGCTGCAATCAGAGGGGGGCTGG + Intronic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1007710045 6:43817098-43817120 CACAGAAATCAGTGTGTGGCAGG + Intergenic
1008023808 6:46610876-46610898 TAAAGAAATCAGACTGGGGCAGG - Intronic
1008276843 6:49551855-49551877 AAGAGAAACAAGAGGGGGGCGGG - Exonic
1008613463 6:53205035-53205057 CAGAGAGATAGGAAGGGGGCAGG - Intergenic
1010823352 6:80442996-80443018 CAGAGATATCAGTGTGTGGCTGG + Intergenic
1010853785 6:80812422-80812444 CAAAGTAATTAGAGGTGGGCAGG + Intergenic
1010947350 6:81991785-81991807 CAGAGAAATCAAAACTGGGCTGG + Intergenic
1011702382 6:89967827-89967849 CAGAGAGATCATGGAGGGGCAGG - Intronic
1013971067 6:116019007-116019029 GAGATAAGTCAGAGGGGAGCTGG - Intronic
1014801015 6:125778009-125778031 AAGAGTAGTCAGAGAGGGGCCGG - Intergenic
1015540320 6:134306899-134306921 CAAAGAAATAAAAGGGGGGGGGG + Intronic
1015589611 6:134810437-134810459 CAGAGAAAGAAGAGGAGGGAGGG - Intergenic
1015599361 6:134897334-134897356 CAGAAAAATCAGAGCAGGACAGG - Intergenic
1017679251 6:156846857-156846879 GACAGGAATCAGAGGGTGGCGGG - Intronic
1017903488 6:158738477-158738499 CAGAGAAGGCAGGGGAGGGCAGG - Intronic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019980711 7:4619941-4619963 CAGAGAATGCAGAGGATGGCGGG + Intergenic
1022454531 7:30546777-30546799 CAAAAAAATCAGAGGTGGTCTGG + Intronic
1024462463 7:49672509-49672531 CTTAGTAATCAGACGGGGGCTGG - Intergenic
1026490333 7:70857596-70857618 CAGAGGAGTCAGAGGGTGGTTGG + Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026879789 7:73901159-73901181 CCGAGAAATAACAGGGAGGCCGG - Intergenic
1027176566 7:75907674-75907696 CAGAGAAACAGGAGGGGGGGTGG - Intronic
1028069243 7:86430580-86430602 CATATAAATCAGAGGAGGGGAGG - Intergenic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028774191 7:94658635-94658657 CAGAGAAACCGCAGGGGGGCGGG - Intronic
1029463524 7:100710704-100710726 CAGAGAGATCACAGTGGGGCGGG + Intergenic
1029490528 7:100867826-100867848 AAGAGAAATCAAAGGTGGGGTGG - Intronic
1030923642 7:115423677-115423699 CACAGAAGTCAGATGGGTGCTGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032727837 7:134607602-134607624 GAGTTAAATCAGAGTGGGGCAGG - Intergenic
1033330643 7:140414336-140414358 CAGAGATAGCACAGAGGGGCCGG - Intronic
1033437609 7:141347713-141347735 CAGAGAAGGCAGACGGGGGGTGG - Intronic
1033544929 7:142391389-142391411 CAGAGAACTCAGCGGAGGGGTGG + Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034977452 7:155456737-155456759 TAGAGAAGTTAGAGGGGGGCGGG + Intergenic
1035220054 7:157401074-157401096 CAGAGAAATCAGAGGCGAGGAGG - Intronic
1035344614 7:158190000-158190022 GAGAGGAATCAGAGGGCGCCAGG - Intronic
1035660220 8:1342103-1342125 CAGAAAAATCAGCTGGGGGTAGG - Intergenic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036657031 8:10683375-10683397 CTGAGAAATCAGATGTGGGAAGG - Intronic
1036807342 8:11844693-11844715 CACAGAAATCAGAGGAGAGACGG - Exonic
1037817254 8:22118781-22118803 CAGAGAAGGCAGAGGGGACCCGG - Intronic
1039284315 8:36023964-36023986 GAGAAAAACCAGATGGGGGCCGG + Intergenic
1039811803 8:41055518-41055540 CAGAGAAGACAGGGGTGGGCAGG - Intergenic
1042388526 8:68204974-68204996 AAAAGAAAGCAGAGGGGGCCGGG - Intronic
1042472611 8:69208714-69208736 CTGAGAAATCTGAAGGGAGCTGG - Intergenic
1042494336 8:69439316-69439338 AAGGGAAATCAGGGTGGGGCAGG + Intergenic
1047198396 8:122742581-122742603 GAGAAAAATCAGAGAAGGGCAGG - Intergenic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047723765 8:127666952-127666974 AAGAGAAATCAGAGAGTGGATGG - Intergenic
1049318263 8:141981191-141981213 CAGAGAGCTCAGTGCGGGGCTGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050107920 9:2184801-2184823 CAGAGACATCAGAGTTGAGCTGG - Intronic
1051082264 9:13307387-13307409 CAGGGAAATCAAAGAGGGGAGGG - Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055062989 9:72090195-72090217 CTGAGAACCCAGAGGGGCGCTGG - Intergenic
1055130772 9:72771604-72771626 GAGAGAAGTAAGAGGGGAGCTGG + Intronic
1055144778 9:72920443-72920465 TAGAGAAATCAAAGGGTGACAGG - Intronic
1055404098 9:75956338-75956360 CAGATAAATCAGGGAGGTGCTGG + Intronic
1055462245 9:76529981-76530003 CAGAAAAATCTGACTGGGGCTGG + Intergenic
1056163153 9:83918315-83918337 GAGAGAAATGGGGGGGGGGCAGG + Intronic
1058623178 9:106905449-106905471 GAGAGAGACCAGAGGTGGGCGGG + Intronic
1060727019 9:126013082-126013104 CAGTGAACTCAGCGAGGGGCAGG - Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1062477603 9:136736399-136736421 CAGAGACATCGAAGGGGGGCCGG + Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186898752 X:14031461-14031483 CAGATAAGTCAGATGGGGCCTGG + Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1188839564 X:34999417-34999439 CAGATAAATCACAGGTGAGCTGG + Intergenic
1189089881 X:38070509-38070531 GAGAGAAACCAGAGGTAGGCAGG - Intronic
1189722339 X:43933174-43933196 GAGAGGATTCAGAGGGTGGCTGG - Intergenic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1194153116 X:90351110-90351132 CAGACATATCTGTGGGGGGCGGG - Intergenic
1194154052 X:90364514-90364536 CAAAGAAATCAGAGATGGGCTGG - Intergenic
1197046596 X:122004772-122004794 AATAAAAATCACAGGGGGGCAGG - Intergenic
1197556491 X:127961541-127961563 CAGAGAAATCAGAGAAGAGAAGG - Intergenic
1198129659 X:133680990-133681012 CATAAAAATGAGAGGGGGGTAGG + Intronic
1198789537 X:140328576-140328598 AAGAGTAATGAGAGGGCGGCCGG - Intergenic
1200110216 X:153737131-153737153 CAGAGACAGCACAGCGGGGCTGG - Intronic
1200230011 X:154439162-154439184 CAGAGAAATCATGGGGTGGCAGG + Intronic
1200500404 Y:3941397-3941419 CAAAGAAATCAGAGATGGGCTGG - Intergenic
1200856369 Y:7942901-7942923 GAGTGACCTCAGAGGGGGGCTGG + Intergenic